Department of Environmental Health Sciences, Johns Hopkins Bloomberg School of Public Health, Baltimore, Maryland,1 Institute of Basic Medical Sciences and Center for Tsukuba Advanced Research Alliance, University of Tsukuba, Tennoudai, Tsukuba, Japan2
Received 11 September 2001/ Returned for modification 16 October 2001/ Accepted 24 January 2002
| ABSTRACT |
|---|
|
|
|---|
2-fold 6 h after D3T treatment. To examine the transcriptional activation of Nrf2 by D3T, the proximal region (1 kb) of the nrf2 promoter was isolated. Deletion and mutagenesis analyses demonstrated that nrf2 promoter-luciferase reporter activity was enhanced by treatment with D3T and that ARE-like sequences were required for this activation. Gel shift assays with nuclear extracts from PE cells indicated that common factors bind to typical AREs and the ARE-like sequences of the nrf2 promoter. Direct binding of Nrf2 to its own promoter was demonstrated by chromatin immunoprecipitation assay. Overexpression of Nrf2 increased the activity of the nrf2 promoter-luciferase reporter, while expression of mutant Nrf2 protein repressed activity. Thus, Nrf2 appears to autoregulate its own expression through an ARE-like element located in the proximal region of its promoter, leading to persistent nuclear accumulation of Nrf2 and protracted induction of phase 2 genes in response to chemopreventive agents. | INTRODUCTION |
|---|
|
|
|---|
-glutamylcysteine ligase. The core sequence of the ARE has been identified as TGACnnnGC, and several transcription factors are known to bind to the ARE (19, 28, 31, 35, 39). Among these transcription factors, members of basic leucine zipper (bZIP) NF-E2 family such as Nrf1 and Nrf2, which heterodimerize with small Maf family proteins, may be particularly important. Overexpression of Nrf1 and Nrf2 in human hepatoma cells enhanced the basal and inducible transcriptional activation of an ARE reporter gene (39). Recent studies with nrf2-disrupted mice indicated that Nrf2 was essential for induction of GST and NQO1 activities in vivo by many different classes of chemopreventive agents, including phenolic antioxidants, 3H-1,2-dithiole-3-thione (D3T), and isothiocyanates (19, 27, 30). Moreover, these knockout mice were considerably more sensitive to the toxicities of acetaminophen, butylated hydroxytoluene, and hyperoxia (4, 6, 11) and the carcinogenicity of benzopyrene (34). Collectively, these reports demonstrated a central role for Nrf2 in the regulation of basal and inducible expression of genes that defend against environmental stresses. Nuclear levels of Nrf2 are increased when peritoneal macrophages are treated with oxidative stressors such as diethylmaleate and paraquat (18). Increased nuclear accumulation of Nrf2 has also been observed in the liver of mice treated with D3T and ß-naphthoflavone (26, 27). Initially, this accumulation results from translocation of Nrf2 protein from the cytoplasm. Itoh et al. (20) have identified Keap1, a protein located in the cytoplasm that sequesters Nrf2 by specific binding to the amino-terminal regulatory domain of Nrf2. Administration of sulfhydryl reactive reagents such as diethylmaleate (which are also phase 2 inducers) abolished Keap1 repression of Nrf2 activity in cells and facilitated the nuclear accumulation of Nrf2 (20). Huang et al. (16) have recently proposed that protein kinase C-mediated phosphorylation of Nrf2 could be a critical event for the nuclear translocation of this protein. Involvement of ERK and p38 mitogen-activated protein kinase pathways in the nuclear binding of Nrf2 to the ARE have been proposed by others (45).
We have previously observed that treatment of mice with dithiolethiones led to increased steady-state mRNA levels for Nrf2 in several tissues (27, 34). In this study with a murine cell culture system in which phase 2 enzymes were readily inducible, we observed that Nrf2 accumulated in nuclei and in total cellular homogenate after treatment with D3T. mRNA levels for Nrf2 were also increased after treatment. Reporter constructs containing either -35 to -1065 of the murine nrf2 promoter or nested deletion fragments indicated that intact promoter activity was increased twofold after incubation with D3T and that this activation was blunted when the ARE-like sequences in the promoter were deleted or mutated. Overexpression of Nrf2 doubled the activity of the reporter promoter and coexpression of MafK in the cells further enhanced the promoter activity of Nrf2. However, the mutated ARE-like promoter showed no activation when Nrf2 was overexpressed. Chromatin immunoprecipitation (ChIP) with Nrf2 antibody also indicated association of Nrf2 with its promoter. Collectively, these results suggest that rapid accumulation of Nrf2 within nuclei after treatment with D3T may upregulate its own expression through ARE-like sequences in its promoter. This autoregulation of Nrf2 expression can, in turn, lead to a more sustained signaling of phase 2 gene expression.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-32P]ATP (4,500 Ci/mmol) was purchased from ICN (Costa Mesa, Calif.). The luciferase reporter vector pGLbasic and the assay kit were purchased from Promega (Madison, Wis.) and pTATALuc+ from the American Type Culture Collection (Manassas, Va.). Cell culture. Murine keratinocyte PE cells were established from 12-O-tetradecanoyl phorbol-13-acetate (TPA)-induced murine skin papillomas as described previously (46). The cells were maintained in Eagle minimal essential medium containing 10% heat-inactivated and Chelex-treated fetal bovine serum (Life Technologies, Inc., Grand Island, N.Y.), 2 mM CaCl2, and antimycotics or antibiotics (Life Technologies).
Plasmids. The sequence of the promoter region of nrf2 (-1065 to -35) has been published (5), and this promoter was isolated by PCR amplification from hepatic genomic DNA of ICR mice. The isolated PCR product was ligated into pCR2.1 (Invitrogen, Carsbad, Calif.) and a SacI-XhoI fragment from this construct was recloned into the luciferase reporter vector pGLbasic (pGLNRP-1063/-35). Deleted sequences of the nrf2 promoter (-599 to -35 and -429 to -35) were produced by PCR from the full-length promoter and ligated into pGLbasic vector (pGLNRP-599/-35, pGLNRP-429/-35). Sequences containing ARE-like 1 (-574 to -403) and ARE-like 2 (-848 to -684) were also produced by PCR and ligated into the enhancer reporter vector pTATALuc+ (pTATA AREL1, AREL2). Plasmids for overexpression of murine Nrf2 and MafK were made by ligating cDNAs generated by PCR from mouse brain cDNA (Clontech, Palo Alto, Calif.) into pcDNA3 (Promega) (5, 17). A mutant Nrf2 construct, in which the N-terminal region (amino acids 1 to 368), including the transactivation domain, was excluded, was generated as described previously (1). All plasmid sequences were confirmed by sequencing analysis by the DNA Analysis Facility of the Johns Hopkins University (Baltimore, Md.).
Site-directed mutagenesis. Mutated ARE-like sequence-containing promoters of nrf2 were generated by site-directed mutagenesis. Primers containing mutated AREL1 (ACCGTCCTCCGCCAT) or AREL2 (GGCGTCCTGTGGCGC) were used for PCR amplification of mutated nrf2 promoter, and PCR products were digested with DpnI for 1 h to cleave the wild-type promoter. The sequence of each promoter was verified.
DNA transfection and luciferase activity. Cells were transfected at 50% confluency by using Lipofectamine Plus reagent (Life Technologies). Briefly, cells were seeded in 12-well plates at a density of 3 x 104 to 4 x 104 cells/well. Cells were grown overnight, and the transfection complex containing 1 µg of plasmid DNA, 0.2 µg of pRLtk plasmid (Promega), and transfection reagent was added to each well in the absence of fetal bovine serum. Medium containing 20% fetal bovine serum was added 3 h after transfection was begun, and cells were incubated for another 16 to 18 h. Cells recovered for 6 h in normal media after removal of the transfection reagents. After incubations with inducers, cells were lysed and Renilla and firefly luciferase activities were measured by using the dual luciferase assay kit (Promega) with a luminometer (EG&G Wallac, Inc., Gaithersburg, Md.). Luciferase activities were normalized relative to Renilla luciferase activities, the internal control. For overexpression studies, pcDNA3 and pcDNA3-wild-type Nrf2, -mutant Nrf2, or -MafK constructs were cotransfected with the pGL-Nrf2 promoter. Reported luciferase activities are from three to five different transfections.
Preparation of cell extracts. Nuclear extracts from PE cells were prepared as described previously (9), and supernatant resulting from isolation of nuclei was centrifuged at 100,000 x g for 1 h to obtain the cytosolic fraction. Total homogenate from PE cells was prepared by disrupting cells with a glass-Teflon homogenizer in an extraction buffer containing 20 mM HEPES (pH 7.9), 1.5 mM MgCl2, 420 mM NaCl, 10% glycerol, 0.2 mM EDTA, and 0.5 mM phenylmethylsulfonyl fluoride. Protein concentrations were determined by the modified Lowry method (Bio-Rad, Hercules, Calif.).
Electrophoretic mobility shift assays (EMSAs).
Nrf2 ARE-like sequence 1 (GCCCACCTGACTCCGCCATGCCC) or Nrf2 ARE-like sequence 2 (AACTGGCGCCACAGTCAGCCGGT) was end labeled with [
-32P]ATP and incubated with 5 g of nuclear extracts from PE cells for 30 min at room temperature in a reaction mixture containing 10 mM HEPES (pH 7.9), 60 mM KCl, 0.5 mM EDTA, 4% Ficoll, 1 mM phenylmethylsulfonyl fluoride, and 0.2 g of poly(dI-dC). For competition binding, a 200-fold excess of cold AREL1 or AREL2, human NQO1 ARE (GCAGTCACAGTGACTCAGCAGAATCT), NF-E2 (TGGGGAACCTGTGCTGAGTCACTGGT), and AP-1 (TATCGATAAGCTATGACTCATCCGGG) consensus binding sequences were incubated with radiolabeled AREL1 and AREL2. For immunodepletion studies, nuclear extracts from D3T-treated cells preincubated with 1 µg of Nrf2 antibody for 2 h. After incubation, loading buffer was added and the reaction products were analyzed on a 4% acrylamide gel (80:1 [acrylamide-bisacrylamide]) and exposed to X-ray film for 16 h.
SDS-PAGE and Western blotting. Total cellular homogenate (20 µg), cytosol (35 µg) and nuclear extract (12 µg) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on a 6% polyacrylamide gel. Gels were transferred to nitrocellulose membranes (Amersham Pharmacia Biotech, Inc., Piscataway, N.J.) at 50 V for 3 h, and immunoblotting was carried out with Nrf2 antibodies reacting with the N-terminal of murine Nrf2 (27). Immunoblotted membranes were developed by using the ECL Western blotting system (Amersham Pharmacia Biotech) as described in the manufacturer's instructions.
Isolation of RNA and Northern blot hybridization.
Total RNA was isolated by the procedure of Chomczynski and Sacchi (7), and RNA samples were electrophoresed on 1% agarose gels containing 2.2 M formaldehyde and then transferred to nylon membranes (Schleicher and Schuell, Keene, N.H.). cDNA for mouse Nrf2 was labeled with [
-32P]dCTP by using a random primer labeling kit (Amersham Pharmacia Biotech), hybridized, and washed as described previously (27). After being washed, the membranes were exposed to X-ray film (Eastman Kodak, Rochester, N.Y.) and developed with a Konica (Tokyo, Japan) film processor. Labeled membranes were stripped and reprobed with oligonucleotides for ß-actin for loading control.
ChIP assay. Formaldehyde cross-linking and immunoprecipitations were carried out as described previously (3, 44) by using an acetyl-histone H4 ChIP assay kit (Upstate Biotechnology, Lake Placid, N.Y.). Briefly, 37% formaldehyde was directly added to cell culture medium at a final concentration of 1%. Cells were incubated for 10 min at 37°C and washed twice with ice-cold phosphate-buffered saline containing protease inhibitor cocktail (Sigma). Nuclei were isolated after Dounce homogenization and resuspended in sonication buffer (1% SDS; 10 mM EDTA; 50 mM Tris-HCl, pH 8.1; protease inhibitor cocktail). Samples were sonicated on ice to an average length of 500 to 1,000 bp by using a Sonic Dismembrator (Fisher Scientific, Pittsburgh, Pa.) and centrifuged at 12,000 rpm. The chromatin solution was diluted 10-fold with dilution buffer (0.01% SDS; 1.1% Triton X-100; 1.2 mM EDTA; 16.7 mM Tris-HCl, pH 8.1; 167 mM NaCl); one-third was reserved as a total input of chromatin. Diluted chromatin solution was precleared with salmon sperm DNA-protein A-agarose for 1 h and incubated with either anti-Nrf2 antibody, anti-GATA-1 antibody (Santa Cruz, Santa Cruz, Calif.), nonspecific immunoglobulin, or no antibody for 18 h at 4°C with rotation. Immunoprecipitation, washing, and elution were carried out according to the manufacturer's instructions. Cross-linked immunoprecipitates and total chromatin input were reversed, and samples were treated with proteinase K (Sigma) and extracted with phenol-chloroform-isoamyl alcohol (25:24:1). DNA was precipitated with ethanol and resuspended with 30 µl of water. Then, 1 µl of DNA was used for 32 to 36 cycles of PCR amplification with the following primers: gst Ya ARE (5'-ACTTGGCAGGAAGGATCAGT-3' and 5'-TGCTCTAGGTCTCAGTGCAG-3'), nrf2 AREL-2 (5'-GGCAGTTGGCCTCTTGCAAA-3' and 5'-CCTGCAGAACCTTGCCCGCT-3'), promoter of ß-actin (5'-CCGGTCGAGTCGC-GTCCACC-3' and 5'-GGCGAACTGGTGGC-GGGTGT-3'), and hematopoietic enhancer of GATA-1 (5'-GGATCCAAGGAAGAGAGGAC-3' and 5'-TTCCTGGAGGTGACAAAGGG-3').
| RESULTS |
|---|
|
|
|---|
|
|
Levels of Nrf2 mRNA are increased by D3T.
The sensitivity of Nrf2 nuclear accumulation to CHX and the additive effect of D3T and the proteasome inhibitor on the accumulation of Nrf2 suggested that transcriptional activation of nrf2 leading to enhanced synthesis of Nrf2 protein may contribute to the increased level of this transcription factor after D3T treatment. Steady-state mRNA levels of Nrf2 increased
2-fold 6 h after treatment with D3T (Fig. 2C). mRNA levels returned to basal levels at 24 h, a pattern also observed with nuclear levels of Nrf2 in the liver of mice treated with D3T (27).
Promoter activity of nrf2 is increased by D3T. The promoter activity of nrf2 was measured by using a luciferase reporter system to further test the hypothesis that enzyme inducers may enhance transcriptional activation of nrf2 in PE cells. Chan et al. (5) previously described a 1-kb proximal promoter region for nrf2, so this region was isolated by PCR amplification from genomic DNA prepared from the livers of ICR mice. The sequence of the isolated promoter determined here matched the sequence reported earlier. This promoter is very GC-rich and contains several putative AP-2 and SP-1 binding sites. Of particular interest, there are two ARE-like sequences at -754 (AREL2; GCCACAGTCA) and -492 (AREL1; TGACTCCGC) from the transcription start site (Fig. 3A). A full-length promoter construct (pGLNRP-1065/-35) was transiently transfected into PE cells, and the luciferase activity was measured after treatment with D3T. Luciferase activity of blank plasmid pGLbasic was not influenced by D3T treatment in these cells. However, luciferase activity derived from the nrf2 promoter was consistently doubled after treatment with D3T for 5 h (Fig. 3B). The nrf2 promoter-derived luciferase activity was not elevated by longer incubations (i.e., 24 h) with D3T (data not shown). Several nested deletion fragments differing only in their 5' ends were constructed and transfected into PE cells. These modified promoters contained AREL2-deleted (-599 to -35) and AREL1- and AREL2-deleted (-429 to -35) promoter fragments (Fig. 3A). Induction of luciferase activity by D3T was lost in both of these constructs (Fig. 3B). This result suggested that the region between -599 and -1065, which includes the AREL2 sequence, could mediate activation of the nrf2 promoter by D3T.
|
GTCCTGTGGC; MutAREL2) was constructed and transfected into PE cells. Luciferase activity of mutated AREL2 promoter was not increased by treatment with D3T (Fig. 4B). Mutation of AREL1 (TGACTCCGC
GTCCTCCGC; MutAREL1) also abolished inducibility of the wild-type promoter by D3T. Thus, AREL2 mediates a weak induction, but AREL2 alone is not sufficient to activate fully this promoter by D3T treatment.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
Nrf2 is a critical transcription factor in the regulation of both basal and inducible expression of many phase 2 and antioxidative genes (27, 34, 39). Nrf2 is sequestered in the cytoplasm by the actin-binding protein Keap1 (20). Upon stimulation of cells with inducers, Nrf2 dissociates from Keap1 and translocates to the nucleus, where it interacts with AREs found in the promoter region of many phase 2 genes. This translocation is driven by a nuclear localization signal in Nrf2 but also appears to be facilitated through phosphorylation by several kinases (16, 45). Our results indicate that the nuclear accumulation of Nrf2 is rapid and persistent and can be mediated by inducers of distinct chemical classes. Enhanced nuclear accumulation of Nrf2 in response to inducers does not appear simply to be due to translocation of preexistent Nrf2 from the cytoplasm. First, quiescent PE cells have very low levels of Nrf2 that are barely detectable by Western blotting and that cannot account fully for the elevated amount of Nrf2 seen in nuclei after treatment with an inducer. Second, concomitant increases in total cellular amounts of Nrf2 are seen with the nuclear accumulation, suggesting that amplified de novo synthesis of the transcription factor is occurring. Treatment of cells with CHX blocks the accumulation of Nrf2 (nuclear and total) by D3T. Third, D3T treatment in combination with a proteasome inhibitor enhanced the nuclear accumulation of Nrf2 compared to treatment with a proteasome inhibitor alone. Fourth, Nrf2 mRNA and protein levels were elevated 6 h after treatment in these cells. These results suggest that dissociation of Nrf2 from Keap1 leads to an initial elevation of Nrf2 in the nucleus within 20 to 60 min. However, given the short half-life of Nrf2 (
20 min [Fig. 2A]), the predominant factor driving the sustained accumulation and transactivation of phase 2 and/or antioxidative genes results from enhanced de novo synthesis.
The sequence of murine nrf2, including 1 kb of the 5'-flanking region, has been reported and contains multiple SP-1 and AP-2 sites, as well as two ARE-like sequences located at -492 and -754 from the start codon. One motif has a perfect ARE (AREL1; TGACTCCGC) consensus sequence, while the second one has one more base before the GC box (AREL2; TGACTGTGGC). The activity of a luciferase reporter construct containing the 1-kb promoter (pGNLRP-1065/-35) transfected into PE cells could be doubled by treatment with D3T. Studies with several nested deletion fragments differing only in their 5' ends indicated that deletion of AREL2 (-599/-35) or AREL2 and AREL1 (-429/-35) eliminated dithiolethione inducibility. Mutation of the core sequence of either AREL2 or AREL1 in the full-length promoter obviated activation by D3T. A reporter construct containing an AREL2 (-848 to -684) ligated to pTATAluc+ was partially activated by D3T, while a comparable construct with AREL1 was not. Collectively, these studies document that both AREL1 and AREL2 are necessary to fully activate Nrf2 expression by D3T.
Nrf2, a cap'n'collar bZIP transcription factor, forms heterodimers with other proteins, especially of the small Maf class and other bZIP transcription factors (15, 19, 39). Diminished binding of nuclear proteins to AREL1 or AREL2 after the addition of excess NQO1 ARE or NF-E2 suggests common factors may bind to these sequences. EMSA conducted on nuclear proteins isolated from D3T-treated cells demonstrated a marked increase in binding to AREL2-containing oligonucleotides compared to vehicle control, while no such differential was observed with AREL1-containing oligonucleotides. Treatment of EMSA incubations with Nrf2 antibody diminished the total protein binding to AREL2 through immunodepletion. Binding of Nrf2 to ARE-like sequences of its promoter was directly confirmed by a ChIP assay with Nrf2 antibody. This experiment demonstrated that Nrf2 associated with a region of the nrf2 promoter that included or was adjacent to AREL2. The likely involvement of Nrf2 in its own regulation is also supported by experiments in which either wild-type or mutant Nrf2 was overexpressed in PE cells. Overexpression of wild-type Nrf2 activated promoter activity twofold, while mutant Nrf2, which has no transactivation domain, did not increase promoter activity. Coexpression of MafK with Nrf2 in PE cells substantially enhanced the activation of the Nrf2 promoter. Mutation of three bases in the AREL2 of the full-length promoter-reporter construct eliminated responsiveness to overexpression of Nrf2, whereas mutation in AREL1 did not.
In PE cells, Nrf2 can bind to and enhance the activity of its own promoter. However, the extent of activation of the nrf2 promoter by enzyme inducers (or forced Nrf2 expression) is less than seen with typical ARE-containing promoters found in murine GST Ya or rat NQO1. The murine GST Ya and rat NQO1 genes have repeated AREs in their promoters. Mutation studies have shown that multiple AREs are necessary for maximal activation of these enhancers (12, 42). AREL2 in the nrf2 promoter is a single, imperfect ARE since it has one more base before the GC box. This degeneration from the consensus ARE sequence may induce different binding affinities to transcription factors and account for the weak responsiveness of the nrf2 promoter to inducers. Several reports have suggested that different combinations of the bZIP transcription factors have different binding affinities to DNA. Ryseck and Bravo (36) showed that Jun family proteins have different binding affinities to TRE (TPA response element) and CRE (cyclic AMP response element) motifs depending upon their partners. TRE (TGACTCA) and CRE (TGACGTCA) have very similar sequences; however, the Jun-Fos dimer has a higher affinity to TRE than CRE, while the Jun-ATF (activation transcription factor) dimer binds more efficiently to CRE than TRE. Kataoka et al. (23) also suggested that TRE-type MARE (Maf response element) and the CRE-type MARE are recognized with different affinities by different combinations of bZIP proteins, including Maf. Similar conclusions hold for the regulation of detoxifying genes. Small differences in the AREs found in detoxifying genes seem to be related to differential responsiveness to bZIP transcription factors. The promoter of the
-glutamylcysteine ligase heavy chain has several AREs, but a single ARE acts as a cis-acting element (32) and is activated by Nrf2 overexpression while inhibited by overexpression of MafK or MafG in human hepatoma cells (43). Jeyapaul and Jaiswal (21) have shown that Nrf2 and c-Jun are important in regulating the basal and inducible levels of
-glutamylcysteine ligase heavy chain by ß-naphthoflavone. Activation of the ARE of human NQO1 was repressed by expression of small Maf proteins such as MafK and MafG in human hepatoma cells, whereas the expression of c-Jun did not increase activity of an NQO1 ARE-derived luciferase reporter (8). Activity of a GST Ya ARE luciferase reporter was also repressed by expression of MafK in PE cells (M.-K. Kwak and T. W. Kensler, unpublished data). In contrast, expression of reporter genes linked to the thioredoxin ARE (TGAGTCGT) and p53 ARE (TGACTCTGC) was increased by MafK expression (13, 25). These results suggest that the composition of the transcription complex can be varied depending upon the individual genes and the means of stimulation. In the case of nrf2, Nrf2 associates with the AREL2 in its own promoter and MafK facilitates activation of this promoter.
This mechanism of autoregulation of gene expression can be seen for several other transcription factors. For example, GATA-1, which is essential for hematopoietic cell differentiation, also has GATA-binding sequences in its promoter region that have been shown to be critical for regulation of this gene (33). NF-
B also positively regulates its transcription by binding to an NF-
B regulating element in its promoter (29). NF-
B levels are controlled through binding with its inhibitor I-
B in the cytoplasm. Stimuli such as oxidative stress can trigger degradation of I-
B by phosphorylation, allowing NF-
B to be translocated into the nucleus (22). While control of trafficking is the main pathway for the regulation of NF-
B, transcriptional activation of NF-
B is also observed. The bZIP proteins c-Jun and c-Fos can also autoregulate their expression (2, 40). It is also probable that bZIP transcription factors, including Nrf2, can cross talk with each other. Venugopal and Jaiswal (38) have reported that human c-Jun has an ARE (TGACTTCGGC) and suggested the involvement of an ARE-mediated induction of this protein. D3T induces c-Jun expression. Thus, increased nuclear Nrf2 accumulation in response to D3T may also induce other transcription factors such as Jun, which in turn contribute to binding and activation of AREL1 and AREL2 with Nrf2.
In summary, Nrf2 appears to autoregulate its expression through weak ARE-like cis-elements in its promoter, thereby greatly extending the duration if not the magnitude of its transactivating action. Under quiescent or nonstressed situations, PE cells maintain low levels of this rapidly turned over transcription factor. Upon exposure to stressor molecules, such as electrophiles or free radicals, release of this constitutive Nrf2 from Keap1 initiates signaling for the induction of protective genes. Amplification of this counterattack response occurs through transactivation of the nrf2 gene, leading to increased synthesis of Nrf2. Saturation of the cytoplasmic tether of Nrf2, Keap1, allows for enhanced nuclear accumulation of Nrf2 and protracted activation of phase 2 genes. Signaling for increased synthesis of Nrf2 is ultimately attenuated, even in the face of continued challenge with inducers. Although the mechanism underlying this dampening response is unclear, posttranslational modification of Nrf2 through phosphorylation or other means may mark the transcription factor for altered disposition. This multifaceted pathway for the regulation of Nrf2 levels in cells provides a tightly controlled mechanism to modulate the expression of genes that protect against an array of endogenous and exogenous assault molecules.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
2. Angel, P., K. Hattori, T. Smeal, and M. Karin. 1988. The jun proto-oncogene is positively autoregulated by its product, Jun/AP-1. Cell 55:875-885.[CrossRef][Medline]
3.
Boyd, K., J. Wells, J. Gutman, S. M. Bartley, and P. J. Farnham. 1998. c-Myc target gene specificity is determined by a post-DNA-binding mechanism. Proc. Natl. Acad. Sci. USA 95:13887-13892.
4.
Chan, K., and Y. W. Kan. 1999. Nrf2 is essential for protection against acute pulmonary injury in mice. Proc. Natl. Acad. Sci. USA 96:12731-12736.
5.
Chan, K., R. Lu, J. C. Chang, and Y. W. Kan. 1996. NRF2, a member of the NFE2 family of transcription factors, is not essential for murine erythropoiesis, growth, and development. Proc. Natl. Acad. Sci. USA 93:13943-13948.
6.
Cho, H.-Y., A. E. Jedlicka, S. P. Reddy, T. W. Kensler, M. Yamamoto, L. Y. Zhang, and S. R. Kleeberger. 2002. Role of Nrf2 in protection against hyperoxic lung injury in mice. Am. J. Respir. Cell Mol. 26:175-182.
7. Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156-159.[Medline]
8.
Dhakshinamoorthy, S., and A. K. Jaiswal. 2000. Small Maf (MafG and MafK) proteins negatively regulate antioxidant response element-mediated expression and antioxidant induction of the NAD(P)H:quinone oxidoreductase. J. Biol. Chem. 275:40134-40141.
9.
Dignam, J. D., R. M. Lebovitz, and R. G. Roeder. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:1475-1489.
10.
Egner, P. A., T. W. Kensler, T. Prestera, P. Talalay, A. H. Libby, H. H. Joyner, and T. J. Curphey. 1994. Regulation of phase 2 enzyme induction by oltipraz and other dithiolethiones. Carcinogenesis 15:177-181.
11.
Enomoto, A., K. Itoh, E. Nagayoshi, J. Haruta, T. Kimura, T. O'Conner, T. Harada, and M. Yamamoto. 2001. High sensitivity of Nrf2 knockout mice to acetaminophen hepatotoxicity associated with decreased expression of ARE-regulated drug metabolizing enzymes and antioxidant genes. Toxicol. Sci. 59:169-177.
12.
Favreau, L. V., and C. B. Pickett. 1995. The rat quinone reductase antioxidant response element. J. Biol. Chem. 270:24468-24474.
13. Hale, T. K., C. Myers, R. Maitra, T. Kolzau, M. Nishizawa, and A. W. Braithwaite. 2000. Maf transcriptionally activates the mouse p53 promoter and causes a p53-dependent cell death. J. Biol. Chem. 24:17991-17999.
14. Hayes, J. D., and L. I. McLellan. 1999. Glutathione and glutathione-dependent enzymes represent a coordinately regulated defence against oxidative stress. Free Radic. Res. 31:273-300.[Medline]
15.
He, C. H., P. Gong, B. Hu, D. Stewart, M. E. Choi, A. M. Choi, and J. Alam. 2001. Identification of activation transcription 4 (ATF4) as an Nrf2-interacting protein. Implication for heme oxygenase-1 gene regulation. J. Biol. Chem. 276:20858-20865.
16.
Huang, H.-C., T. Nguyen, and C. Pickett. 2000. Regulation of the antioxidant response element by protein kinase C-mediated phosphorylation of NF-E2 related factor 2. Proc. Natl. Acad. Sci. USA 97:1-6.
17.
Igarashi, K., K. Itoh, H. Motohashi, N. Hayashi, Y. Matuzaki, H. Nakauchi, M. Nishizawa, and M. Yamamoto. 1995. Activity and expression of murine small Maf family protein Maf K. J. Biol. Chem. 270:7615-7624.
18.
Ishii, T., K. Itoh, S. Takahashi, H. Sato, T. Yanagawa, Y. Katoh, S. Bannai, and M. Yamamoto. 2000. Transcription factor Nrf2 coordinately regulates a group of oxidative stress-induced genes in macrophages. J. Biol. Chem. 275:16023-16029.
19. Itoh, K., T. Chiba, S. Takahashi, T. Ishii, K. Igarashi, Y. Katoh, T. Oyake, N. Hayashi, K. Satoh, I. Iatayama, M. Yamamoto, and Y. Nabeshima. 1997. An Nrf2/small Maf heterodimer mediates the induction of phase II detoxifying enzyme gene through antioxidant response elements. Biochem. Biophys. Res. Commun. 236:313-322.[CrossRef][Medline]
20.
Itoh, K., N. Wakabayashi, Y. Katoh, T. Ishii, K. Igarashi, J. D. Engel, and M. Yamamoto. 1999. Keap1 represses nuclear activation of antioxidant responsive elements by Nrf2 through binding to the amino-terminal Neh2 domain. Genes Dev. 13:76-86.
21. Jeyapaul, J., and A. K. Jaiswal. 2000. Nrf2 and c-Jun regulation of antioxidant response element (ARE)-mediated expression and induction of gamma-glutamylcysteine synthetase heavy subunit gene. Biochem. Pharmacol. 59:1433-1439.[CrossRef][Medline]
22.
Karin, M. 1999. The beginning of the end: I
B kinase (IKK) and NF-
B activation. J. Biol. Chem. 274:27339-27342.
23.
Kataoka, K., M. Noda, and M. Nishizawa. 1994. Maf nuclear oncoprotein recognizes sequences related to an AP-1 site and forms heterodimers with both Fos and Jun. Mol. Cell. Biol. 14:700-712.
24. Kensler, T. W., J. D. Groopman, T. R. Sutter, T. J. Curphey, and B. D. Roebuck. 1999. Development of cancer chemopreventive agents: oltipraz as a paradigm. Chem. Res. Toxicol. 12:113-126.[CrossRef][Medline]
25.
Kim, Y.-C., H. Masutani, Y. Yamaguchi, K. Itoh, M. Yamamoto, and J. Yodoi. 2001. Hemin-induced activation of the thioredoxin gene by Nrf2. J. Biol. Chem. 276:18399-18406.
26. Kwak, M.-K., P. A. Egner, P. M. Dolan, M. Ramos-Gomez, J. D. Groopman, K. Itoh, M. Yamamoto, and T. W. Kensler. 2001. Role of phase 2 enzyme induction in chemoprotection by dithiolethiones. Mutat. Res. 480:305-315.
27. Kwak, M.-K., K. Itoh, M. Yamamoto, T. R. Sutter, and T. W. Kensler. 2001. Role of transcription factor Nrf2 in the induction of hepatic phase 2 and antioxidative enzymes in vivo by the cancer chemoprotective agent, 3H-1,2-dithiole-3-thione. Mol. Med. 7:135-145.[Medline]
28.
Li, Y., and A. K. Jaiswal. 1992. Regulation of human NAD(P)H:quinone oxidoreductase gene: role of AP-1 binding site contained within human antioxidant response element. J. Biol. Chem. 267:15097-15104.
29.
Liptay, S., R. M. Schmid, E. G. Nabel, and G. J. Nabel. 1994. Transcriptional regulation of NF-
B2: evidence for
B-mediated positive and negative autoregulation. Mol. Cell. Biol. 14:7695-7703.
30.
MacMahon, M., K. Itoh, M. Yamamoto, S. A. Chanas, C. J. Henderson, L. I. McLellan, C. R. Wolf, C. Cavin, and J. D. Hayes. 2001. The cap'n'collar basic leucine zipper transcription factor Nrf2 (NF-E2 p45-related factor 2) controls both constitutive and inducible expression of intestinal detoxification and glutathione biosynthetic enzymes. Cancer Res. 61:3299-3307.
31.
Moinova, H. R., and R. T. Mulcahy. 1998. An electrophile responsive element (EpRE) regulation of ß-naphthoflavone induction of the human
-glutamylcysteine synthetase regulatory subunit gene. Constitutive expression is mediated by an adjacent AP-1 site. J. Biol. Chem. 273:14683-14689.
32.
Mulchay, R. T., M. A. Wartman, H. H. Bailey, and J. J. Gipp. 1997. Constitutive and ß-naphthoflavone-induced expression of the human
-glutamylcycteine synthetase heavy subunit gene is regulated by a distal antioxidant response element/TRE sequence. J. Biol. Chem. 272:7445-7454.
33.
Nishimura, S., S. Takahashi, T. Kuroha, N. Suwabe, T. Nagasawa, C. Trainor, and M. Yamamoto. 2000. A GATA box in the GATA-1 gene hematopoietic enhancer is a critical element in the network of GATA factors and sites that regulate this gene. Mol. Cell. Biol. 20:713-723.
34.
Ramos-Gomez, M., M.-K. Kwak, P. M. Dolan, K. Itoh, M. Yamamoto, P. Talalay, and T. W. Kensler. 2001. Sensitivity to carcinogenesis is increased and chemoprotective efficacy of enzymes inducers is lost in nrf2 transcription factor-deficient mice. Proc. Natl. Acad. Sci. USA 98:3410-3415.
35.
Rushmore, T. H., R. G. King, K. E. Paulson, and C. B. Pickett. 1990. Regulation of glutathione S-transferase Ya subunit gene expression: identification of a unique xenobiotic-responsive element controlling inducible expression by planar aromatic compounds. Proc. Natl. Acad. Sci. USA 87:3826-3830.
36. Ryseck, R.-P., and R. Bravo. 1991. c-JUN, JUN B, and JUN D differ in their binding affinities to AP-1 and CRE consensus sequences: effect of FOS proteins. Oncogene 6:533-542.[Medline]
37.
Shapiro, T. A., J. W. Fahey, K. L. Wade, K. K. Stephenson, and P. Talalay. 2001. Chemoprotective glucosinolates and isothiocyanates of broccoli sprouts: metabolism and excretion in humans. Cancer Epidemiol. Biomarkers Prev. 10:501-508.
38. Venugopal, R., and A. K. Jaiswal. 1999. Coordinated induction of the c-jun gene with genes encoding quinine oxidoreductases in response to xenobiotics and antioxidants. Biochem. Pharmacol. 58:597-603.[CrossRef][Medline]
39.
Venugopal, R., and A. K. Jaiswal. 1996. Nrf1 and Nrf2 positively and c-Fos and Fra1 negatively regulate the human antioxidant response element-mediated expression of NAD(P)H:quinone oxidoreductase1 gene. Proc. Natl. Acad. Sci. USA 93:14960-14965.
40. Verma, I. M., and P. Sassone-Corsi. 1987. Proto-oncogene fos: complex but versatile regulation. Cell 51:513-514.[CrossRef][Medline]
41.
Wang, J.-S., X. Shen, X. He, Y.-R. Zhu, B.-C. Zhang, J.-B. Wang, G.-S. Qian, S.-Y. Kuang, A. Zarba, P. A. Egner, L. J. Jacobson, A. Muñoz, K. J. Helzlsouer, J. D. Groopman, and T. W. Kensler. 1999. Protective alterations in phase 1 and 2 metabolism of aflatoxin B1 by oltipraz in residents of Qidong, People's Republic of China. J. Natl. Cancer Inst. 91:347-354.
42.
Wasserman, W. W., and W. E. Fahl. 1997. Functional antioxidant response element. Proc. Natl. Acad. Sci. USA 94:5361-5366.
43.
Wild, A. C., H. R. Moinova, and R. T. Mulcahy. 1999. Regulation of
-glutamylcysteine synthetase subunit gene expression by the transcription factor Nrf2. J. Biol. Chem. 274:33627-33636.
44. Yamamoto, M., S. Takahashi, K. Onodera, Y. Muraosa, and J. D. Engel. 1997. Upstream and downstream of erythroid transcription factor GATA-1. Genes Cells 2:107-115.[Abstract]
45.
Yu, R., C. Chen, Y.-Y. Mo, V. Hebbar, E. D. Owuor, T.-H. Tan, and A.-N. T. Kong. 2000. Activation of mitogen-activated protein kinase pathways induces antioxidant response element-mediated gene expression via a Nrf2-dependent mechanism. J. Biol. Chem. 275:39907-39913.
46.
Yuspa, S. H., D. Morgan, U. Lichti, E. F. Spangler, D. Michael, A. Kilkenny, and H. Hennings. 1986. Cultivation and characterization of cells derived from mouse skin papillomas induced by an initiation-promotion protocol. Carcinogenesis 7:949-958.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||