This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kwak, M.-K.
Right arrow Articles by Kensler, T. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kwak, M.-K.
Right arrow Articles by Kensler, T. W.

Next Article 

Molecular and Cellular Biology, May 2002, p. 2883-2892, Vol. 22, No. 9
0270-7306/02/$04.00+0     DOI: 10.1128/MCB.22.9.2883-2892.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Enhanced Expression of the Transcription Factor Nrf2 by Cancer Chemopreventive Agents: Role of Antioxidant Response Element-Like Sequences in the nrf2 Promoter

Mi-Kyoung Kwak,1 Ken Itoh,2 Masayuki Yamamoto,2 and Thomas W. Kensler1*

Department of Environmental Health Sciences, Johns Hopkins Bloomberg School of Public Health, Baltimore, Maryland,1 Institute of Basic Medical Sciences and Center for Tsukuba Advanced Research Alliance, University of Tsukuba, Tennoudai, Tsukuba, Japan2

Received 11 September 2001/ Returned for modification 16 October 2001/ Accepted 24 January 2002


arrow
ABSTRACT
 
Induction of phase 2 enzymes, which neutralize reactive electrophiles and act as indirect antioxidants, is an important mechanism for protection against carcinogenesis. The transcription factor Nrf2, which binds to the antioxidant response element (ARE) found in the upstream regulatory region of many phase 2 genes, is essential for the induction of these enzymes. We have investigated the effect of the potent enzyme inducer and anticarcinogen 3H-1,2-dithiole-3-thione (D3T) on the fate of Nrf2 in murine keratinocytes. Both total and nuclear Nrf2 levels increased rapidly and persistently after treatment with D3T but could be blocked by cotreatment with cycloheximide. Nrf2 mRNA levels increased ~2-fold 6 h after D3T treatment. To examine the transcriptional activation of Nrf2 by D3T, the proximal region (1 kb) of the nrf2 promoter was isolated. Deletion and mutagenesis analyses demonstrated that nrf2 promoter-luciferase reporter activity was enhanced by treatment with D3T and that ARE-like sequences were required for this activation. Gel shift assays with nuclear extracts from PE cells indicated that common factors bind to typical AREs and the ARE-like sequences of the nrf2 promoter. Direct binding of Nrf2 to its own promoter was demonstrated by chromatin immunoprecipitation assay. Overexpression of Nrf2 increased the activity of the nrf2 promoter-luciferase reporter, while expression of mutant Nrf2 protein repressed activity. Thus, Nrf2 appears to autoregulate its own expression through an ARE-like element located in the proximal region of its promoter, leading to persistent nuclear accumulation of Nrf2 and protracted induction of phase 2 genes in response to chemopreventive agents.


arrow
INTRODUCTION
 
Inducers of phase 2 and antioxidative enzymes are known to enhance the detoxication of environmental carcinogens in animals, often leading to protection against neoplasia (14, 24, 26). Use of enzyme inducers as cancer chemopreventive agents in humans is currently under clinical investigation (37, 41). Regulation of both basal and inducible expression of protective enzymes is mediated in part by the antioxidant response element (ARE), a cis-acting sequence found in the 5'-flanking region of the genes encoding many phase 2 enzymes such as mouse glutathione S-transferase (GST) Ya, human NAD(P)H quinone oxidoreductase (NQO1), and human {gamma}-glutamylcysteine ligase. The core sequence of the ARE has been identified as TGACnnnGC, and several transcription factors are known to bind to the ARE (19, 28, 31, 35, 39). Among these transcription factors, members of basic leucine zipper (bZIP) NF-E2 family such as Nrf1 and Nrf2, which heterodimerize with small Maf family proteins, may be particularly important. Overexpression of Nrf1 and Nrf2 in human hepatoma cells enhanced the basal and inducible transcriptional activation of an ARE reporter gene (39). Recent studies with nrf2-disrupted mice indicated that Nrf2 was essential for induction of GST and NQO1 activities in vivo by many different classes of chemopreventive agents, including phenolic antioxidants, 3H-1,2-dithiole-3-thione (D3T), and isothiocyanates (19, 27, 30). Moreover, these knockout mice were considerably more sensitive to the toxicities of acetaminophen, butylated hydroxytoluene, and hyperoxia (4, 6, 11) and the carcinogenicity of benzopyrene (34). Collectively, these reports demonstrated a central role for Nrf2 in the regulation of basal and inducible expression of genes that defend against environmental stresses.

Nuclear levels of Nrf2 are increased when peritoneal macrophages are treated with oxidative stressors such as diethylmaleate and paraquat (18). Increased nuclear accumulation of Nrf2 has also been observed in the liver of mice treated with D3T and ß-naphthoflavone (26, 27). Initially, this accumulation results from translocation of Nrf2 protein from the cytoplasm. Itoh et al. (20) have identified Keap1, a protein located in the cytoplasm that sequesters Nrf2 by specific binding to the amino-terminal regulatory domain of Nrf2. Administration of sulfhydryl reactive reagents such as diethylmaleate (which are also phase 2 inducers) abolished Keap1 repression of Nrf2 activity in cells and facilitated the nuclear accumulation of Nrf2 (20). Huang et al. (16) have recently proposed that protein kinase C-mediated phosphorylation of Nrf2 could be a critical event for the nuclear translocation of this protein. Involvement of ERK and p38 mitogen-activated protein kinase pathways in the nuclear binding of Nrf2 to the ARE have been proposed by others (45).

We have previously observed that treatment of mice with dithiolethiones led to increased steady-state mRNA levels for Nrf2 in several tissues (27, 34). In this study with a murine cell culture system in which phase 2 enzymes were readily inducible, we observed that Nrf2 accumulated in nuclei and in total cellular homogenate after treatment with D3T. mRNA levels for Nrf2 were also increased after treatment. Reporter constructs containing either -35 to -1065 of the murine nrf2 promoter or nested deletion fragments indicated that intact promoter activity was increased twofold after incubation with D3T and that this activation was blunted when the ARE-like sequences in the promoter were deleted or mutated. Overexpression of Nrf2 doubled the activity of the reporter promoter and coexpression of MafK in the cells further enhanced the promoter activity of Nrf2. However, the mutated ARE-like promoter showed no activation when Nrf2 was overexpressed. Chromatin immunoprecipitation (ChIP) with Nrf2 antibody also indicated association of Nrf2 with its promoter. Collectively, these results suggest that rapid accumulation of Nrf2 within nuclei after treatment with D3T may upregulate its own expression through ARE-like sequences in its promoter. This autoregulation of Nrf2 expression can, in turn, lead to a more sustained signaling of phase 2 gene expression.


arrow
MATERIALS AND METHODS
 
Reagents. All chemicals were purchased from Sigma Chemical Co. (St. Louis, Mo.), and D3T was provided by Thomas Curphey (Dartmouth Medical School, Hanover, N.H.) (10). [{gamma}-32P]ATP (4,500 Ci/mmol) was purchased from ICN (Costa Mesa, Calif.). The luciferase reporter vector pGLbasic and the assay kit were purchased from Promega (Madison, Wis.) and pTATALuc+ from the American Type Culture Collection (Manassas, Va.).

Cell culture. Murine keratinocyte PE cells were established from 12-O-tetradecanoyl phorbol-13-acetate (TPA)-induced murine skin papillomas as described previously (46). The cells were maintained in Eagle minimal essential medium containing 10% heat-inactivated and Chelex-treated fetal bovine serum (Life Technologies, Inc., Grand Island, N.Y.), 2 mM CaCl2, and antimycotics or antibiotics (Life Technologies).

Plasmids. The sequence of the promoter region of nrf2 (-1065 to -35) has been published (5), and this promoter was isolated by PCR amplification from hepatic genomic DNA of ICR mice. The isolated PCR product was ligated into pCR2.1 (Invitrogen, Carsbad, Calif.) and a SacI-XhoI fragment from this construct was recloned into the luciferase reporter vector pGLbasic (pGLNRP-1063/-35). Deleted sequences of the nrf2 promoter (-599 to -35 and -429 to -35) were produced by PCR from the full-length promoter and ligated into pGLbasic vector (pGLNRP-599/-35, pGLNRP-429/-35). Sequences containing ARE-like 1 (-574 to -403) and ARE-like 2 (-848 to -684) were also produced by PCR and ligated into the enhancer reporter vector pTATALuc+ (pTATA AREL1, AREL2). Plasmids for overexpression of murine Nrf2 and MafK were made by ligating cDNAs generated by PCR from mouse brain cDNA (Clontech, Palo Alto, Calif.) into pcDNA3 (Promega) (5, 17). A mutant Nrf2 construct, in which the N-terminal region (amino acids 1 to 368), including the transactivation domain, was excluded, was generated as described previously (1). All plasmid sequences were confirmed by sequencing analysis by the DNA Analysis Facility of the Johns Hopkins University (Baltimore, Md.).

Site-directed mutagenesis. Mutated ARE-like sequence-containing promoters of nrf2 were generated by site-directed mutagenesis. Primers containing mutated AREL1 (ACCGTCCTCCGCCAT) or AREL2 (GGCGTCCTGTGGCGC) were used for PCR amplification of mutated nrf2 promoter, and PCR products were digested with DpnI for 1 h to cleave the wild-type promoter. The sequence of each promoter was verified.

DNA transfection and luciferase activity. Cells were transfected at 50% confluency by using Lipofectamine Plus reagent (Life Technologies). Briefly, cells were seeded in 12-well plates at a density of 3 x 104 to 4 x 104 cells/well. Cells were grown overnight, and the transfection complex containing 1 µg of plasmid DNA, 0.2 µg of pRLtk plasmid (Promega), and transfection reagent was added to each well in the absence of fetal bovine serum. Medium containing 20% fetal bovine serum was added 3 h after transfection was begun, and cells were incubated for another 16 to 18 h. Cells recovered for 6 h in normal media after removal of the transfection reagents. After incubations with inducers, cells were lysed and Renilla and firefly luciferase activities were measured by using the dual luciferase assay kit (Promega) with a luminometer (EG&G Wallac, Inc., Gaithersburg, Md.). Luciferase activities were normalized relative to Renilla luciferase activities, the internal control. For overexpression studies, pcDNA3 and pcDNA3-wild-type Nrf2, -mutant Nrf2, or -MafK constructs were cotransfected with the pGL-Nrf2 promoter. Reported luciferase activities are from three to five different transfections.

Preparation of cell extracts. Nuclear extracts from PE cells were prepared as described previously (9), and supernatant resulting from isolation of nuclei was centrifuged at 100,000 x g for 1 h to obtain the cytosolic fraction. Total homogenate from PE cells was prepared by disrupting cells with a glass-Teflon homogenizer in an extraction buffer containing 20 mM HEPES (pH 7.9), 1.5 mM MgCl2, 420 mM NaCl, 10% glycerol, 0.2 mM EDTA, and 0.5 mM phenylmethylsulfonyl fluoride. Protein concentrations were determined by the modified Lowry method (Bio-Rad, Hercules, Calif.).

Electrophoretic mobility shift assays (EMSAs). Nrf2 ARE-like sequence 1 (GCCCACCTGACTCCGCCATGCCC) or Nrf2 ARE-like sequence 2 (AACTGGCGCCACAGTCAGCCGGT) was end labeled with [{gamma}-32P]ATP and incubated with 5 g of nuclear extracts from PE cells for 30 min at room temperature in a reaction mixture containing 10 mM HEPES (pH 7.9), 60 mM KCl, 0.5 mM EDTA, 4% Ficoll, 1 mM phenylmethylsulfonyl fluoride, and 0.2 g of poly(dI-dC). For competition binding, a 200-fold excess of cold AREL1 or AREL2, human NQO1 ARE (GCAGTCACAGTGACTCAGCAGAATCT), NF-E2 (TGGGGAACCTGTGCTGAGTCACTGGT), and AP-1 (TATCGATAAGCTATGACTCATCCGGG) consensus binding sequences were incubated with radiolabeled AREL1 and AREL2. For immunodepletion studies, nuclear extracts from D3T-treated cells preincubated with 1 µg of Nrf2 antibody for 2 h. After incubation, loading buffer was added and the reaction products were analyzed on a 4% acrylamide gel (80:1 [acrylamide-bisacrylamide]) and exposed to X-ray film for 16 h.

SDS-PAGE and Western blotting. Total cellular homogenate (20 µg), cytosol (35 µg) and nuclear extract (12 µg) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on a 6% polyacrylamide gel. Gels were transferred to nitrocellulose membranes (Amersham Pharmacia Biotech, Inc., Piscataway, N.J.) at 50 V for 3 h, and immunoblotting was carried out with Nrf2 antibodies reacting with the N-terminal of murine Nrf2 (27). Immunoblotted membranes were developed by using the ECL Western blotting system (Amersham Pharmacia Biotech) as described in the manufacturer's instructions.

Isolation of RNA and Northern blot hybridization. Total RNA was isolated by the procedure of Chomczynski and Sacchi (7), and RNA samples were electrophoresed on 1% agarose gels containing 2.2 M formaldehyde and then transferred to nylon membranes (Schleicher and Schuell, Keene, N.H.). cDNA for mouse Nrf2 was labeled with [{gamma}-32P]dCTP by using a random primer labeling kit (Amersham Pharmacia Biotech), hybridized, and washed as described previously (27). After being washed, the membranes were exposed to X-ray film (Eastman Kodak, Rochester, N.Y.) and developed with a Konica (Tokyo, Japan) film processor. Labeled membranes were stripped and reprobed with oligonucleotides for ß-actin for loading control.

ChIP assay. Formaldehyde cross-linking and immunoprecipitations were carried out as described previously (3, 44) by using an acetyl-histone H4 ChIP assay kit (Upstate Biotechnology, Lake Placid, N.Y.). Briefly, 37% formaldehyde was directly added to cell culture medium at a final concentration of 1%. Cells were incubated for 10 min at 37°C and washed twice with ice-cold phosphate-buffered saline containing protease inhibitor cocktail (Sigma). Nuclei were isolated after Dounce homogenization and resuspended in sonication buffer (1% SDS; 10 mM EDTA; 50 mM Tris-HCl, pH 8.1; protease inhibitor cocktail). Samples were sonicated on ice to an average length of 500 to 1,000 bp by using a Sonic Dismembrator (Fisher Scientific, Pittsburgh, Pa.) and centrifuged at 12,000 rpm. The chromatin solution was diluted 10-fold with dilution buffer (0.01% SDS; 1.1% Triton X-100; 1.2 mM EDTA; 16.7 mM Tris-HCl, pH 8.1; 167 mM NaCl); one-third was reserved as a total input of chromatin. Diluted chromatin solution was precleared with salmon sperm DNA-protein A-agarose for 1 h and incubated with either anti-Nrf2 antibody, anti-GATA-1 antibody (Santa Cruz, Santa Cruz, Calif.), nonspecific immunoglobulin, or no antibody for 18 h at 4°C with rotation. Immunoprecipitation, washing, and elution were carried out according to the manufacturer's instructions. Cross-linked immunoprecipitates and total chromatin input were reversed, and samples were treated with proteinase K (Sigma) and extracted with phenol-chloroform-isoamyl alcohol (25:24:1). DNA was precipitated with ethanol and resuspended with 30 µl of water. Then, 1 µl of DNA was used for 32 to 36 cycles of PCR amplification with the following primers: gst Ya ARE (5'-ACTTGGCAGGAAGGATCAGT-3' and 5'-TGCTCTAGGTCTCAGTGCAG-3'), nrf2 AREL-2 (5'-GGCAGTTGGCCTCTTGCAAA-3' and 5'-CCTGCAGAACCTTGCCCGCT-3'), promoter of ß-actin (5'-CCGGTCGAGTCGC-GTCCACC-3' and 5'-GGCGAACTGGTGGC-GGGTGT-3'), and hematopoietic enhancer of GATA-1 (5'-GGATCCAAGGAAGAGAGGAC-3' and 5'-TTCCTGGAGGTGACAAAGGG-3').


arrow
RESULTS
 
Nrf2 levels are increased in nuclei and total cellular homogenates by enzyme inducers. Murine keratinocyte PE cells are very responsive to induction of GST and NQO1 activities. For example, NQO1 activity increased fivefold after treatment with 10 µM D3T for 18 h compared to vehicle-treated cells. Therefore, these cells were used to investigate changes in the distribution of Nrf2 after treatment with enzyme inducers by Western blot analysis. Time course studies (Fig. 1A) indicated that Nrf2 levels increased within 20 min of addition of D3T, both in nuclei and total cellular homogenates. At least sixfold increases in Nrf2 were seen after 2-h incubations in nuclear and total cellular homogenate. Basal levels of cytosolic Nrf2 were difficult to detect but appeared to increase slightly after treatment of cells with D3T. Nuclear Nrf2 levels remained elevated for at least 6 h (Fig. 1B). Moreover, treatment with different phase 2 enzyme inducers (D3T [10 µM], disulfiram [50 µM], tert-butylhydroquinone [50 µM], and ß-naphthoflavone [20 µM]) led to substantial increases in nuclear Nrf2 content compared to vehicle-treated PE cells. Thus, overall levels of the ARE-binding transcription factor Nrf2 increase rapidly and persistently after treatment of PE cells with enzyme inducers.



View larger version (30K):
[in this window]
[in a new window]
 
FIG. 1. Effects of D3T on levels of Nrf2 in PE cells. (A) Nrf2 levels were examined in nuclear extracts, total cellular homogenates, and cytosolic fractions after treatment with D3T for different incubation times. Each lane contains three pooled samples. (B) Nuclear extracts were isolated from dimethyl sulfoxide (control)-, D3T (10 µM)-, disulfiram (50 µM)-, tert-butylhydroxyquinone (tBHQ) (50 µM)-, or ß-naphthofalvone (ß NF) (20 µM)-treated cells 6 h after treatment. Immunoblot analyses were performed with Nrf2 antibody. A positive standard for the immunoblot was prepared from Nrf2-overexpressing cells (Nrf2 std).

Inhibitors of protein synthesis and proteasome function affect the accumulation of Nrf2. Accumulation of Nrf2 in PE cells was very sensitive to treatment with the protein synthesis inhibitor cycloheximide (CHX), since the cotreatment of 1 µg of CHX/ml with D3T for 3 h completely blocked both the nuclear and total cellular accumulation of Nrf2 triggered by D3T (Fig. 2A). Treatment with CHX for 1 h prior to addition of D3T also blocked the induction of NQO1 and heme oxygenase-1 activities; products of genes known to be regulated through Nrf2-ARE interactions (data not shown). As shown in Fig. 2A, washout experiments, in which the rate of disappearance of Nrf2 from nuclei was monitored, indicated that the addition of CHX significantly enhanced the loss of nuclear Nrf2. Thus, while continued incubation of PE cells with D3T from 3 to 4.5 h maintained a constant elevation of nuclear Nrf2, removal of D3T from cells at 3 h led to a 50% reduction in nuclear levels of Nrf2 50 min later. Removal of D3T at 3 h coupled with addition of CHX led to a 50% reduction in 30 min and a complete loss of Nrf2 in nuclei within 90 min. Similar results were seen when total cellular levels of Nrf2 monitored. These observations suggest that maintenance of elevated nuclear Nrf2 depends upon de novo synthesis of Nrf2 after treatment with D3T.



View larger version (49K):
[in this window]
[in a new window]
 
FIG. 2. Effects of protein synthesis inhibitor, CHX, and proteasome inhibitor, MG132, on the accumulation of Nrf2 and effect of D3T on levels of Nrf2 mRNA. (A) In the upper panel, cells were treated with vehicle, D3T (10 µM), or D3T plus CHX (1 µg/ml) for 3 h. Immunoblotting with Nrf2 antibody was carried out with nuclear extracts. In the lower panel, cells were washed after treatment with D3T for 3 h, and either vehicle or CHX was added to the culture medium for the indicated times. {blacktriangledown}, Level of nuclear Nrf2 after incubation with D3T for 4.5 h without washout at 3 h. Nuclear Nrf2 levels were measured by immunoblot analysis of three pooled samples at each time point. (B) Nrf2 levels after treatment for 6 h with vehicle, MG132 (15 µM), D3T (10 µM), or MG132 plus D3T were measured in nuclear and total cellular fractions. Each lane contains three pooled samples, and three separate immunoblots were carried out. (C) Nrf2 mRNA levels measured in PE cells by Northern blot hybridization. The histogram on the right represents the mean ± the standard error (SE) from three different experiments.

Protein degradation also appears to play a role in the regulation of Nrf2. Addition of the 26S proteasome inhibitor, MG132 (15 µM) increased the level of total cellular Nrf2 after incubation of PE cells for 3 h but did not increase the nuclear level of Nrf2 (Fig. 2B). Apparently, Nrf2 is constantly degraded by the 26S proteasome in uninduced cells, such that inhibition of proteasomes causes accumulation of Nrf2 within cells. Presumably, however, there is an excess of Keap1, the cytoplasmic tether for Nrf2, in the cell to keep Nrf2 sequestered in the cytoplasm rather than allowing for nuclear accumulation as its concentration is increased. However, accumulation of both total and nuclear levels of Nrf2 was greatly increased by coincubation of cells with MG132 and D3T, indicating that D3T increases Nrf2 levels in part through a proteasome-independent pathway. Collectively, the effects of CHX and MG132 suggest that levels of Nrf2 protein are regulated through a balance between rapid protein synthesis and constant degradation. D3T treatment may elevate the level of Nrf2 not only by enhanced translocation but also by enhanced protein synthesis.

Levels of Nrf2 mRNA are increased by D3T. The sensitivity of Nrf2 nuclear accumulation to CHX and the additive effect of D3T and the proteasome inhibitor on the accumulation of Nrf2 suggested that transcriptional activation of nrf2 leading to enhanced synthesis of Nrf2 protein may contribute to the increased level of this transcription factor after D3T treatment. Steady-state mRNA levels of Nrf2 increased ~2-fold 6 h after treatment with D3T (Fig. 2C). mRNA levels returned to basal levels at 24 h, a pattern also observed with nuclear levels of Nrf2 in the liver of mice treated with D3T (27).

Promoter activity of nrf2 is increased by D3T. The promoter activity of nrf2 was measured by using a luciferase reporter system to further test the hypothesis that enzyme inducers may enhance transcriptional activation of nrf2 in PE cells. Chan et al. (5) previously described a 1-kb proximal promoter region for nrf2, so this region was isolated by PCR amplification from genomic DNA prepared from the livers of ICR mice. The sequence of the isolated promoter determined here matched the sequence reported earlier. This promoter is very GC-rich and contains several putative AP-2 and SP-1 binding sites. Of particular interest, there are two ARE-like sequences at -754 (AREL2; GCCACAGTCA) and -492 (AREL1; TGACTCCGC) from the transcription start site (Fig. 3A). A full-length promoter construct (pGLNRP-1065/-35) was transiently transfected into PE cells, and the luciferase activity was measured after treatment with D3T. Luciferase activity of blank plasmid pGLbasic was not influenced by D3T treatment in these cells. However, luciferase activity derived from the nrf2 promoter was consistently doubled after treatment with D3T for 5 h (Fig. 3B). The nrf2 promoter-derived luciferase activity was not elevated by longer incubations (i.e., 24 h) with D3T (data not shown). Several nested deletion fragments differing only in their 5' ends were constructed and transfected into PE cells. These modified promoters contained AREL2-deleted (-599 to -35) and AREL1- and AREL2-deleted (-429 to -35) promoter fragments (Fig. 3A). Induction of luciferase activity by D3T was lost in both of these constructs (Fig. 3B). This result suggested that the region between -599 and -1065, which includes the AREL2 sequence, could mediate activation of the nrf2 promoter by D3T.



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 3. Effect of D3T on nrf2 promoter activity in PE cells. (A) A 1-kb portion of the promoter of nrf2 was isolated from murine liver and ligated into a luciferase reporter vector (pGLNRP-1065/-35) to monitor the activity of this promoter. ARE-like sequences (AREL1; -492, AREL2; -754) are found in the promoter of Nrf2. Different 5'-deletion constructs (pGLNRP-599/-35 and pGLNRP-429/-35) were also prepared by PCR. (B) Luciferase reporter plasmids containing the nrf2 promoter (pGLNRP-1065/-35) or truncated promoter constructs (pGLNRP-599/-35 and pGLNRP-429/-35) were transiently transfected into PE cells, and the luciferase activities were measured after treatment with D3T (10 µM) for 5 h. Luciferase activities were normalized by cotransfecting Renilla luciferase control vectors. Values are means ± the SE from five to seven different experiments. a, P < 0.05 compared to vehicle-treated control.

ARE-like sequences regulate the nrf2 promoter and bind Nrf2. Two sequences containing AREL2 (-848 to -684) and AREL1 (-574 to -403) were amplified from the nrf2 promoter and ligated to pTATALuc+ for enhancer analysis. The AREL2 containing sequence (pTATA AREL2) could be activated modestly (50%) but significantly (P < 0.05) by D3T compared to dimethyl sulfoxide-treated cells (Fig. 4A). However, pTATA AREL1 was not activated by D3T. To verify this result, a full-length promoter containing mutated AREL2 (TGACTGTGGC -> GTCCTGTGGC; MutAREL2) was constructed and transfected into PE cells. Luciferase activity of mutated AREL2 promoter was not increased by treatment with D3T (Fig. 4B). Mutation of AREL1 (TGACTCCGC -> GTCCTCCGC; MutAREL1) also abolished inducibility of the wild-type promoter by D3T. Thus, AREL2 mediates a weak induction, but AREL2 alone is not sufficient to activate fully this promoter by D3T treatment.



View larger version (37K):
[in this window]
[in a new window]
 
FIG. 4. Effects of D3T on ARE-like-mediated luciferase activity and site-directed mutagenesis studies of the nrf2 promoter. (A) Luciferase plasmids containing ARE-like sequences from nrf2 promoter (pTATA AREL1 and pTATA AREL2) were transfected, and the luciferase activities were measured after D3T treatment for 5 h. Luciferase activities were normalized by measuring the Renilla luciferase activity from a cotransfected reporter vector. Values are means ± the SE from four different experiments. a, P < 0.05 compared to vehicle-treated control. (B) Mutated AREL1- or AREL2-containing promoters were transfected and luciferase activities measured following treatment with D3T for 5 h. Values are means ± the SE from five different experiments. a, P < 0.05 compared to vehicle-treated control.

EMSA analysis was carried out to establish the protein-binding patterns of AREL1 and AREL2. AREL1 and AREL2 sequences from the nrf2 promoter were end labeled with [32P]ATP and incubated with nuclear extract isolated from PE cells. As shown in Fig. 5A, excess amounts (200-fold) of cold AREL1 (lane 1) and AREL2 (lane 6) inhibited the binding of nuclear proteins to these sequences. Competition with cold human NQO1 ARE (lanes 3 and 8) and the NF-E2 (lanes 5 and 10) consensus sequence also inhibited binding, whereas the AP-1 (lanes 4 and 9) consensus sequence did not. Nuclear extracts isolated from PE cells treated with either vehicle or D3T were then used for gel shift analyses with AREL1 and AREL2. Total binding of nuclear extract protein to AREL2 (Fig. 5B, lane 4) was substantially increased with nuclear extract isolated from D3T-treated mice compared to vehicle-treated mice (lane 3). No differential effect of D3T treatment on nuclear protein binding to the AREL1 was observed (lanes 1 and 2). Immunodepletion with Nrf2 antibodies of nuclear extracts from D3T-treated cells greatly diminished protein binding to AREL2 (Fig. 5B, lanes 5 and 6) and NQO1 ARE (not shown) but not AREL1 (not shown). Collectively, these results indicated that common factors, including Nrf2, may bind to the AREs of phase 2 genes and the ARE-like sequences of the nrf2 promoter. The results of a ChIP assay are shown in Fig. 5C. Nrf2 antibody precipitated portions of the promoter of nrf2 containing the AREL2 sequence in D3T-treated PE cells. This antibody also precipitated the ARE sequence of GST Ya, a well-characterized binding motif for Nrf2, but did not precipitate the promoter for unrelated genes such as ß-actin and the transcription factor GATA-1. In contrast, GATA-1 antibody precipitated the GATA-1 gene hematopoietic enhancer of the GATA-1 promoter but not the ARE or AREL2 of the murine GST and nrf2 promoters, respectively, in D3T-treated PE cells. Thus, Nrf2 can bind specifically to a region of its own promoter containing the AREL2 after D3T treatment of cells.



View larger version (39K):
[in this window]
[in a new window]
 
FIG. 5. EMSA analyses with AREL1 and AREL2 sequences and ChIP assay. (A) Competitive binding of AREL1 (lanes 1 to 5) and AREL2 (lanes 6 to 10) with consensus sequences of human NQO1 ARE, AP-1, or NF-E2 with nuclear extracts from D3T-treated cells. (B) Total binding of nuclear extracts from vehicle- or D3T-treated cells to AREL1 (lanes 1 and 2) and AREL2 (lanes 3 and 4). The effects of immunodepletion of nuclear extracts from D3T-treated cells with Nrf2 antibody are shown in lanes 5 and 6. Each lane represents three pooled samples. (C) ChIP assay performed in D3T-treated PE cells with Nrf2 antibody. Intact protein-DNA complexes were cross-linked by adding formaldehyde into the culture medium. Immunoprecipitates from control (incubated without antibody) and nonspecific immunoglobulin (IgG)-, Nrf2 antibody-, or GATA-1 antibody-incubated cells were isolated and analyzed by PCR with primers specific for the GST, nrf2, GATA-1, and ß-actin promoters. The supernatant from the control nuclear extract was prepared as the total input of chromatin, and 0.1% of total input was used as the input DNA. Each sample was prepared from three pooled plates.

Overexpression of Nrf2 activates nrf2 promoter activity through AREL2. To probe the effects of Nrf2 on its own regulation through ARE-like sequences of its promoter, wild-type or mutant Nrf2 and MafK were overexpressed in PE cells, and the activity of a nrf2 promoter-luciferase reporter was measured. The activity of full-length nrf2 promoter (pGLNRP-1065/-35) doubled compared to blank plasmid-transfected cells when wild-type Nrf2 was overexpressed. This effect of overexpression of Nrf2 was identical in magnitude to the effect of D3T treatment on full-length promoter activity. However, overexpression of mutant Nrf2 decreased the activity of this promoter to <50% of its basal activity (Fig. 6A). Coexpression of MafK with wild-type Nrf2 increased promoter activity by sixfold compared to blank plasmids, but coexpression of mutant Nrf2 (in which the transactivation domain was deleted), together with wild-type MafK, produced only a 2.5-fold increase in promoter activity. Similar results were also seen with an AREL2-containing reporter construct (pTATAAREL2) (Fig. 6B). However, the full-length promoter containing a mutated AREL2 (MutAREL2) sequence was not activated by overexpression of Nrf2, whereas mutation of the AREL1 sequence (MutAREL1) had no effect on activation by Nrf2 overexpression (Fig. 6B). Collectively, these results suggest that Nrf2 can activate its own promoter, albeit weakly, through interaction with an AREL2 within its promoter.



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 6. Effect of overexpression of Nrf2 on the activity of the nrf2 promoter. (A) Nrf2 promoter luciferase activity was measured after transfection of wild-type or mutant Nrf2 with or without MafK. Values are means ± the SE from four different experiments. a, P < 0.05 compared to blank plasmid-transfected control. b, P < 0.05 compared to the wild-type Nrf2 and MafK-transfected group. (B) Luciferase activities of pTATA AREL2, mutated AREL2 promoter (MutAREL2), or mutated AREL1 promoter (MutAREL1) after overexpression of wild-type and mutant Nrf2. Values are means ± the SE from 4 different experiments. a, P < 0.05 compared to blank plasmid-transfected control.


arrow
DISCUSSION
 
Induction of phase 2 enzymes, which neutralize reactive electrophiles and act as indirect antioxidants, occurs in response to a wide array of cancer chemopreventive agents. Although the biological half-lives of these inducers may be measured in seconds to hours, the pharmacodynamic half-life of enzyme induction is typically several days. Thus, transient exposure to an inducer activates a protracted counterattack protective system that guards against subsequent assaults by electrophiles and free radicals. Understanding the key determinants in the regulation of this protective system should provide insights into optimizing the selection and utilization of pharmacological or dietary inducers for the prevention of cancer and other pathological states driven by elevated or sustained exposures to reactive intermediates formed from exogenous and endogenous compounds.

Nrf2 is a critical transcription factor in the regulation of both basal and inducible expression of many phase 2 and antioxidative genes (27, 34, 39). Nrf2 is sequestered in the cytoplasm by the actin-binding protein Keap1 (20). Upon stimulation of cells with inducers, Nrf2 dissociates from Keap1 and translocates to the nucleus, where it interacts with AREs found in the promoter region of many phase 2 genes. This translocation is driven by a nuclear localization signal in Nrf2 but also appears to be facilitated through phosphorylation by several kinases (16, 45). Our results indicate that the nuclear accumulation of Nrf2 is rapid and persistent and can be mediated by inducers of distinct chemical classes. Enhanced nuclear accumulation of Nrf2 in response to inducers does not appear simply to be due to translocation of preexistent Nrf2 from the cytoplasm. First, quiescent PE cells have very low levels of Nrf2 that are barely detectable by Western blotting and that cannot account fully for the elevated amount of Nrf2 seen in nuclei after treatment with an inducer. Second, concomitant increases in total cellular amounts of Nrf2 are seen with the nuclear accumulation, suggesting that amplified de novo synthesis of the transcription factor is occurring. Treatment of cells with CHX blocks the accumulation of Nrf2 (nuclear and total) by D3T. Third, D3T treatment in combination with a proteasome inhibitor enhanced the nuclear accumulation of Nrf2 compared to treatment with a proteasome inhibitor alone. Fourth, Nrf2 mRNA and protein levels were elevated 6 h after treatment in these cells. These results suggest that dissociation of Nrf2 from Keap1 leads to an initial elevation of Nrf2 in the nucleus within 20 to 60 min. However, given the short half-life of Nrf2 (~20 min [Fig. 2A]), the predominant factor driving the sustained accumulation and transactivation of phase 2 and/or antioxidative genes results from enhanced de novo synthesis.

The sequence of murine nrf2, including 1 kb of the 5'-flanking region, has been reported and contains multiple SP-1 and AP-2 sites, as well as two ARE-like sequences located at -492 and -754 from the start codon. One motif has a perfect ARE (AREL1; TGACTCCGC) consensus sequence, while the second one has one more base before the GC box (AREL2; TGACTGTGGC). The activity of a luciferase reporter construct containing the 1-kb promoter (pGNLRP-1065/-35) transfected into PE cells could be doubled by treatment with D3T. Studies with several nested deletion fragments differing only in their 5' ends indicated that deletion of AREL2 (-599/-35) or AREL2 and AREL1 (-429/-35) eliminated dithiolethione inducibility. Mutation of the core sequence of either AREL2 or AREL1 in the full-length promoter obviated activation by D3T. A reporter construct containing an AREL2 (-848 to -684) ligated to pTATAluc+ was partially activated by D3T, while a comparable construct with AREL1 was not. Collectively, these studies document that both AREL1 and AREL2 are necessary to fully activate Nrf2 expression by D3T.

Nrf2, a cap'n'collar bZIP transcription factor, forms heterodimers with other proteins, especially of the small Maf class and other bZIP transcription factors (15, 19, 39). Diminished binding of nuclear proteins to AREL1 or AREL2 after the addition of excess NQO1 ARE or NF-E2 suggests common factors may bind to these sequences. EMSA conducted on nuclear proteins isolated from D3T-treated cells demonstrated a marked increase in binding to AREL2-containing oligonucleotides compared to vehicle control, while no such differential was observed with AREL1-containing oligonucleotides. Treatment of EMSA incubations with Nrf2 antibody diminished the total protein binding to AREL2 through immunodepletion. Binding of Nrf2 to ARE-like sequences of its promoter was directly confirmed by a ChIP assay with Nrf2 antibody. This experiment demonstrated that Nrf2 associated with a region of the nrf2 promoter that included or was adjacent to AREL2. The likely involvement of Nrf2 in its own regulation is also supported by experiments in which either wild-type or mutant Nrf2 was overexpressed in PE cells. Overexpression of wild-type Nrf2 activated promoter activity twofold, while mutant Nrf2, which has no transactivation domain, did not increase promoter activity. Coexpression of MafK with Nrf2 in PE cells substantially enhanced the activation of the Nrf2 promoter. Mutation of three bases in the AREL2 of the full-length promoter-reporter construct eliminated responsiveness to overexpression of Nrf2, whereas mutation in AREL1 did not.

In PE cells, Nrf2 can bind to and enhance the activity of its own promoter. However, the extent of activation of the nrf2 promoter by enzyme inducers (or forced Nrf2 expression) is less than seen with typical ARE-containing promoters found in murine GST Ya or rat NQO1. The murine GST Ya and rat NQO1 genes have repeated AREs in their promoters. Mutation studies have shown that multiple AREs are necessary for maximal activation of these enhancers (12, 42). AREL2 in the nrf2 promoter is a single, imperfect ARE since it has one more base before the GC box. This degeneration from the consensus ARE sequence may induce different binding affinities to transcription factors and account for the weak responsiveness of the nrf2 promoter to inducers. Several reports have suggested that different combinations of the bZIP transcription factors have different binding affinities to DNA. Ryseck and Bravo (36) showed that Jun family proteins have different binding affinities to TRE (TPA response element) and CRE (cyclic AMP response element) motifs depending upon their partners. TRE (TGACTCA) and CRE (TGACGTCA) have very similar sequences; however, the Jun-Fos dimer has a higher affinity to TRE than CRE, while the Jun-ATF (activation transcription factor) dimer binds more efficiently to CRE than TRE. Kataoka et al. (23) also suggested that TRE-type MARE (Maf response element) and the CRE-type MARE are recognized with different affinities by different combinations of bZIP proteins, including Maf. Similar conclusions hold for the regulation of detoxifying genes. Small differences in the AREs found in detoxifying genes seem to be related to differential responsiveness to bZIP transcription factors. The promoter of the {gamma}-glutamylcysteine ligase heavy chain has several AREs, but a single ARE acts as a cis-acting element (32) and is activated by Nrf2 overexpression while inhibited by overexpression of MafK or MafG in human hepatoma cells (43). Jeyapaul and Jaiswal (21) have shown that Nrf2 and c-Jun are important in regulating the basal and inducible levels of {gamma}-glutamylcysteine ligase heavy chain by ß-naphthoflavone. Activation of the ARE of human NQO1 was repressed by expression of small Maf proteins such as MafK and MafG in human hepatoma cells, whereas the expression of c-Jun did not increase activity of an NQO1 ARE-derived luciferase reporter (8). Activity of a GST Ya ARE luciferase reporter was also repressed by expression of MafK in PE cells (M.-K. Kwak and T. W. Kensler, unpublished data). In contrast, expression of reporter genes linked to the thioredoxin ARE (TGAGTCGT) and p53 ARE (TGACTCTGC) was increased by MafK expression (13, 25). These results suggest that the composition of the transcription complex can be varied depending upon the individual genes and the means of stimulation. In the case of nrf2, Nrf2 associates with the AREL2 in its own promoter and MafK facilitates activation of this promoter.

This mechanism of autoregulation of gene expression can be seen for several other transcription factors. For example, GATA-1, which is essential for hematopoietic cell differentiation, also has GATA-binding sequences in its promoter region that have been shown to be critical for regulation of this gene (33). NF-{kappa}B also positively regulates its transcription by binding to an NF-{kappa}B regulating element in its promoter (29). NF-{kappa}B levels are controlled through binding with its inhibitor I-{kappa}B in the cytoplasm. Stimuli such as oxidative stress can trigger degradation of I-{kappa}B by phosphorylation, allowing NF-{kappa}B to be translocated into the nucleus (22). While control of trafficking is the main pathway for the regulation of NF-{kappa}B, transcriptional activation of NF-{kappa}B is also observed. The bZIP proteins c-Jun and c-Fos can also autoregulate their expression (2, 40). It is also probable that bZIP transcription factors, including Nrf2, can cross talk with each other. Venugopal and Jaiswal (38) have reported that human c-Jun has an ARE (TGACTTCGGC) and suggested the involvement of an ARE-mediated induction of this protein. D3T induces c-Jun expression. Thus, increased nuclear Nrf2 accumulation in response to D3T may also induce other transcription factors such as Jun, which in turn contribute to binding and activation of AREL1 and AREL2 with Nrf2.

In summary, Nrf2 appears to autoregulate its expression through weak ARE-like cis-elements in its promoter, thereby greatly extending the duration if not the magnitude of its transactivating action. Under quiescent or nonstressed situations, PE cells maintain low levels of this rapidly turned over transcription factor. Upon exposure to stressor molecules, such as electrophiles or free radicals, release of this constitutive Nrf2 from Keap1 initiates signaling for the induction of protective genes. Amplification of this counterattack response occurs through transactivation of the nrf2 gene, leading to increased synthesis of Nrf2. Saturation of the cytoplasmic tether of Nrf2, Keap1, allows for enhanced nuclear accumulation of Nrf2 and protracted activation of phase 2 genes. Signaling for increased synthesis of Nrf2 is ultimately attenuated, even in the face of continued challenge with inducers. Although the mechanism underlying this dampening response is unclear, posttranslational modification of Nrf2 through phosphorylation or other means may mark the transcription factor for altered disposition. This multifaceted pathway for the regulation of Nrf2 levels in cells provides a tightly controlled mechanism to modulate the expression of genes that protect against an array of endogenous and exogenous assault molecules.


arrow
ACKNOWLEDGMENTS
 
This work was supported by grants CA 39416 and CA 94076 from the National Institutes of Health. M.-K.K. was partially supported by the Korea Science and Engineering Foundation.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Environmental Health Sciences, Johns Hopkins Bloomberg School of Public Health, 615 N. Wolfe St., Baltimore, MD 21205. Phone: (410) 955-4712. Fax: (410) 955-0116. E-mail: tkensler{at}jhsph.edu. Back


arrow
REFERENCES
 
    1
  1. Alam, J., D. Stewart, C. Touchard, S. Boinapally, A. M. K. Choi, and J. L. Cook. 1999. Nrf2, a cap'n'collar transcription factor, regulates induction of the heme oxygenase-1 gene. J. Biol. Chem. 274:26071-26078.[Abstract/Free Full Text]
  2. 2
  3. Angel, P., K. Hattori, T. Smeal, and M. Karin. 1988. The jun proto-oncogene is positively autoregulated by its product, Jun/AP-1. Cell 55:875-885.[CrossRef][Medline]
  4. 3
  5. Boyd, K., J. Wells, J. Gutman, S. M. Bartley, and P. J. Farnham. 1998. c-Myc target gene specificity is determined by a post-DNA-binding mechanism. Proc. Natl. Acad. Sci. USA 95:13887-13892.[Abstract/Free Full Text]
  6. 4
  7. Chan, K., and Y. W. Kan. 1999. Nrf2 is essential for protection against acute pulmonary injury in mice. Proc. Natl. Acad. Sci. USA 96:12731-12736.[Abstract/Free Full Text]
  8. 5
  9. Chan, K., R. Lu, J. C. Chang, and Y. W. Kan. 1996. NRF2, a member of the NFE2 family of transcription factors, is not essential for murine erythropoiesis, growth, and development. Proc. Natl. Acad. Sci. USA 93:13943-13948.[Abstract/Free Full Text]
  10. 6
  11. Cho, H.-Y., A. E. Jedlicka, S. P. Reddy, T. W. Kensler, M. Yamamoto, L. Y. Zhang, and S. R. Kleeberger. 2002. Role of Nrf2 in protection against hyperoxic lung injury in mice. Am. J. Respir. Cell Mol. 26:175-182.[Abstract/Free Full Text]
  12. 7
  13. Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156-159.[Medline]
  14. 8
  15. Dhakshinamoorthy, S., and A. K. Jaiswal. 2000. Small Maf (MafG and MafK) proteins negatively regulate antioxidant response element-mediated expression and antioxidant induction of the NAD(P)H:quinone oxidoreductase. J. Biol. Chem. 275:40134-40141.[Abstract/Free Full Text]
  16. 9
  17. Dignam, J. D., R. M. Lebovitz, and R. G. Roeder. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:1475-1489.[Abstract/Free Full Text]
  18. 10
  19. Egner, P. A., T. W. Kensler, T. Prestera, P. Talalay, A. H. Libby, H. H. Joyner, and T. J. Curphey. 1994. Regulation of phase 2 enzyme induction by oltipraz and other dithiolethiones. Carcinogenesis 15:177-181.[Abstract/Free Full Text]
  20. 11
  21. Enomoto, A., K. Itoh, E. Nagayoshi, J. Haruta, T. Kimura, T. O'Conner, T. Harada, and M. Yamamoto. 2001. High sensitivity of Nrf2 knockout mice to acetaminophen hepatotoxicity associated with decreased expression of ARE-regulated drug metabolizing enzymes and antioxidant genes. Toxicol. Sci. 59:169-177.[Abstract/Free Full Text]
  22. 12
  23. Favreau, L. V., and C. B. Pickett. 1995. The rat quinone reductase antioxidant response element. J. Biol. Chem. 270:24468-24474.[Abstract/Free Full Text]
  24. 13
  25. Hale, T. K., C. Myers, R. Maitra, T. Kolzau, M. Nishizawa, and A. W. Braithwaite. 2000. Maf transcriptionally activates the mouse p53 promoter and causes a p53-dependent cell death. J. Biol. Chem. 24:17991-17999.
  26. 14
  27. Hayes, J. D., and L. I. McLellan. 1999. Glutathione and glutathione-dependent enzymes represent a coordinately regulated defence against oxidative stress. Free Radic. Res. 31:273-300.[Medline]
  28. 15
  29. He, C. H., P. Gong, B. Hu, D. Stewart, M. E. Choi, A. M. Choi, and J. Alam. 2001. Identification of activation transcription 4 (ATF4) as an Nrf2-interacting protein. Implication for heme oxygenase-1 gene regulation. J. Biol. Chem. 276:20858-20865.[Abstract/Free Full Text]
  30. 16
  31. Huang, H.-C., T. Nguyen, and C. Pickett. 2000. Regulation of the antioxidant response element by protein kinase C-mediated phosphorylation of NF-E2 related factor 2. Proc. Natl. Acad. Sci. USA 97:1-6.[Free Full Text]
  32. 17
  33. Igarashi, K., K. Itoh, H. Motohashi, N. Hayashi, Y. Matuzaki, H. Nakauchi, M. Nishizawa, and M. Yamamoto. 1995. Activity and expression of murine small Maf family protein Maf K. J. Biol. Chem. 270:7615-7624.[Abstract/Free Full Text]
  34. 18
  35. Ishii, T., K. Itoh, S. Takahashi, H. Sato, T. Yanagawa, Y. Katoh, S. Bannai, and M. Yamamoto. 2000. Transcription factor Nrf2 coordinately regulates a group of oxidative stress-induced genes in macrophages. J. Biol. Chem. 275:16023-16029.[Abstract/Free Full Text]
  36. 19
  37. Itoh, K., T. Chiba, S. Takahashi, T. Ishii, K. Igarashi, Y. Katoh, T. Oyake, N. Hayashi, K. Satoh, I. Iatayama, M. Yamamoto, and Y. Nabeshima. 1997. An Nrf2/small Maf heterodimer mediates the induction of phase II detoxifying enzyme gene through antioxidant response elements. Biochem. Biophys. Res. Commun. 236:313-322.[CrossRef][Medline]
  38. 20
  39. Itoh, K., N. Wakabayashi, Y. Katoh, T. Ishii, K. Igarashi, J. D. Engel, and M. Yamamoto. 1999. Keap1 represses nuclear activation of antioxidant responsive elements by Nrf2 through binding to the amino-terminal Neh2 domain. Genes Dev. 13:76-86.[Abstract/Free Full Text]
  40. 21
  41. Jeyapaul, J., and A. K. Jaiswal. 2000. Nrf2 and c-Jun regulation of antioxidant response element (ARE)-mediated expression and induction of gamma-glutamylcysteine synthetase heavy subunit gene. Biochem. Pharmacol. 59:1433-1439.[CrossRef][Medline]
  42. 22
  43. Karin, M. 1999. The beginning of the end: I{kappa}B kinase (IKK) and NF-{kappa}B activation. J. Biol. Chem. 274:27339-27342.[Free Full Text]
  44. 23
  45. Kataoka, K., M. Noda, and M. Nishizawa. 1994. Maf nuclear oncoprotein recognizes sequences related to an AP-1 site and forms heterodimers with both Fos and Jun. Mol. Cell. Biol. 14:700-712.[Abstract/Free Full Text]
  46. 24
  47. Kensler, T. W., J. D. Groopman, T. R. Sutter, T. J. Curphey, and B. D. Roebuck. 1999. Development of cancer chemopreventive agents: oltipraz as a paradigm. Chem. Res. Toxicol. 12:113-126.[CrossRef][Medline]
  48. 25
  49. Kim, Y.-C., H. Masutani, Y. Yamaguchi, K. Itoh, M. Yamamoto, and J. Yodoi. 2001. Hemin-induced activation of the thioredoxin gene by Nrf2. J. Biol. Chem. 276:18399-18406.[Abstract/Free Full Text]
  50. 26
  51. Kwak, M.-K., P. A. Egner, P. M. Dolan, M. Ramos-Gomez, J. D. Groopman, K. Itoh, M. Yamamoto, and T. W. Kensler. 2001. Role of phase 2 enzyme induction in chemoprotection by dithiolethiones. Mutat. Res. 480:305-315.
  52. 27
  53. Kwak, M.-K., K. Itoh, M. Yamamoto, T. R. Sutter, and T. W. Kensler. 2001. Role of transcription factor Nrf2 in the induction of hepatic phase 2 and antioxidative enzymes in vivo by the cancer chemoprotective agent, 3H-1,2-dithiole-3-thione. Mol. Med. 7:135-145.[Medline]
  54. 28
  55. Li, Y., and A. K. Jaiswal. 1992. Regulation of human NAD(P)H:quinone oxidoreductase gene: role of AP-1 binding site contained within human antioxidant response element. J. Biol. Chem. 267:15097-15104.[Abstract/Free Full Text]
  56. 29
  57. Liptay, S., R. M. Schmid, E. G. Nabel, and G. J. Nabel. 1994. Transcriptional regulation of NF-{kappa}B2: evidence for {kappa}B-mediated positive and negative autoregulation. Mol. Cell. Biol. 14:7695-7703.[Abstract/Free Full Text]
  58. 30
  59. MacMahon, M., K. Itoh, M. Yamamoto, S. A. Chanas, C. J. Henderson, L. I. McLellan, C. R. Wolf, C. Cavin, and J. D. Hayes. 2001. The cap'n'collar basic leucine zipper transcription factor Nrf2 (NF-E2 p45-related factor 2) controls both constitutive and inducible expression of intestinal detoxification and glutathione biosynthetic enzymes. Cancer Res. 61:3299-3307.[Abstract/Free Full Text]
  60. 31
  61. Moinova, H. R., and R. T. Mulcahy. 1998. An electrophile responsive element (EpRE) regulation of ß-naphthoflavone induction of the human {gamma}-glutamylcysteine synthetase regulatory subunit gene. Constitutive expression is mediated by an adjacent AP-1 site. J. Biol. Chem. 273:14683-14689.[Abstract/Free Full Text]
  62. 32
  63. Mulchay, R. T., M. A. Wartman, H. H. Bailey, and J. J. Gipp. 1997. Constitutive and ß-naphthoflavone-induced expression of the human {gamma}-glutamylcycteine synthetase heavy subunit gene is regulated by a distal antioxidant response element/TRE sequence. J. Biol. Chem. 272:7445-7454.[Abstract/Free Full Text]
  64. 33
  65. Nishimura, S., S. Takahashi, T. Kuroha, N. Suwabe, T. Nagasawa, C. Trainor, and M. Yamamoto. 2000. A GATA box in the GATA-1 gene hematopoietic enhancer is a critical element in the network of GATA factors and sites that regulate this gene. Mol. Cell. Biol. 20:713-723.[Abstract/Free Full Text]
  66. 34
  67. Ramos-Gomez, M., M.-K. Kwak, P. M. Dolan, K. Itoh, M. Yamamoto, P. Talalay, and T. W. Kensler. 2001. Sensitivity to carcinogenesis is increased and chemoprotective efficacy of enzymes inducers is lost in nrf2 transcription factor-deficient mice. Proc. Natl. Acad. Sci. USA 98:3410-3415.[Abstract/Free Full Text]
  68. 35
  69. Rushmore, T. H., R. G. King, K. E. Paulson, and C. B. Pickett. 1990. Regulation of glutathione S-transferase Ya subunit gene expression: identification of a unique xenobiotic-responsive element controlling inducible expression by planar aromatic compounds. Proc. Natl. Acad. Sci. USA 87:3826-3830.[Abstract/Free Full Text]
  70. 36
  71. Ryseck, R.-P., and R. Bravo. 1991. c-JUN, JUN B, and JUN D differ in their binding affinities to AP-1 and CRE consensus sequences: effect of FOS proteins. Oncogene 6:533-542.[Medline]
  72. 37
  73. Shapiro, T. A., J. W. Fahey, K. L. Wade, K. K. Stephenson, and P. Talalay. 2001. Chemoprotective glucosinolates and isothiocyanates of broccoli sprouts: metabolism and excretion in humans. Cancer Epidemiol. Biomarkers Prev. 10:501-508.[Abstract/Free Full Text]
  74. 38
  75. Venugopal, R., and A. K. Jaiswal. 1999. Coordinated induction of the c-jun gene with genes encoding quinine oxidoreductases in response to xenobiotics and antioxidants. Biochem. Pharmacol. 58:597-603.[CrossRef][Medline]
  76. 39
  77. Venugopal, R., and A. K. Jaiswal. 1996. Nrf1 and Nrf2 positively and c-Fos and Fra1 negatively regulate the human antioxidant response element-mediated expression of NAD(P)H:quinone oxidoreductase1 gene. Proc. Natl. Acad. Sci. USA 93:14960-14965.[Abstract/Free Full Text]
  78. 40
  79. Verma, I. M., and P. Sassone-Corsi. 1987. Proto-oncogene fos: complex but versatile regulation. Cell 51:513-514.[CrossRef][Medline]
  80. 41
  81. Wang, J.-S., X. Shen, X. He, Y.-R. Zhu, B.-C. Zhang, J.-B. Wang, G.-S. Qian, S.-Y. Kuang, A. Zarba, P. A. Egner, L. J. Jacobson, A. Muñoz, K. J. Helzlsouer, J. D. Groopman, and T. W. Kensler. 1999. Protective alterations in phase 1 and 2 metabolism of aflatoxin B1 by oltipraz in residents of Qidong, People's Republic of China. J. Natl. Cancer Inst. 91:347-354.[Abstract/Free Full Text]
  82. 42
  83. Wasserman, W. W., and W. E. Fahl. 1997. Functional antioxidant response element. Proc. Natl. Acad. Sci. USA 94:5361-5366.[Abstract/Free Full Text]
  84. 43
  85. Wild, A. C., H. R. Moinova, and R. T. Mulcahy. 1999. Regulation of {gamma}-glutamylcysteine synthetase subunit gene expression by the transcription factor Nrf2. J. Biol. Chem. 274:33627-33636.[Abstract/Free Full Text]
  86. 44
  87. Yamamoto, M., S. Takahashi, K. Onodera, Y. Muraosa, and J. D. Engel. 1997. Upstream and downstream of erythroid transcription factor GATA-1. Genes Cells 2:107-115.[Abstract]
  88. 45
  89. Yu, R., C. Chen, Y.-Y. Mo, V. Hebbar, E. D. Owuor, T.-H. Tan, and A.-N. T. Kong. 2000. Activation of mitogen-activated protein kinase pathways induces antioxidant response element-mediated gene expression via a Nrf2-dependent mechanism. J. Biol. Chem. 275:39907-39913.[Abstract/Free Full Text]
  90. 46
  91. Yuspa, S. H., D. Morgan, U. Lichti, E. F. Spangler, D. Michael, A. Kilkenny, and H. Hennings. 1986. Cultivation and characterization of cells derived from mouse skin papillomas induced by an initiation-promotion protocol. Carcinogenesis 7:949-958.[Abstract/Free Full Text]


Molecular and Cellular Biology, May 2002, p. 2883-2892, Vol. 22, No. 9
0270-7306/02/$04.00+0     DOI: 10.1128/MCB.22.9.2883-2892.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Li, W., Thakor, N., Xu, E. Y., Huang, Y., Chen, C., Yu, R., Holcik, M., Kong, A.-N. (2009). An internal ribosomal entry site mediates redox-sensitive translation of Nrf2. Nucleic Acids Res 0: gkp1048v1-gkp1048 [Abstract] [Full Text]  
  • Li, C.-Q., Kim, M. Y., Godoy, L. C., Thiantanawat, A., Trudel, L. J., Wogan, G. N. (2009). Nitric oxide activation of Keap1/Nrf2 signaling in human colon carcinoma cells. Proc. Natl. Acad. Sci. USA 106: 14547-14551 [Abstract] [Full Text]  
  • WIEGAND, H., WAGNER, A. E., BOESCH-SAADATMANDI, C., KRUSE, H.-P., KULLING, S., RIMBACH, G. (2009). Effect of Dietary Genistein on Phase II and Antioxidant Enzymes in Rat Liver. Cancer Genomics Proteomics 6: 85-92 [Abstract] [Full Text]  
  • Suzuki, M., Betsuyaku, T., Ito, Y., Nagai, K., Nasuhara, Y., Kaga, K., Kondo, S., Nishimura, M. (2008). Down-Regulated NF-E2-Related Factor 2 in Pulmonary Macrophages of Aged Smokers and Patients with Chronic Obstructive Pulmonary Disease. Am. J. Respir. Cell Mol. Bio. 39: 673-682 [Abstract] [Full Text]  
  • Noyan-Ashraf, M. H., Sadeghinejad, Z., Davies, G. F., Ross, A. R., Saucier, D., Harkness, T. A. A., Juurlink, B. H. J. (2008). Phase 2 Protein Inducers in the Diet Promote Healthier Aging. Journals of Gerontology Series A: Biological Sciences and Medical Sciences 63: 1168-1176 [Abstract] [Full Text]  
  • Xue, M., Qian, Q., Adaikalakoteswari, A., Rabbani, N., Babaei-Jadidi, R., Thornalley, P. J. (2008). Activation of NF-E2-Related Factor-2 Reverses Biochemical Dysfunction of Endothelial Cells Induced by Hyperglycemia Linked to Vascular Disease. Diabetes 57: 2809-2817 [Abstract] [Full Text]  
  • Ding, Y., Choi, K. J., Kim, J. H., Han, X., Piao, Y., Jeong, J.-H., Choe, W., Kang, I., Ha, J., Forman, H. J., Lee, J., Yoon, K.-S., Kim, S. S. (2008). Endogenous Hydrogen Peroxide Regulates Glutathione Redox via Nuclear Factor Erythroid 2-Related Factor 2 Downstream of Phosphatidylinositol 3-Kinase during Muscle Differentiation. Am. J. Pathol. 172: 1529-1541 [Abstract] [Full Text]  
  • Keum, Y.-S., Chang, P. P.-J., Kwon, K. H., Yuan, X., Li, W., Hu, L., Kong, A.-N. T. (2008). 3-Morpholinopropyl isothiocyanate is a novel synthetic isothiocyanate that strongly induces the antioxidant response element-dependent Nrf2-mediated detoxifying/antioxidant enzymes in vitro and in vivo. Carcinogenesis 29: 594-599 [Abstract] [Full Text]  
  • Shin, S., Wakabayashi, N., Misra, V., Biswal, S., Lee, G. H., Agoston, E. S., Yamamoto, M., Kensler, T. W. (2007). NRF2 Modulates Aryl Hydrocarbon Receptor Signaling: Influence on Adipogenesis. Mol. Cell. Biol. 27: 7188-7197 [Abstract] [Full Text]  
  • Purdom-Dickinson, S. E., Sheveleva, E. V., Sun, H., Chen, Q. M. (2007). Translational Control of Nrf2 Protein in Activation of Antioxidant Response by Oxidants. Mol. Pharmacol. 72: 1074-1081 [Abstract] [Full Text]  
  • Marzec, J. M., Christie, J. D., Reddy, S. P., Jedlicka, A. E., Vuong, H., Lanken, P. N., Aplenc, R., Yamamoto, T., Yamamoto, M., Cho, H.-Y., Kleeberger, S. R. (2007). Functional polymorphisms in the transcription factor NRF2 in humans increase the risk of acute lung injury. FASEB J. 21: 2237-2246 [Abstract] [Full Text]  
  • Aleksunes, L. M., Manautou, J. E. (2007). Emerging Role of Nrf2 in Protecting Against Hepatic and Gastrointestinal Disease. Toxicol Pathol 35: 459-473 [Abstract] [Full Text]  
  • Katzenellenbogen, M., Mizrahi, L., Pappo, O., Klopstock, N., Olam, D., Barash, H., Domany, E., Galun, E., Goldenberg, D. (2007). Molecular mechanisms of the chemopreventive effect on hepatocellular carcinoma development in Mdr2 knockout mice. Molecular Cancer Therapeutics 6: 1283-1291 [Abstract] [Full Text]  
  • Kim, Y.-J., Ahn, J.-Y., Liang, P., Ip, C., Zhang, Y., Park, Y.-M. (2007). Human prx1 Gene Is a Target of Nrf2 and Is Up-regulated by Hypoxia/Reoxygenation: Implication to Tumor Biology. Cancer Res. 67: 546-554 [Abstract] [Full Text]  
  • Cao, Z., Zhu, H., Zhang, L., Zhao, X., Zweier, J. L., Li, Y. (2006). Antioxidants and Phase 2 Enzymes in Cardiomyocytes: Chemical Inducibility and Chemoprotection Against Oxidant and Simulated Ischemia-Reperfusion Injury. Exp. Biol. Med. 231: 1353-1364 [Abstract] [Full Text]  
  • Ross, S. A., Finley, J. W., Milner, J. A. (2006). Allyl Sulfur Compounds from Garlic Modulate Aberrant Crypt Formation. J. Nutr. 136: 852S-854S [Abstract] [Full Text]  
  • Huang, Y., Yan, J., Lubet, R., Kensler, T. W., Sutter, T. R. (2006). Identification of novel transcriptional networks in response to treatment with the anticarcinogen 3H-1,2-dithiole-3-thione. Physiol. Genomics 24: 144-153 [Abstract] [Full Text]  
  • Korashy, H. M., El-Kadi, A. O. S. (2006). TRANSCRIPTIONAL REGULATION OF THE NAD(P)H:QUINONE OXIDOREDUCTASE 1 AND GLUTATHIONE S-TRANSFERASE YA GENES BY MERCURY, LEAD, AND COPPER. Drug Metab. Dispos. 34: 152-165 [Abstract] [Full Text]  
  • Kim, H.-J., Nel, A. E. (2005). The Role of Phase II Antioxidant Enzymes in Protecting Memory T Cells from Spontaneous Apoptosis in Young and Old Mice. J. Immunol. 175: 2948-2959 [Abstract] [Full Text]  
  • Feng, R., Lu, Y., Bowman, L. L., Qian, Y., Castranova, V., Ding, M. (2005). Inhibition of Activator Protein-1, NF-{kappa}B, and MAPKs and Induction of Phase 2 Detoxifying Enzyme Activity by Chlorogenic Acid. J. Biol. Chem. 280: 27888-27895 [Abstract] [Full Text]  
  • Miao, W., Hu, L., Scrivens, P. J., Batist, G. (2005). Transcriptional Regulation of NF-E2 p45-related Factor (NRF2) Expression by the Aryl Hydrocarbon Receptor-Xenobiotic Response Element Signaling Pathway: DIRECT CROSS-TALK BETWEEN PHASE I AND II DRUG-METABOLIZING ENZYMES. J. Biol. Chem. 280: 20340-20348 [Abstract] [Full Text]  
  • Li, N., Alam, J., Venkatesan, M. I., Eiguren-Fernandez, A., Schmitz, D., Di Stefano, E., Slaughter, N., Killeen, E., Wang, X., Huang, A., Wang, M., Miguel, A. H., Cho, A., Sioutas, C., Nel, A. E. (2004). Nrf2 Is a Key Transcription Factor That Regulates Antioxidant Defense in Macrophages and Epithelial Cells: Protecting against the Proinflammatory and Oxidizing Effects of Diesel Exhaust Chemicals. J. Immunol. 173: 3467-3481 [Abstract] [Full Text]  
  • McMahon, M., Thomas, N., Itoh, K., Yamamoto, M., Hayes, J. D. (2004). Redox-regulated Turnover of Nrf2 Is Determined by at Least Two Separate Protein Domains, the Redox-sensitive Neh2 Degron and the Redox-insensitive Neh6 Degron. J. Biol. Chem. 279: 31556-31567 [Abstract] [Full Text]  
  • Zhang, Y., Gordon, G. B. (2004). A strategy for cancer prevention: Stimulation of the Nrf2-ARE signaling pathway. Molecular Cancer Therapeutics 3: 885-893 [Abstract] [Full Text]  
  • Cullinan, S. B., Diehl, J. A. (2004). PERK-dependent Activation of Nrf2 Contributes to Redox Homeostasis and Cell Survival following Endoplasmic Reticulum Stress. J. Biol. Chem. 279: 20108-20117 [Abstract] [Full Text]  
  • Suh, J. H., Shenvi, S. V., Dixon, B. M., Liu, H., Jaiswal, A. K., Liu, R.-M., Hagen, T. M. (2004). Decline in transcriptional activity of Nrf2 causes age-related loss of glutathione synthesis, which is reversible with lipoic acid. Proc. Natl. Acad. Sci. USA 101: 3381-3386 [Abstract] [Full Text]  
  • Kwak, M.-K., Wakabayashi, N., Greenlaw, J. L., Yamamoto, M., Kensler, T. W. (2003). Antioxidants Enhance Mammalian Proteasome Expression through the Keap1-Nrf2 Signaling Pathway. Mol. Cell. Biol. 23: 8786-8794 [Abstract] [Full Text]  
  • Zhang, D. D., Hannink, M. (2003). Distinct Cysteine Residues in Keap1 Are Required for Keap1-Dependent Ubiquitination of Nrf2 and for Stabilization of Nrf2 by Chemopreventive Agents and Oxidative Stress. Mol. Cell. Biol. 23: 8137-8151 [Abstract] [Full Text]  
  • McMahon, M., Itoh, K., Yamamoto, M., Hayes, J. D. (2003). Keap1-dependent Proteasomal Degradation of Transcription Factor Nrf2 Contributes to the Negative Regulation of Antioxidant Response Element-driven Gene Expression. J. Biol. Chem. 278: 21592-21600 [Abstract] [Full Text]  
  • Walsh, A. C. (2003). Regulation of Nrf2-Mediated Induction of Glutamate Cysteine Ligase Modulatory Gene (GCLM) Expression: Considerations for Future Studies. Toxicol Sci 73: 1-3 [Abstract] [Full Text]  
  • Lee, J.-M., Calkins, M. J., Chan, K., Kan, Y. W., Johnson, J. A. (2003). Identification of the NF-E2-related Factor-2-dependent Genes Conferring Protection against Oxidative Stress in Primary Cortical Astrocytes Using Oligonucleotide Microarray Analysis. J. Biol. Chem. 278: 12029-12038 [Abstract] [Full Text]  
  • Kwak, M.-K., Wakabayashi, N., Itoh, K., Motohashi, H., Yamamoto, M., Kensler, T. W. (2003). Modulation of Gene Expression by Cancer Chemopreventive Dithiolethiones through the Keap1-Nrf2 Pathway. IDENTIFICATION OF NOVEL GENE CLUSTERS FOR CELL SURVIVAL. J. Biol. Chem. 278: 8135-8145 [Abstract] [Full Text]  
  • Nguyen, T., Sherratt, P. J., Huang, H.-C., Yang, C. S., Pickett, C. B. (2003). Increased Protein Stability as a Mechanism That Enhances Nrf2-mediated Transcriptional Activation of the Antioxidant Response Element. DEGRADATION OF Nrf2 BY THE 26 S PROTEASOME. J. Biol. Chem. 278: 4536-4541 [Abstract] [Full Text]  
  • Pietsch, E. C., Chan, J. Y., Torti, F. M., Torti, S. V. (2003). Nrf2 Mediates the Induction of Ferritin H in Response to Xenobiotics and Cancer Chemopreventive Dithiolethiones. J. Biol. Chem. 278: 2361-2369 [Abstract] [Full Text]  
  • Stewart, D., Killeen, E., Naquin, R., Alam, S., Alam, J. (2003). Degradation of Transcription Factor Nrf2 via the Ubiquitin-Proteasome Pathway and Stabilization by Cadmium. J. Biol. Chem. 278: 2396-2402 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kwak, M.-K.
Right arrow Articles by Kensler, T. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kwak, M.-K.
Right arrow Articles by Kensler, T. W.