Previous Article | Next Article ![]()
Molecular and Cellular Biology, April 2002, p. 2524-2535, Vol. 22, No. 8
0270-7306/02/$04.00+0 DOI: 10.1128/MCB.22.8.2524-2535.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Couples the B-Cell Antigen Receptor to Distal Signaling Pathways
Committees on Immunology,1 Cell Physiology,3 Section of Rheumatology, University of Chicago, Chicago, Illinois 60637,2 Department of Microbiology and Immunology, University of British Columbia, Vancouver, British Columbia V6T 1Z3, Canada,4 Nestec Ltd. Research Centre, Lausanne, Switzerland,5 Howard Hughes Medical Institute, Washington University School of Medicine, St. Louis, Missouri 63110,6 Institute for Systems Biology, Seattle, Washington 981957
Received 6 November 2001/ Returned for modification 18 December 2001/ Accepted 24 December 2001
| ABSTRACT |
|---|
|
|
|---|
(Ig
) and Igß recruit Syk to initiate signaling cascades. The coupling of Syk to several distal substrates requires linker protein BLNK. However, the mechanism by which BLNK is recruited to the BCR is unknown. Using chimeric receptors with wild-type and mutant Ig
cytoplasmic tails we show that the non-immunoreceptor tyrosine-based activation motif (ITAM) tyrosines, Y176 and Y204, are required to activate BLNK-dependent pathways. Subsequent analysis demonstrated that BLNK bound directly to phospho-Y204 and that fusing BLNK to mutated Ig
reconstituted downstream signaling events. Moreover, ligation of the endogenous BCR induced Y204 phosphorylation and BLNK recruitment. These data demonstrate that the non-ITAM tyrosines of Ig
couple Syk activation to BLNK-dependent pathways. | INTRODUCTION |
|---|
|
|
|---|
/Igß heterodimer activates key signaling molecules including phospholipase C-
(PLC-
), Ras, Rac, extracellular signal-regulated kinase (ERK), and c-Jun NH2-terminal kinase (JNK) (7, 11, 13, 27, 32). Coordinated activation of these effectors controls cell differentiation, proliferation, and development.
BCR aggregation induces phosphorylation of conserved tyrosines in the immunoreceptor tyrosine-based activation motifs (ITAMs) (8, 48) present in the cytoplasmic tails of Ig
and Igß (20, 25). ITAM phosphorylation is mediated by Src family tyrosine kinases assembled with the resting BCR (6, 16). Although Ig
and Igß both contain ITAMs, Igß may serve to regulate Ig
phosphorylation rather than initiate primary signaling (15, 36, 42, 51). Once phosphorylated, the Ig
ITAM recruits and activates the tyrosine kinase Syk (50), which is both necessary (38, 49) and sufficient (37) to initiate many BCR-mediated signaling pathways. While the processes regulating Syk activation are well defined, the mechanisms linking Syk to downstream effectors are unclear.
The linker protein BLNK (21), also known as SLP-65 (63) and BASH (22), is preferentially expressed in B cells. BLNK phosphorylation is dependent on Syk, and cotransfection studies indicate that BLNK is a direct substrate (21, 22, 28, 63). Deletion of BLNK in DT40 cells blocks BCR-induced JNK and PLC-
2 activation (30). Expression of BLNK is required for normal B-cell development in mice (33, 34, 47, 64) and has been implicated in human immunodeficiency (43).
BLNK contains a carboxy-terminal Src homology 2 (SH2) domain, a proline-rich region, and 13 potential tyrosine phosphorylation sites (21). Six of these tyrosines are part of YXXP motifs, predicted to bind the SH2 domains of PLC-
, Vav, and Nck (55, 56). In addition, the SH2 domain of Btk binds to phosphorylated BLNK in vitro (28), and the proline-rich region is predicted to bind the SH3 domain of Grb2 (3). Although these molecules can be coimmunoprecipitated with BLNK following receptor ligation, specific binding sites on BLNK have not been definitively identified.
BLNK and related T-cell adapter protein SLP-76 act as scaffolds to integrate the activation of multiple signaling cascades (17, 21, 31). For example, the coassembly of Vav and Nck on SLP-76 directly couples the guanine nucleotide exchange factor activity of Vav to Nck-associated serine/threonine kinase Pak to facilitate JNK activation and actin polymerization (61). A possible integration point coordinated by BLNK is at PLC-
2, which requires both Syk and Btk for full activation (57, 58).
A simple way in which BLNK could be brought into proximity to Syk is through direct recruitment to the BCR. In addition to the ITAM tyrosines, Ig
contains two additional tyrosines, Y176 and Y204, which flank the ITAM (9) and which, we now report, function to recruit BLNK. Mutation of these tyrosines uncoupled a chimeric receptor from BLNK-dependent pathways. Subsequent analysis demonstrated that Y204 was phosphorylated following receptor ligation and bound directly to the SH2 domain of BLNK. In addition, fusion of BLNK to the carboxy-terminal tail of mutant Ig
rescued distal signaling. These data provide a model in which the recruitment of BLNK to Ig
links Syk activation to downstream pathways.
| MATERIALS AND METHODS |
|---|
|
|
|---|
chimera has been previously described (42). Single tyrosine-to-phenylalanine mutations at residue 176 or 204 of Ig
were generated by site-directed mutagenesis with the Altered Sites system (Promega). The double tyrosine-to-phenylalanine mutations at residues 182 and 193 or residues 176 and 204 were generated by complementary-primer PCR (54). To fuse BLNK to the carboxy terminus of PDGFRß/Ig
176,204, DNA containing the open reading frame of BLNK was first amplified by PCR from murine cDNA. The 5' primer contained an EcoRI site, and the 3' primer contained an XhoI site and an in-frame stop codon. These sites were used to clone the BLNK DNA 3' to cDNA encoding PDGFRß/Ig
176,204. All constructs were cloned into a modified pcDNA3 expression vector (Invitrogen) in which the cytomegalovirus promoter had been replaced with the thymidine kinase promoter and µ heavy chain enhancer (54). Plasmids were transfected into A20IIA1.6, an Fc receptor-
RII-negative B-cell lymphoma, by electroporation and grown by plating at limiting dilution in medium containing 1.2 mg of G-418 (Gibco-BRL)/ml. For transfection of full-length murine Ig
into J558Lµm cells (J. Cambier, National Jewish Center, Denver, Colo.), murine Ig
cDNA was obtained from A20IIA1.6 cells by first isolating total RNA with the RNeasy kit (Qiagen), followed by reverse transcription-PCR utilizing random hexamer primers (First Strand cDNA kit; Pharmacia). The entire open reading frame of Ig
was amplified with primers containing an EcoRI site at the 5' end and an XhoI site and an in-frame stop codon at the 3' end. After the Ig
open reading frame was cloned into pGEM (Promega) and sequenced, the Y204F mutant was created by PCR with the following 3' primer, with the mutated base underlined (TAC [tyrosine]) to TTC ([phenylalanine]): GGGGCTCGAGTCATGGCTTTTCCAGCTGGGCATCTCCAATGTGGAGGTTGCCCACATCCTGGAAGGTGCCCTGGAG. After ligation into pGEM and sequencing, both the wild type and Y204F mutant were cloned into the green fluorescent protein (GFP) containing retrovirus vector MIGR1 (H. Singh, University of Chicago), modified to include an altered multiple cloning site between the EcoRI and XhoI sites. J558Lµm cells were transfected with these clones by using retrovirus collected from packaging cell line GP-293 (Clontech), and productive infection was confirmed by both flow cytometry (for GFP) and protein blotting (for Ig
). Cell culture and generation of clones. Cells were grown in Iscove's modified Dulbecco's medium (IMDM) (Gibco-BRL) supplemented with 10% fetal calf serum (FCS; HyClone), 2 mM glutamine, 100 U of penicillin/ml, and 10 µg of streptomycin/ml (Gibco-BRL) at 37°C in 5% CO2. Clones were screened by fluorescence-activated cell sorter with an antibody that recognizes the extracellular domain of PDGFRß (R&D Systems), followed by a fluorescein isothiocyanate (FITC)-coupled anti-mouse IgG1 antibody (Zymed). Cells were tested for BCR expression by staining with a FITC-labeled rabbit anti-mouse IgG antibody (Zymed).
Cell stimulations.
Cells (1.5 x 107) were resuspended in 0.4 ml of serum-free media, the ligand and antibodies were added on ice, and the cells were then transferred to 37°C for various lengths of time. To stimulate the PDGFRß/Ig
chimera, platelet-derived growth factor BB (PDGF-BB; Sigma) was first added to a final concentration of 1 µg/ml and the cells were incubated for 5 min. The cells were then sequentially incubated with an anti-PDGFRß antibody (final concentration, 10 µg/ml) for 3 min and with rabbit anti-mouse IgG1 antibodies (20 µg/ml) for 5 min. To stimulate the BCR, rabbit anti-mouse IgG (Jackson) was added for 5 min at a final concentration of 20 µg/ml. In experiments assaying the association of BLNK with endogenous Ig
/Igß, cells were first warmed to 37°C and then stimulated with rabbit anti-mouse IgG (A20IIA1.6 cells) or goat anti-mouse IgM (WEHI-231 cells) (Jackson Laboratories) for 2 min. In all cases, reactions were terminated by the addition of ice-cold phosphate-buffered saline (PBS). For the J558Lµm experiment, cells (4 x 106) were stimulated with 20 µg of goat anti-mouse IgM/ml for 3 min at 37°C.
Immunoprecipitations and immunoblotting.
Stimulated cells were washed with ice-cold PBS and lysed in 1 ml of modified radioimmunoprecipitation assay buffer (1% NP-40, 0.1% sodium dodecyl sulfate [SDS], 0.5% deoxycholate, 150 mM NaCl, 10 mM Tris [pH 7.3], 10 mM Na4P2O7, 0.4 mM Na3VO4, 0.4 mM EDTA, 10 mM NaF, 1 mM phenylmethylsulfonyl fluoride [PMSF], and 1 µg each of aprotinin, leupeptin, and
-1-antitrypsin/ml) for 20 min on ice. Lysates were clarified by centrifugation, precleared with protein A- and G-Sepharose, and then subjected to immunoprecipitation with protein A- and G-Sepharose-coupled antibodies at 4°C. The beads were boiled in Laemmli SDS sample buffer, subjected to SDS-polyacrylamide gel electrophoresis (PAGE), and transferred to polyvinylidene difluoride membranes (Millipore), which were then blocked in 3% bovine serum albumin-Tris-buffered saline with 1% Triton X-100 (TBST). Membranes were then incubated with the antibodies listed in the figure legends, washed with TBST, incubated with horseradish peroxidase-labeled secondary antibodies (Amersham), and then washed with TBST. ECL (Amersham) was used to visualize immunoreactive proteins. To strip blots, membranes were incubated in TBST-0.4% SDS, pH 2.5, for 1 h at room temperature before being washed and reblotted as described above. Antibodies utilized included antiphosphotyrosine antibody 4G10 (Upstate Biotechnology), anti-ERK (Zymed), anti-phospho-ERK (Promega), anti-PLC-
2 (Santa Cruz Biotechnology), and anti-Igß extracellular domain (Pharmingen). Anti-Syk and anti-BLNK antisera were generated by immunizing rabbits (Strategic Biosolutions) with glutathione S-transferase (GST) fusion proteins containing the hinge region of Syk (gift from J. Cambier, National Jewish Center) and the BLNK SH2 domain, respectively. For some experiments, anti-BLNK antiserum purified against GST-BLNK-SH2 bound to Sepharose was used. The anti-Ig
antisera have been described previously (42).
Syk kinase assay.
Cells (5 x 106) were stimulated and lysed in lysis buffer (50 mM Tris-HCl [pH 7.4], 1% Brij 96, 150 mM NaCl, 5 mM EDTA, 1 mM Na3VO4, 1 µg of leupeptin and aprotinin/ml). After clarification by centrifugation, lysates were incubated for 2 h at 4°C with anti-Syk antibodies bound to protein A-Sepharose. Immunoprecipitates were washed three times in 700 µl of wash buffer (25 mM HEPES [pH 7.4], 0.1% Brij 96, 150 mM NaCl, 1 mM Na3VO4) and twice in wash buffer without Brij 96 (5). Washed immunoprecipitates were then incubated with 4 µg of GST-Ig
cytoplasmic tail (1) in kinase buffer (25 mM HEPES [pH 7.5], 10 mM MnCl2, 20 mM p-nitrophenylphosphate, 10 µCi of [
-32P]ATP) for 3 min at 30°C. Samples were immediately boiled in 2x Laemmli sample buffer and separated by SDS-PAGE. Phosphorylation of GST-Ig
was detected by autoradiography.
JNK kinase assay.
Cells were stimulated and lysed in lysis buffer (25 mM HEPES [pH 7.7], 300 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.1% Triton X-100, 0.5 mM dithiothreitol [DTT], 20 mM ß-glycerolphosphate, 0.1 mM Na3VO4, 2 µg of leupeptin/ml, 100 µg of PMSF/ml) on ice for 30 min. The cell lysates were clarified by centrifugation and incubated with GST-c-Jun coupled to glutathione-Sepharose beads for 3 h at 4°C. The beads were washed four times with HEPES binding buffer (20 mM HEPES [pH 7.7], 50 mM NaCl, 2.5 mM MgCl2, 0.1 mM EDTA, 0.05% Triton X-100, 0.1 mM Na3VO4, 2 µg of leupeptin/ml, 100 µg of PMSF/ml), resuspended in 30 µl of kinase buffer (20 mM HEPES [pH 7.6], 20 mM MgCl2, 20 mM ß-glycerolphosphate, 20 mM p-nitrophenylphosphate, 0.1 mM Na3VO4, 2 mM DTT, 20 µM ATP, 5 µCi of [
-32P]ATP), and incubated at 30°C for 15 min. The beads were washed with HEPES binding buffer, resuspended in 50 µl of Laemmli SDS sample buffer, boiled, and subjected to SDS-PAGE. Dried gels were exposed to X-ray film for autoradiography.
Intracellular calcium mobilization.
Cells (107) were incubated in IMDM with 10% FCS in the presence of 4 µM fluo-3 and 10 µM Fura red (Molecular Probes) for 45 min at 37°C (45). Cells expressing the PDGFRß/Ig
chimeric proteins were washed, resuspended in 300 µl of IMDM with 10% FCS, warmed to 37°C in the presence of PDGF-BB, and stimulated by addition of anti-PDGFRß and rabbit anti-mouse IgG1 antibodies. BCR signaling was initiated with rabbit anti-mouse IgG antibodies. Data were collected as histograms of fluorescence over time on a BD LSR flow cytometer. The fluo-3/Fura red ratio versus time was plotted with Multitime software (Phoenix Flow Systems, San Diego, Calif.).
Peptides. Peptides were synthesized at the University of Chicago Cancer Research Center Peptide Core Facility. The sequence flanking tyrosine 176 is MPDDYEDENLY, and the sequence flanking tyrosine 204 is LQGTYQDVGNL. The peptides were synthesized with or without a phosphate group on the tyrosine corresponding to the fifth residue of each peptide. One microgram of peptide was covalently coupled to 1 ml of a 50% slurry of N-hydroxy-succinimide-activated Sepharose 4 Fast Flow (Pharmacia) for precipitation studies in accordance with the manufacturer's directions.
GST fusion proteins. The coding sequence for the SH2 domain of BLNK (amino acid residues 324 to 456) was cloned into pGEX3X (Pharmacia). The plasmid encoding GST-c-Jun was generously provided by Marsha Rosner (University of Chicago). Bacteria containing the GST fusion protein constructs were grown in Luria-Bertani medium containing ampicillin. Expression of the fusion proteins was induced by the addition of IPTG (isopropyl-ß-D-thiogalactopyranoside) to a final concentration of 0.1 mM for 3 h at 37°C. The cells were harvested and resuspended in ice-cold PBS with 1% Triton X-100 and 1 mM PMSF. Cells were then frozen at -80°C, thawed at 37°C, and sonicated for maximum lysis. Insoluble debris was pelleted by centrifugation. Glutathione-Sepharose beads were added to the supernatant and incubated at 4°C for 2 h. The beads were then washed in PBS. Fusion proteins were eluted with 10 mM reduced glutathione in 10 mM Tris-HCl (pH 8), dialyzed against PBS, and quantitated by SDS-PAGE and Coomassie staining.
GST fusion protein binding assays. For far-Western blotting, the eluted fusion protein was used to probe transferred membranes at a concentration of 4 µg/ml in 5% milk-TBST at 4°C overnight. Blots were washed extensively and then blotted sequentially with rabbit anti-GST (Zymed) and horseradish peroxidase-labeled anti-rabbit IgG (Amersham). For pull-down assays, 10 µg of fusion protein bound to glutathione-Sepharose was used for each precipitation.
In vivo phosphopeptide mapping.
For in vivo labeling, 107 WEHI-231 cells were incubated with 1.5 mCi of 32PO4 (Amersham) in phosphate-free medium for 1.5 h at 37°C (23). The cells were stimulated with 50 µg of goat anti-mouse IgM antibodies/ml for 5 min and then lysed in a solution containing 20 mM Tris-HCl (pH 8), 137 mM NaCl, 10% glycerol, 2 mM EDTA, 1% Triton X-100, 1 mM Na3VO4, 1 mM PMSF, 10 µg of leupeptin/ml, and 1 µg of aprotinin/ml. After insoluble debris was removed by centrifugation, SDS was added to a final concentration of 0.3% and sodium deoxycholate was added to a final concentration of 0.4%. Ig
/Igß was immunoprecipitated with rabbit polyclonal antibodies directed against the cytoplasmic tail of Ig
. Immunoprecipitations were resolved by two-dimensional (2D) nonreducing and reducing SDS-PAGE, and Ig
was identified by autoradiography. Gel slices containing Ig
were excised and digested with V8 protease. Recovered peptides were resolved by thin-layer electrophoresis (TLE) in the first dimension and ascending thin-layer chromatography in the second dimension as described previously (23). Plates were then subjected to autoradiography. To identify each phosphorylated peptide, a synthetic peptide corresponding to the entire cytoplasmic domain of Ig
was labeled in vitro with baculovirus-produced Lck, digested with V8 protease in solution, and then subjected to 2D phosphopeptide mapping. Radiolabeled spots were eluted from the thin-layer chromatography (TLC) plate and sequenced by tandem mass spectrometry.
| RESULTS |
|---|
|
|
|---|
contains four tyrosines, two within the ITAM (Y182 and Y193) and two flanking the ITAM (Y176 and Y204). While the importance of the ITAM tyrosines has been demonstrated (20, 46), we postulated that phosphorylation of Y176 and/or Y204 might contribute to the activation of receptor-dependent signaling pathways. Therefore, we constructed cDNAs encoding chimeric proteins in which the extracellular and transmembrane domains of the PDGFRß chain were fused to wild-type or mutant Ig
cytoplasmic tails (Fig. 1A). The mutant tails contained tyrosine-to-phenylalanine mutations at both ITAM tyrosines (Ig
182,193) or at one or both non-ITAM tyrosines (Ig
176, Ig
204, or Ig
176,204). Stable clones of murine B-cell lymphoma A20IIA1.6 cells expressing each chimera were derived. Flow cytometry was used to select clones expressing similar levels of PDGFRß and the endogenous BCR for further analysis (Fig. 1B).
|
chimeras to induce tyrosine phosphorylation, cells from each line were stimulated through the BCR or through each chimera for 2 min and analyzed for inductive protein tyrosine phosphorylation. Cross-linking PDGFRß/Ig
induced a pattern of tyrosine phosphorylation similar to that for the corresponding endogenous BCR (Fig. 2A). As expected, stimulation of PDGFRß/Ig
182,193, in which both ITAM tyrosines were mutated, induced no detectable cytosolic phosphorylation. Interestingly, mutation of Y204 and, to a lesser degree, Y176 resulted in a selective defect in the phosphorylation of at least four proteins with relative molecular masses of approximately 42, 52, 65, and 75 kDa. Similar results were observed when cells were stimulated for 1 or 5 min (data not shown).
|
ITAM tyrosines is required to recruit and activate Syk (38, 50), it was possible that mutating Y176 and/or Y204 compromised Syk activation. Therefore, cells from each line were stimulated through their respective chimeras, lysed, and immunoprecipitated with anti-PDGFRß (Fig. 2B) or anti-Syk antibodies (Fig. 2C and D). Immunoblotting with antiphosphotyrosine antibodies revealed that stimulation through the wild-type chimera and chimeras bearing Y176 and/or Y204 mutations induced similar levels of both chimera and Syk phosphorylation (Fig. 2B and C). In addition, Syk kinase activity, as measured by phosphorylation of the exogenous substrate GST-Ig
cytoplasmic tail, paralleled the phosphorylation status of Syk (Fig. 2D).
Downstream of Syk, the activation of PLC-
2 generates inositol-1,4,5-triphosphate, which, through specific receptors on the endoplasmic reticulum, mobilizes intracellular calcium stores (53, 60). Therefore, we next investigated whether the different chimeric receptors could induce PLC-
2 phosphorylation. Cells from each line were stimulated through the BCR or their respective chimeric receptors, and PLC-
2 immunoprecipitates were analyzed for tyrosine phosphorylation (Fig. 3A). Cross-linking either PDGFRß/Ig
, PDGFRß/Ig
176, or PDGFRß/Ig
204 induced robust phosphorylation of PLC-
2. In contrast, mutation of both non-ITAM tyrosines reduced PDGFRß/Ig
-mediated PLC-
2 phosphorylation. We next assayed the ability of each chimeric complex to increase intracellular calcium. As seen in Fig. 3B, the requirements for calcium mobilization paralleled those for PLC-
2 phosphorylation. Mutation of either Y176 or Y204 had minimal effects on the ability of PDGFRß/Ig
to mobilize intracellular calcium. However, mutation of both Y176 and Y204 severely inhibited calcium mobilization. Similar results were obtained with independently derived clones (data not shown). These data indicate that the non-ITAM residues are redundant for PLC-
2 activation.
|
2 activation (30, 33, 47). Therefore, we next examined whether Ig
-mediated BLNK phosphorylation was dependent on the Ig
non-ITAM tyrosines. BLNK immunoprecipitates from the lysates of chimera- or BCR-stimulated cells were analyzed for tyrosine phosphorylation. As seen in Fig. 3C, BLNK was phosphorylated following stimulation by either BCR or PDGFRß/Ig
. In contrast, mutation of Y204 and, to a lesser degree, Y176, inhibited receptor-induced BLNK phosphorylation. Mutation of both tyrosines almost completely eliminated BLNK phosphorylation. Therefore, as opposed to their redundant contributions to PLC-
2 activation, both Y176 and Y204 are required for optimal receptor-induced BLNK phosphorylation.
If Y176 and Y204 contribute to PLC-
2 activation by mediating the phosphorylation of BLNK, then mutation of these tyrosines should inhibit the activation of other effectors distal to BLNK such as the mitogen-activated protein kinases JNK and ERK (30). To assay for ERK activation, whole-cell lysates of cells stimulated through the BCR, or the chimeras, were immunoblotted with anti-phospho-ERK antibodies. As seen in Fig. 3D, the activation of ERK1 and, to some degree ERK2, was diminished in cells stimulated through chimeras bearing mutations of Y204. Mutation of Y176 had a modest effect on ERK activation. The partial dependency of receptor-induced ERK activation on Y176 and Y204 may reflect the calcium-dependent and -independent pathways through which ERK can be activated in B lymphocytes (26). In contrast, BCR-induced JNK activation is fully dependent on BLNK (30). Therefore, in vitro kinase assays with GST-c-Jun, the JNK substrate, were performed. Mutation of Y204 significantly diminished PDGFRß/Ig
-mediated JNK activation. In parallel with BLNK phosphorylation and ERK activation, Y204 was the primary determinant of JNK activation (Fig. 3E). Together, these data indicate that phospho-Y176 and -Y204 make differential contributions to the coupling of BCR-initiated kinase activation to BLNK phosphorylation and BLNK-dependent signaling pathways. To explore how Y176 and Y204 mediate receptor-induced BLNK phosphorylation, we first sought to identify what proteins, if any, they bound.
BLNK is recruited directly to phospho-Y204. When phosphorylated, Y204, in the context of the three amino acids C-terminal to it, is predicted to bind group I SH2 domains (55). In contrast, the sequence flanking Y176 does not contain a consensus motif for binding either the SH2 (18) or phosphotyrosine binding (PTB) (4) domain. To determine if proteins could bind to either Y176 or Y204, we synthesized phosphorylated and nonphosphorylated peptides containing the 11 amino acids flanking these tyrosines. The peptides were covalently coupled to Sepharose beads and assayed for their ability to bind tyrosine-phosphorylated proteins from BCR-stimulated cells. As seen in Fig. 4A, a single tyrosine-phosphorylated band with a relative molecular mass of 65 kDa, suggestive of BLNK, was precipitated specifically by the phospho-Y204 peptide from the lysates of stimulated cells. When the blot was stripped and reprobed, strong BLNK immunoreactivity was detected in phospho-Y204 peptide precipitations from both unstimulated and stimulated lysates (bottom). Less BLNK was recovered from the lysates of stimulated cells than from those of unstimulated cells, possibly because of competition for the BLNK SH2 domain by other tyrosine-phosphorylated proteins in the cell lysate.
|
antibodies confirmed that the precipitated bands were the PDGFRß/Ig
chimeras (bottom). We conclude that the BLNK SH2 domain can bind to phospho-Y204, but not Y176, following receptor stimulation.
We next examined if the BLNK SH2 domain interacted directly with phospho-Y204 or required an intermediate molecule by far-Western blotting (Fig. 4C). PDGFRß immunoprecipitates from chimera-stimulated cells were blotted with either GST-BLNK-SH2 (top), GST alone (middle), or antiphosphotyrosine antibodies (bottom). Aggregation induced the tyrosine phosphorylation of all the PDGFRß/Ig
chimeras containing an intact ITAM. This suggested that Syk recruitment was required for the phosphorylation of the non-ITAM tyrosines. In contrast, GST-BLNK-SH2 bound only the PDGFRß/Ig
chimeras containing an intact ITAM as well as Y204. These data indicate that aggregation of the PDGFRß/Ig
chimera induces the phosphorylation of Y204, which then directly and specifically binds the SH2 domain of BLNK.
Utilizing the high specificity and sensitivity of the BLNK SH2 domain, we also examined the kinetics of Y204 phosphorylation (Fig. 4D). Cells expressing the PDGFRß/Ig
chimera were stimulated for the times indicated, lysed, and subjected to anti-PDGFRß immunoprecipitation. Total chimera phosphorylation, as visualized by antiphosphotyrosine blotting (top), illustrated that the phosphorylation of the chimera was transient and peaked at 2 min following stimulation. The far-Western data illustrated that Y204 was more transiently phosphorylated than the entire chimera: phosphorylation peaked at 1 min and rapidly decreased thereafter.
BLNK reconstitutes mutant receptor signaling.
Membrane recruitment of BLNK is necessary for the proper activation and assembly of downstream signaling molecules. Therefore, we next examined if constitutive membrane localization of BLNK would restore PLC-
2 phosphorylation, calcium mobilization, and JNK activation. A chimeric protein was constructed by fusing full-length BLNK to the carboxy terminus of the PDGFRß/Ig
176,204 chimera (Fig. 5A, left). A clone expressing levels of chimera and BCR similar to those expressed by the previously analyzed clones was selected and analyzed. Expression of the PDGFRß/Ig
176,204/BLNK protein was confirmed by Western blotting using both anti-BLNK and anti-PDGFRß antibodies (Fig. 5A, right). As shown previously, cross-linking of PDGFRß/Ig
induces more-robust tyrosine phosphorylation of PLC-
2 than does cross-linking of the BCR, while PDGFRß/Ig
176,204 induces minimal tyrosine phosphorylation. However, BLNK fused to PDGFRß/Ig
176,204 induced PLC-
2 phosphorylation that was significantly enhanced over that induced by PDGFRß/Ig
176,204 or the BCR (Fig. 5B). Moreover, fusing BLNK to Ig
176,204 did not merely rescue, but augmented, the magnitude of initial calcium responses (Fig. 5C). JNK and ERK activation, which is deficient when Y176 and Y204 are mutated, was also reconstituted (Fig. 5D and E). Therefore, constitutive receptor localization of BLNK reconstitutes BLNK-dependent signaling pathways.
|
through its SH2 domain.
Our results demonstrate that phosphorylation of Y204 can functionally and structurally couple PDGFRß/Ig
to BLNK. However, it is not clear if Y204 has a similar function in the intact BCR. Therefore, we examined whether the BLNK SH2 domain bound to endogenous Ig
. Lysates from unstimulated and BCR-stimulated A20IIA1.6 cells were precipitated with either anti-Igß antibodies to precipitate the Ig
/Igß heterodimer, GST-BLNK-SH2, or GST and then analyzed for tyrosine phosphorylation (Fig. 6A). Although no bands appeared in the GST precipitation, a tyrosine-phosphorylated band the size of endogenous Ig
was present in both the Igß and GST-BLNK-SH2 precipitations. Stripping and reprobing confirmed that the band was indeed Ig
. These data demonstrate that the BLNK SH2 domain can precipitate endogenous Ig
from BCR-stimulated cells.
|
and the BLNK-SH2 domain was direct. Lysates from unstimulated and BCR-stimulated A20IIA1.6 cells were precipitated with control Ig, antiphosphotyrosine, or anti-Igß antibodies and immunoblotted with either antiphosphotyrosine (left), GST-BLNK-SH2 (middle), or GST (right) (Fig. 6B). Short exposures revealed a large number of phosphoproteins in the antiphosphotyrosine immunoprecipitates of stimulated cells, and a single phosphorylated band at 33 kDa was detected in the Igß immunoprecipitation. Subsequent immunoblotting confirmed that this phosphoprotein was Ig
(data not shown). When immunoprecipitations were far-Western blotted with GST-BLNK-SH2, Ig
was detected in the antiphosphotyrosine and anti-Igß immunoprecipitations from BCR-stimulated cells (middle). These results demonstrate that the BLNK SH2 domain binds directly to the Ig
chain of the endogenous BCR following receptor stimulation.
We next examined the kinetics of Y204 phosphorylation in the endogenous receptor by a time course assay (Fig. 6C). A20IIA1.6 cells were stimulated through the BCR for the times shown, lysed, and subjected to immunoprecipitation with anti-Igß antibodies. Total Ig
phosphorylation was detected by antiphosphotyrosine blotting (top), and Y204-specific phosphorylation was visualized by far-Western blotting with the GST-BLNK-SH2 fusion protein (bottom). The phosphorylation patterns of endogenous Ig
and Y204 were strikingly similar to those of Ig
and Y204 in the chimeric system (Fig. 4D). Total Ig
phosphorylation was transient and peaked at 2 min, whereas Y204 phosphorylation peaked at 1 min and rapidly decreased thereafter.
We next sought to determine if BLNK was recruited to the BCR following ligation. Stimulated A20IIA1.6 lysates were immunoprecipitated with antibodies to the extracellular domain of Igß and immunoblotted with either antiphosphotyrosine (left) or anti-BLNK antibodies (right). Although short exposures of antiphosphotyrosine blots of Igß immunoprecipitates detected only phosphorylated Ig
(Fig. 6B), longer exposures revealed several coprecipitating bands (Fig. 6A and D). Some of these bands, such as the p40/42 complex, have been characterized previously (41). In the Igß immunoprecipitates, a phosphoprotein with a relative molecular mass of 65 kDa was detected (Fig. 6D). When similar immunoprecipitations were blotted with anti-BLNK antibodies, only one band was preferentially and reproducibly detected in BCR-stimulated samples. Another band of weaker intensity at 60 kDa was observed in some, but not all, experiments. These data indicate that, upon BCR stimulation, BLNK is recruited to the Ig
/Igß heterodimer. Interestingly, longer exposures revealed a faint anti-BLNK immunoreactive band in precipitations from unstimulated A20IIA1.6 cells (Fig. 6D, bottom). This suggests that the BCR may be preassembled with receptor-coupled substrates as well as their kinases (16, 62).
We next examined whether phosphorylation of Y204 in the endogenous BCR mediated BLNK recruitment. To address this, we used a retrovirus to transfect Ig
-negative murine plasmacytoma J558Lµm with constructs containing wild-type and Y204F Ig
. Cell populations that expressed similar levels of GFP (by flow cytometry) and Ig
(by Western blotting; Fig. 6E, right) were established. After anti-IgM stimulation, cell samples were lysed and subjected to precipitation with the GST-BLNK-SH2 fusion protein. Blotting with antiphosphotyrosine antibodies indicated that the BLNK-SH2 domain precipitated transfected, phosphorylated Ig
molecules in an IgM-stimulated, Y204-dependent manner (Fig. 6E, left).
Finally, we sought to determine if Ig
Y204 in the endogenous BCR was phosphorylated in vivo following receptor ligation. The demonstrated binding specificity of the BLNK SH2 domain for phospho-Y204, and its direct binding to Ig
, made this likely. For these experiments, we used the B-cell line WEHI-231 because BCR stimulation in this cell line induces a very robust tyrosine phosphorylation of cellular substrates including Ig
and BLNK is recruited directly to the BCR (data not shown). WEHI-231 cells labeled with 32PO4 were stimulated through the BCR, Ig
immunoprecipitates were digested with V8 protease, and Ig
peptides were resolved by 2D TLE and TLC (23). Three prominent phosphopeptides, labeled 1, 2, and 3, were observed (Fig. 6F, left). To identify the peptide in each spot, a synthetic peptide corresponding to the entire cytoplasmic tail of Ig
was phosphorylated by baculovirus-produced Lck and then digested with V8 protease. After TLE and TLC the same three spots were identified (Fig. 6F, right). Elution of each spot and sequencing using tandem mass spectrometry revealed the indicated sequences (Fig. 6F). A similar pattern of three prominent spots was obtained when in vivo- and in vitro-labeled and V8-digested materials were mixed and resolved by TLE and TLC (data not shown). From these data, we conclude that Y182 and Y204 are phosphorylated following receptor stimulation. Consistent with previous reports (44, 46), we did not detect the phosphorylation of Ig
Y193. There was also no detectable phosphorylation of Ig
Y176. These results and the results presented in Fig. 4 indicate that, while Y204 phosphorylation is necessary to recruit BLNK, Y176 may contribute to functional coupling of the receptor to BLNK through a phosphorylation-independent mechanism.
| DISCUSSION |
|---|
|
|
|---|
ITAM and the recruitment of Syk (25, 29, 52). Genetic and biochemical evidence indicates that Syk activation is linked to several distal pathways through BLNK, which acts to assemble effectors of these pathways at the plasma membrane (21, 30). However, it was unknown how activated Syk coupled to BLNK. Herein, we demonstrate that BLNK is recruited by its SH2 domain directly to phospho-Y204, which lies carboxy-terminal to the Ig
ITAM tyrosines. Using these chimeras, we showed that mutation of Y204 and another functionally important tyrosine, Y176, uncoupled Ig
from BLNK-dependent pathways leading to PLC-
2 and JNK activation. The activation of these pathways was reconstituted when BLNK was added back to the receptor complex. In addition, BLNK and Ig
coprecipitate in a Y204-dependent manner in the endogenous BCR. Our data indicate that the close juxtaposition of kinase and substrate on the Ig
cytoplasmic tail facilitates the rapid assembly and initiation of several signaling pathways.
Both Ig
Y176 and Y204 contribute to coupling the BCR to PLC-
2 and JNK activation. Mutation of either tyrosine alone resulted in a partial decrease in BLNK phosphorylation, although it did not significantly affect PLC-
2 phosphorylation or calcium mobilization in response to maximal stimulation through the chimeric receptor. However, mutation of Y204 did attenuate calcium mobilization in response to suboptimal cross-linking (data not shown). Therefore, while both tyrosines function to mediate the phosphorylation of BLNK, Y176 cannot fully compensate for mutation of Y204. However, it is likely that there are other mechanisms that couple the BCR to BLNK activation, as demonstrated by the ability of chimeric Ig
molecules which contain only the ITAM and not Y204 to mobilize intracellular calcium (14, 40). Our chimeric Ig
receptors with a mutation of Y204 were not completely deficient at inducing BLNK phosphorylation or calcium mobilization.
Although functionally redundant, Y176 and Y204 probably link the BCR to BLNK through different mechanisms. As demonstrated, BLNK is directly recruited through its SH2 domain to phospho-Y204 following receptor ligation. This interaction was also suggested in a recent preliminary report (19). The binding of the BLNK SH2 domain appears highly specific in that only the pYQDV motif in Ig
was selected from the array of cytosolic phosphotyrosines available following receptor stimulation (Fig. 4A and 6A and B). Closely related motif YDDV in serine/threonine kinase HPK-1 has also been shown to bind the BLNK SH2 domain (59). These sequences suggest a possible consensus motif of Y-hydrophilic amino acid-D-V. A BLAST search of this motif did not reveal additional potential BLNK binding partners, indicating a very limited array of potential ligands for the BLNK SH2 domain. Furthermore, similar unpaired tyrosines could not be detected within the cytosolic tails of other ITAM-containing receptors. Therefore, the non-ITAM tyrosines of Ig
appear to represent a unique signaling mechanism.
In contrast to the role of phospho-Y204 in the activation of BLNK, the mechanism by which Y176 contributes to signaling is unclear. We were unable to detect any protein that specifically bound to either unphosphorylated or phosphorylated Y176. This Y176 motif (YEDE) is not part of any recognizable SH2 or PTB domain consensus sequence (4, 55). Furthermore, there was no detectable phosphorylation of Ig
Y176 following receptor stimulation (Fig. 6F). Y176 is only six amino acids from Y182, the binding site for Syk, making it less likely that Y176 independently binds a distinct protein. Rather, the hydroxyl moiety of Y176 might provide a secondary binding site for BLNK or a BLNK-associated protein. This would be consistent with the relatively mild reduction in BLNK phosphorylation observed when only Y176 was mutated.
We did not determine if BLNK and Syk bound to the same or to different Ig
molecules. If BLNK and Syk were bound in cis, the amino terminus of BLNK, which contains several potential tyrosine phosphorylation sites, might be in close proximity to the catalytic domain of Syk (14, 40) (Fig. 7). Furthermore, numerous proteins in an Ig
-based complex, including Syk, BLNK, and other BLNK-associated molecules, could mediate cooperative binding events favoring the assembly of multimeric signalsomes. Alternatively, it might be difficult to accommodate both Syk and BLNK on the same Ig
chain, which raises the possibility that they might be recruited to different Ig
molecules. The cross-linking of the receptor forms large caps, and proteins associated with adjacent Ig
molecules would be brought into close apposition, facilitating the phosphorylation of BLNK in trans. Igß, which has no non-ITAM tyrosines or obvious recruitment sites for BLNK, cannot compensate for mutation of Y176 and Y204 (54a). Therefore, it is likely that only Ig
recruits BLNK to the BCR.
|
and Igß contain ITAMs, which, if phosphorylated, should recruit Syk (50). However, this potential does not always translate into competency to signal. Igß alone induces weak tyrosine phosphorylation (36, 51) and chaotic intracellular calcium mobilizations (15). It is likely that Igß functions to regulate Ig
phosphorylation and lower the activation threshold (42). Immunoprecipitations from resting B cells demonstrate that the BCR is constitutively associated with Src family kinases and with Syk. Our observation that BLNK coimmunoprecipitates with the unstimulated BCR indicates that a proximal substrate is present as well. The preassembly of these signaling molecules at the BCR may prime the receptor for rapid activation in response to ligation. Alternatively, receptor-facilitated assembly of both kinases and substrate may be required for resting BCR function. Indeed, surface expression of membrane Ig has been demonstrated to be required for maintenance of mature B lymphocytes in the periphery (39). The presence of BLNK may link the receptor to pathways required for survival.
In summary, our observations indicate that coupling of kinase to substrate is accomplished by the direct recruitment of BLNK to Ig
. This simple and efficient solution provides an explanation for the rapidity with which the BCR can initiate signals. Furthermore, it provides a model for how receptor assembly, in the absence of ligation, could transmit signals sufficient for cell survival.
| ACKNOWLEDGMENTS |
|---|
We thank Lee Ann Garrett-Sinha and Leo D. Wang for critical reading of the manuscript and helpful discussions.
This work was supported by National Institutes of Health grants HL07065 (S.K.), AI42787 (A.C.C.), and GM52736 and GM56187 (M.R.C.).
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
2. Alberola-Ila, J., S. Takaki, J. D. Kerner, and R. M. Perlmutter. 1997. Differential signaling by lymphocyte antigen receptors. Annu. Rev. Immunol. 15:125-154.[CrossRef][Medline]
3.
Alexandropoulos, K., G. Cheng, and D. Baltimore. 1995. Proline-rich sequences that bind to Src homology 3 domains with individual specificities. Proc. Natl. Acad. Sci. USA 92:3110-3114.
4. Bork, P., and B. Margolis. 1995. A phosphotyrosine interaction domain. Cell 80:693-694.[CrossRef][Medline]
5.
Burg, D. L., M. T. Furlong, M. L. Harrison, and R. L. Geahlen. 1994. Interactions of Lyn with the antigen receptor during B cell activation. J. Biol. Chem. 269:28136-28142.
6.
Burkhardt, A. L., M. Brunswick, J. B. Bolen, and J. J. Mond. 1991. Anti-immunoglobulin stimulation of B lymphocytes activates src-related protein-tyrosine kinases. Proc. Natl. Acad. Sci. USA 88:7410-7414.
7.
Bustelo, X. R., and M. Barbacid. 1992. Tyrosine phosphorylation of the vav proto-oncogene product in activated B cells. Science 256:1196-1199.
8. Cambier, J. C. 1995. New nomenclature for the Reth motif (or ARH1/TAM/ARAM/YXXL). Immunol. Today 16:110.[Medline]
9. Cambier, J. C., C. M. Pleiman, and M. R. Clark. 1994. Signal transduction by the B cell antigen receptor and its coreceptors. Annu. Rev. Immunol. 12:457-486.[CrossRef][Medline]
10. Campbell, K. S. 1999. Signal transduction from the B cell antigen-receptor. Curr. Opin. Immunol. 11:256-264.[CrossRef][Medline]
11. Campbell, K. S., and J. C. Cambier. 1990. B lymphocyte antigen receptors (mIg) are non-covalently associated with a disulfide-linked, inducibly phosphorylated glycoprotein complex. EMBO J. 9:441-448.[Medline]
12. Campbell, M. A., and B. M. Sefton. 1990. Protein tyrosine phosphorylation is induced in murine B lymphocytes in response to stimulation with anti-immunoglobulin. EMBO J. 9:2125-2131.[Medline]
13.
Carter, R. H., D. J. Park, S. G. Rhee, and D. T. Fearon. 1991. Tyrosine phosphorylation of phospholipase C induced by membrane immunoglobulin in B lymphocytes. Proc. Natl. Acad. Sci. USA 88:2745-2749.
14.
Cassard, S., D. Choquet, W. H. Fridman, and C. Bonnerot. 1996. Regulation of ITAM signaling by specific sequences in Ig-ß B cell antigen receptor subunit. J. Biol. Chem. 271:23786-23791.
15.
Choquet, D., G. Ku, S. Cassard, B. Malissen, H. Korn, W. H. Fridman, and C. Bonnerot. 1994. Different patterns of calcium signaling triggered through two components of the B lymphocyte antigen receptor. J. Biol. Chem. 269:6491-6497.
16.
Clark, M. R., S. A. Johnson, and J. C. Cambier. 1994. Analysis of Ig-
tyrosine kinase interaction reveals two levels of binding specificity and tyrosine phosphorylated Ig-
stimulation of Fyn activity. EMBO J. 13:1911-1919.[Medline]
17.
Clements, J. L., S. E. Ross-Barta, L. T. Tygrett, T. J. Waldschmidt, and G. A. Koretzky. 1998. SLP-76 expression is restricted to hematopoietic cells of monocyte, granulocyte, and T lymphocyte lineage and is regulated during T cell maturation and activation. J. Immunol. 161:3880-3889.
18. Cohen, G. B., R. Ren, and D. Baltimore. 1995. Modular binding domains in signal transduction proteins. Cell 80:237-248.[CrossRef][Medline]
19.
Engels, N., B. Wollscheid, and J. Wienands. 2001. Association of SLP-65/BLNK with the B cell antigen receptor through a non-ITAM tyrosine of Ig-
. Eur. J. Immunol. 31:2126-2134.[CrossRef][Medline]
20. Flaswinkel, H., and M. Reth. 1994. Dual role of the tyrosine activation motif of the Ig-alpha protein during signal transduction via the B cell antigen receptor. EMBO J. 13:83-89.[Medline]
21. Fu, C., C. W. Turck, T. Kurosaki, and A. C. Chan. 1998. BLNK: a central linker protein in B cell activation. Immunity 9:93-103.[CrossRef][Medline]
22.
Goitsuka, R., Y.-I. Fujimura, H. Mamada, A. Umeda, K. Morimura, K. Uetsuka, S. Doi, S. Tsuji, and D. Kitamura. 1998. BASH, a novel signaling molecule preferentially expressed in B cells of the bursa of Fabricius. J. Immunol. 161:5804-5808.
23. Gold, M. R., R. Chiu, R. J. Ingham, T. M. Saxton, I. V. Oostveen, J. D. Watts, M. Affolter, and R. Aebersold. 1994. Activation and serine phosphorylation of the p56 lck protein tyrosine kinase in response to antigen receptor cross-linking in B lymphocytes. J. Immunol. 153:2369-2380.[Abstract]
24. Gold, M. R., D. A. Law, and A. L. DeFranco. 1990. Stimulation of protein tyrosine phosphorylation by the B-lymphocyte antigen receptor. Nature 345:810-813.[CrossRef][Medline]
25.
Gold, M. R., L. Matsuuchi, R. B. Kelly, and A. L. DeFranco. 1991. Tyrosine phosphorylation of components of the B-cell antigen receptors following receptor crosslinking. Proc. Natl. Acad. Sci. USA 88:3436-3440.
26. Harwood, A. E., and J. C. Cambier. 1993. B cell antigen receptor cross-linking triggers rapid protein kinase C independent activation of p21ras. J. Immunol. 151:4513-4522.[Abstract]
27.
Hashimoto, A., H. Okada, A. Jiang, M. Kurosaki, S. Greenberg, and E. A. Clark. 1998. Involvement of guanoside triphosphatases and phospholipase C-gamma2 in extracellular signal-regulated kinase, c-Jun NH2-terminal kinase, and p38 mitogen-activated protein kinase activation by the B cell antigen receptor. J. Exp. Med. 188:1287-1295.
28.
Hashimoto, S., A. Iwamatsu, M. Ishiai, K. Okawa, T. Yamadori, M. Matsushita, Y. Baba, T. Kishimoto, T. Kurosaki, and S. Tsukada. 1999. Identification of the SH2 domain binding protein of Bruton's tyrosine kinase as BLNK--functional significance of Btk-SH2 domain in B-cell antigen receptor-coupled calcium signaling. Blood 94:2357-2364.
29.
Hutchcroft, J. E., M. L. Harrison, and R. L. Geahlen. 1991. B lymphocyte activation is accompanied by phosphorylation of a 72kDa protein-tyrosine kinase. J. Biol. Chem. 266:14846.
30.
Ishiai, M., M. Kurosaki, R. Pappu, K. Okawa, I. Ronko, C. Fu, M. Shibata, A. Iwamatsu, A. C. Chan, and T. Kurosaki. 1999. BLNK required for coupling Syk to PLC
2 and Rac1-JNK in B cells. Immunity 10:117-125.[CrossRef][Medline]
31.
Jackman, J. K., D. G. Motto, Q. Sun, M. Tanemoto, C. W. Turck, G. A. Peltz, G. A. Koretzky, and P. R. Findell. 1995. Molecular cloning of SLP-76, a 76 kDa tyrosine phosphoprotein associated with Grb2 in T cells. J. Biol. Chem. 270:7029-7032.
32.
Jiang, A., A. Craxton, T. Kurosaki, and E. A. Clark. 1998. Different protein tyrosine kinases are required for B cell antigen receptor-mediated activation of extracellular signal-regulated kinase, c-Jun NH2-terminal kinase 1, and p38 mitogen-activated protein kinase. J. Exp. Med. 188:1297-1306.
33. Jumaa, H., B. Wollscheid, M. Mitterer, J. Wienands, M. Reth, and P. J. Nielsen. 1999. Abnormal development and function of B lymphocytes in mice deficient for the signaling adaptor protein SLP-65. Immunity 11:547-554.[CrossRef][Medline]
34.
Katsuhiko, H., R. Nittono, N. Okamoto, T. Sachiyo, Y. Hara, R. Goitsuka, and D. Kitamura. 2000. The B cell-restricted adaptor BASH is required for normal development and antigen receptor mediated activation of B cells. Proc. Natl. Acad. Sci. USA 97:2755-2760.
35. Keegan, A. D., and W. E. Paul. 1992. Multichain immune recognition receptors: similarities in structure and signaling pathways. Immunol. Today 13:63-68.[CrossRef][Medline]
36. Kim, K. M., G. Alber, P. Weiser, and M. Reth. 1993. Differential signaling through the Ig-alpha and Ig-beta components of the B-cell antigen receptor. Eur. J. Immunol. 23:911-916.[Medline]
37. Kolanus, W., C. Romeo, and B. Seed. 1993. T cell activation by clustered tyrosine kinases. Cell 74:171-183.[CrossRef][Medline]
38.
Kurosaki, T., S. A. Johnson, L. Pao, K. Sada, H. Yamamura, and J. C. Cambier. 1995. Role of the Syk autophosphorylation site and SH2 domains in B cell antigen receptor signaling. J. Exp. Med. 182:1815-1823.
39. Lam, K.-P., R. Kuhn, and K. Rajewsky. 1997. In vivo ablation of surface immunoglobulin on mature B cells by inducible gene targeting results in rapid cell death. Cell 90:1073-1083.[CrossRef][Medline]
40. Law, D. A., V. W. F. Chan, S. K. Datta, and A. L. DeFranco. 1993. B-cell antigen receptor motifs have redundant signaling capabilities and bind the tyrosine kinases PTK72, Lyn and Fyn. Curr. Biol. 3:645-657.
41. Lee, J., P. Luisiri, and M. R. Clark. 1996. A novel complex, p40/42, is constitutively associated with the B cell antigen receptor and phosphorylated upon receptor stimulation. J. Immunol. 157:3828-3837.[Abstract]
42.
Luisiri, P., Y. J. Lee, B. J. Eisfelder, and M. R. Clark. 1996. Cooperativity and segregation of function within the Ig
/ß heterodimer of the B cell antigen receptor complex. J. Biol. Chem. 271:5158-5163.
43.
Minegishi, Y., J. Rohrer, E. Coustan-Smith, H. M. Lederman, R. Pappu, D. Campana, A. C. Chan, and M. E. Conley. 1999. An essential role for BLNK in human B cell development. Science 286:1954-1957.
44.
Muller, R., J. Wienands, and M. Reth. 2000. The serine and threonine residues in the Ig-
cytoplasmic tail negatively regulate immunoreceptor tyrosine based activation motif-mediated signal transduction. Proc. Natl. Acad. Sci. USA 97:8451-8454.
45. Novak, E. J., and P. S. Rabinovitch. 1994. Improved sensitivity in flow cytometric intracellular ionized calcium measurement using fluo-3/Fura red fluorescence ratios. Cytometry 17:135-141.[CrossRef][Medline]
46.
Pao, L. I., S. J. Famiglietti, and J. C. Cambier. 1998. Asymmetrical phosphorylation and function of immunoreceptor tyrosine-based activation motif tyrosines in B cell antigen receptor signal transduction. J. Immunol. 160:3305-3314.
47.
Pappu, R., A. M. Cheng, B. Li, Q. Gong, C. Chiu, N. Griffin, M. White, B. P. Sleckman, and A. C. Chan. 1999. Requirement for B cell linker protein (BLNK) in B cell development. Science 286:1949-1954.
48. Reth, M. 1989. Antigen receptor tail clue. Nature 338:383-384.[Medline]
49. Richards, J. D., M. R. Gold, S. L. Hourihane, A. L. DeFranco, and L. Matsuuchi. 1996. Reconstitution of B cell antigen receptor-induced signaling events in a nonlymphoid cell line by expressing the Syk protein-tyrosine kinase. J. Biol. Chem. 271:6458-6466.