Previous Article | Next Article ![]()
Molecular and Cellular Biology, May 2002, p. 3024-3034, Vol. 22, No. 9
0270-7306/02/$04.00+0 DOI: 10.1128/MCB.22.9.3024-3034.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Department of Pathology, Harvard Medical School, Boston, Massachusetts 02115,1 Genetics Unit, Department of Biochemistry, Oxford University, Oxford OX1 3QU, United Kingdom2
Received 18 October 2001/ Returned for modification 28 November 2001/ Accepted 31 January 2002
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The developmental roles of HDACs are just beginning to be identified. Generation of germ line clones of a strong hypomorphic allele of Drosophila Rpd3, a class I deacetylase, results in embryonic lethality, highlighting a specific role for RPD3 in segmentation control during embryogenesis (36). Furthermore, in C. elegans, RNA-mediated interference (RNAi) (12) of maternal and zygotic expression of the C. elegans homolog of Rpd3p, HDA-1, results in embryonic lethality. Although cells that form muscle, hypoderm, and intestine are present and appear to be terminally differentiated, the embryos nevertheless die prior to elongation (43; P. Dufourcq and Y. Shi, unpublished results). In addition to its role in embryogenesis, recent RNAi studies have suggested a possible postembryonic function for HDA-1 in C. elegans vulval development (35, 45).
Here, we report the identification and results of analyses of an hda-1 genetic mutant. We provide genetic, molecular, and biochemical evidence that this hda-1 mutant is the previously isolated gon-10 mutant (named for gonadogenesis defective 10). Phenotypic analysis of gon-10 animals revealed multiple developmental defects in gonadogenesis and vulval development. The gonadogenesis defects are characterized by the lack of organized somatic gonad structures, which suggests that these abnormalities may be due to defects in tissue morphogenesis. Hermaphrodite gon-10 animals also display a protruding or everted vulva and often develop multivulvae as a result of hyperinduction of vulval cells. Since gonadogenesis and vulval development are regulated by Notch and Ras, respectively (reviewed in reference 26), our findings suggest that hda-1 may be a component of these two signaling pathways. Consistent with this hypothesis, we have identified lag-2, a gene that encodes a homolog of the Notch ligand Delta, as a potential target for HDA-1. In summary, we provide compelling evidence that a ubiquitous histone deacetylase plays specific roles in a number of critical developmental decision processes in C. elegans.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Isolation of gon-10(e1795). A mutation induced by ethyl methanesulfonate, originally designated gon-10(e1795), was isolated while screening for abnormal sexual development and mapped to a location on linkage group V, between the egl-41 and unc-76 loci. Hermaphrodites homozygous for e1795 were sterile and maintained as heterozygotes. gon-10(e1795) animals were outcrossed five times; the gon-10(e1795) gene was marked by dpy-11(e224) and balanced by unc-76(e911). In order to score for progeny, larvae, or eggs, adult heterozygote hermaphrodites were allowed to lay eggs for a short period of time, and progeny were examined through time course analysis.
Transformation rescue of gon-10(e1795). Nested PCR primers were used to isolate the hda-1 gene using cosmid D1027 (canonical form of cosmid C53A5) as a template. The PCR primers were designed on the basis of the sequence information from cosmid C53A5. The outer primer pair is 3361S/6946R (TGCCTCAAAGAGCTTTCCTACG/CATCCAACATCAGATGAAGACAGAC), and the inner primer pair is 3881S/6799R (TTCAACATCGTGAGAGCGTGG/CGACATAAACGATGTCAACTGC). Transgenic lines were established as described previously (37). To perform rescue experiments, we marked gon-10(e1795) with dpy-11. Since dpy-11 is closely linked to gon-10(e1795), we used the Dpy phenotype as an indicator for homozygosity of the gon-10 locus; homozygote dpy-11(e224) gon-10(e1795) animals are phenotypically Dpy, characterized by short and fat physical appearance. If rescue is complete, the sterile homozygous gon-10(e1795) animals with the Dpy phenotype are expected to become fertile. Hermaphrodites were injected with a mixture of test DNA and a green fluorescence protein (GFP) marker pPD97.93 myo-3::gfp at 20 ng/µl. GFP was used to monitor the germ line transmission frequency of the hda-1 transgene. For all transgenic lines, the transmission rate was approximately 60%.
RNAi. RNAi experiments were performed as described previously (12). yk109d9 (hda-1 cDNA) served as a template for the production of double-stranded hda-1 RNA using an in vitro transcription kit (Promega). Young adult animals were injected and allowed to lay eggs for 6 to 12 h. Five percent of the animals from eggs laid during the first 6 h survive through adulthood, while 100% of the animals from eggs laid during the second 6 h die during embryogenesis.
RT-PCR analysis. Reverse transcription-PCR (RT-PCR) analysis was performed to compare the mRNA levels corresponding to either the control sc35 gene (34) or the gfp and lag-2 genes in wild-type N2, lag-2::gfp, and lag-2::gfp; gon-10 transgenic lines. Thirty hermaphrodites (L4 larvae) were collected in Trizol reagent (Gibco BRL Life Technologies). After three cycles of freeze-thawing, total RNA was isolated. RT was performed with 500 ng of total RNA using the Superscript II RNase H- Reverse Transcriptase (Gibco BRL) and oligo(dT) primers (Gibco BRL) following the manufacturer's instructions. Three sets of primers were used for PCR as follows: sc35 F, 5' CAATGGTCTAACTTCGCTG 3'; sc35 R, 5' TATCTTGGAGATCTGGAGC 3'; GFP F, 5' GTAAAGGAGAAGAACTTTTCACTGG 3'; GFP R, 5' GTATAGTTCATCCATGCCATG 3'; lag-2 F, 5' CGCTGTGACATCGGATGGATGG 3'; and lag-2 R, 5' GATGGAGAAGATCACGAAGAGAGC 3'. The optimal number of cycles and amount of RT products used for the PCR were determined in preliminary experiments (not shown). Once the semiquantitative conditions were set up, the RT products were submitted to amplification with the different sets of primers. The samples were then subjected to analysis on an ethidium bromide-stained agarose gel.
Generation of HDA-1 polyclonal antibody and immunofluorescence. Rabbit polyclonal antiserum was raised against amino acids 374 to 460 of HDA-1 (now available at Santa Cruz Biotechnology, Inc., Santa Cruz, Calif.). The purified antibody recognized a single band at the expected position of 50 kDa (data not shown). In addition, the antibody detected strong immunoreactive signals in wild-type embryos but not in hda-1(RNAi) embryos (not shown).
To synchronize larvae, 20 N2, YS40, or YS47 hermaphrodites were allowed to lay eggs for 4 h before being transferred to new plates; eggs and larvae were subsequently harvested at specific time points as needed. Adult animals were fixed as described previously (10). Anti-HDA-1 antibody was used at a 1/500-fold dilution, and the monoclonal antibody MH27, which recognizes adherens junctions (15), was used at a 1/2,000-fold dilution.
| RESULTS |
|---|
|
|
|---|
The gon-10(e1795) mutant is an hda-1 mutant. To explore the hypothesis that the gon-10(e1795) mutant is an hda-1 mutant, we sequenced the hda-1 gene isolated from five independent gon-10(e1795) homozygote animals. We found that the hda-1 gene carried a single base change in the coding region which converts a conserved glycine (G) residue to glutamic acid (E) within the catalytic domain of HDA-1 (Fig. 1). No mutations were detected in the promoter region (approximately 1.5 kb) or in the 3' end of the gene (0.8 kb). This finding suggests the possibility that the hda-1 mutation may underlie the defects observed in gon-10(e1795) animals.
|
|
We predicted that if gon-10(e1795) is an hda-1 mutant, a wild-type copy of the hda-1 gene would rescue the gonad and sterile phenotype. To accomplish this, three independent transgenic lines were generated using a 3.3-kb hda-1 gene fragment which includes 1.8 kb of the promoter region, the entire coding region, and 0.54 kb of the 3' sequence. The gon-10 mutation was marked with the recessive marker dpy-11 (see Materials and Methods). We asked whether the transgenic F2 Dpy animals were fertile. In the absence of the hda-1 transgene, 6% (22 of 324) of the Dpy animals laid eggs as a result of recombination between the dpy-11 and gon-10 loci. However, in the presence of the hda-1 transgene, the fertility of Dpy animals rose to 54% (97 of 181). This increase is in line with the germ line transmission frequency of the hda-1 transgene (60%). Significantly, from the gon-10(e1795) homozygous but fertile animals that carry the hda-1 transgene (dpy-11 gon-10; bmEx1 [phda-1 (wild-type hda-1 gene) pPD97.93 (myo-3::gfp)]), we were able to establish three independent lines that are viable and fertile for at least three generations. These results show that a wild-type copy of the hda-1 gene can rescue gon-10(e1795) defects. Interestingly, HDA-1 with a point mutation (HDA-1H145F) predicted to abrogate the catalytic activity (24) failed to rescue gon-10, suggesting that the enzymatic activity of HDA-1 is important for its biological function.
Taken together, our findings show that HDA-1 protein is present at nearly undetectable levels in the gon-10(e1795) animals due to a point mutation in the hda-1 gene. This suggests that the gon-10(e1795) mutation causes a severe loss of function. In support of this interpretation, heterozygote animals carrying a copy of the gon-10 mutation in trans with a deficiency covering the hda-1 locus display phenotypes identical to those of the gon-10 homozygotes or animals in which zygotic hda-1 expression is selectively inhibited by RNAi. Thus, the result is consistent with the hypothesis that gon-10(e1795) is likely a genetic null hda-1 mutation.
The lack of zygotically expressed gon-10 HDA-1 causes defects in gonadogenesis and vulval development. To investigate the function of HDA-1 in C. elegans development, we analyzed the development of mutant hermaphrodites. Surprisingly, the gon-10(e1795) mutant exhibited a restricted role for HDA-1 in specific developmental processes. gon-10(e1795) homozygote animals complete embryogenesis and mature to adulthood presumably due to the maternal supply of the HDA-1 protein. However, adult animals are sterile with a number of interesting gonadal and vulval phenotypes. The main phenotypes are summarized in Table 1 and described below.
|
|
|
The vulva is derived from three of six potential vulval precursor cells (VPCs) (P5.p to P7.p cells) through a series of stereotypically oriented cell divisions. Whereas these VPCs undergo two longitudinal divisions, the third division is either longitudinal or transversal; 2 of the 12 cells resulting from the second division do not divide further (42). All gon-10(e1795) hermaphrodites display what appears to be a protruding vulva (Fig. 3B). Lineage analyses in gon-10(e1795) revealed that the first two rounds of cell division are oriented longitudinally, as in the wild type. However, cells that divide transversally during the third division in the wild type sometimes divide instead along the longitudinal axis in the mutant (Fig. 5C and D). Therefore, HDA-1 activity appears to be specifically required either for preventing the longitudinal division or promoting the transverse division during the final round of vulval cell division. In gon-10(e1795) animals, the abnormal division orientation is often accompanied by ectopic invagination in the region of the descendants of P5.p to P7.p cells (Fig. 5A and E).
|
|
|
| DISCUSSION |
|---|
|
|
|---|
HDA-1 and C. elegans gonadogenesis. Gonadogenesis in C. elegans involves the development of both germ cells and somatic gonad tissues. Somatic gonadogenesis involves two morphogenic processes, the extension of tissue buds that elongate and form the C. elegans bilobal gonad long arms and the formation of complex, differentiated epithelial tubes composed of distinct modular units, i.e., the uterus, spermatheca, and sheaths in hermaphrodites and the vesicle and vas deferens in males (30). One salient feature of the gonadogenesis phenotype in gon-10(e1795) animals is the lack of organized somatic gonad tissues. Using cell type-specific promoter-driven GFP genes as markers, we were able to visualize the presence of the various differentiated cells necessary for the formation of these tissues. Thus, the lack of organized somatic tissue is probably due to defects in tissue morphogenesis. Taken together, these findings suggest that genes whose products are important for cell-cell communication and cell polarity may be targets of HDA-1. It will be interesting to identify HDA-1 target genes during gonadogenesis to test this hypothesis.
Compared with the somatic gonad tissue defects, the germ line development appeared to be affected to a lesser extent in gon-10(e1795) mutants. Both mitosis and meiosis appear to take place, and as a result we could identify sperm and oocytes by Nomarski analysis. However, a reduction in the number of meiotic cells in the mutants was observed. At present, it is unclear whether germ line defects are direct or indirect consequences of the mutation. In our rescue experiments, we introduced the wild-type gene into gon-10(e1795) animals as simple tandem arrays, which are susceptible to germ line silencing (29). We were nonetheless able to achieve efficient rescue in which the rescued lines were stable for several generations. Since a low level of germ line expression might be sufficient for rescue, these findings do not rule out the possibility that the germ line defects may also be a direct consequence of the gon-10(e1795) mutation.
HDA-1 and C. elegans vulval development. Our analysis of gon-10(e1795) indicates that HDA-1 plays a crucial role in vulval development, a process in C. elegans which is known to be regulated positively by Ras signaling and negatively by the synMuv genes (named for synthetic multivulva) (8). Worms carrying combinations of two mutations of the synMuvA and synMuvB genes result in the synthetic multivulval phenotype (9). A number of transcription factors have been identified as synMuv genes, including the C. elegans homologs of E2F, DP1, and Rb (6, 35). Previous studies suggested that hda-1 acts as a synMuv gene (35, 45). However, we were unable to observe an increase in vulval cell induction when gon-10(e1795) was placed either in a synMuvA or synMuvB background. This discrepancy could be due to the fact that previous studies used RNAi, while this study analyzed a genetic mutant. We also cannot rule out the presence of a persisting maternal HDA-1 component or other histone deacetylase activities in the gon-10(e1795) mutant which might mask a synMuv phenotype. Interestingly, the lineage defect or morphogenic phenotype observed for gon-10(e1795) animals has also been reported for lin-40 metastasis-associated factor 1 (MTA) (7), which has been identified along with HDAC1 as a member of the NURD complex (32, 38). Further analyses are necessary to understand the precise molecular role of HDA-1 in vulval development.
Vulval development in C. elegans is also regulated by the LIN-12/Notch signaling pathways (reviewed in references 17 and 31). Through a mechanism of lateral inhibition, Notch signaling prevents certain VPCs from adopting the primary vulval cell fate. We show here that transcription of one of the Notch ligand-encoding genes, lag-2, is derepressed in gon-10(e1795) mutants, resulting in widespread expression of LAG-2. It is interesting to speculate that the abnormal expression of LAG-2 may contribute to the Muv phenotypes seen in gon-10(e1795) animals. It is possible that derepression of the expression of LAG-2 leads to overactivation of LIN-12/Notch signaling and mimics gain-of-function alleles of lin-12 which have already been shown to result in multivulval phenotypes (17, 18).
Corepressor complexes and development of the reproductive systems. In mammals, class I HDACs such as HDAC1 and HDAC2 (which are both homologs of HDA-1) are components of multiple corepressor complexes. HDAC1 and -2 have been found to be present in at least two distinct biochemical complexes, i.e., the SIN3 and NURD/Mi-2 complexes (32, 38). Members of the NURD/Mi-2 complex, with the exception of MBD3, are conserved in C. elegans. Interestingly, in addition to HDA-1, two other members of the NURD/Mi-2 complex, the C. elegans MTA1 homolog LIN-40, and Mi-2 homologs LET-418 and CHD-3 have recently been shown to play a role in vulval development (7, 45, 48). The C. elegans SIN3 complex is less well understood, but at least two components of this complex, SIN3 (encoded by open reading frame F02E9.4) and SAP18 (encoded by open reading frame C16C10.4), are present in C. elegans (1). Preliminary experiments suggest that inhibition of SIN3 expression results in sterile animals (unpublished result) and therefore may play a role in either one of these two processes.
In addition, HDAC1 and -2 also interact with Rb and Groucho, both of which are corepressors and can be targeted to promoters via interactions with DNA-binding transcription factors (reviewed in reference 32). The C. elegans Rb homolog LIN-35 has been shown to play a role in vulval development (35): the role of the C. elegans Groucho homolog UNC-37 in gonadogenesis and vulval development is unknown. However, on the basis of biochemical results, we predict that the SIN3 complex and UNC-37 probably play a role in either one or both of these processes. Since HDA-1 is a component of a number of the different corepressor complexes discussed above, it is not surprising that the hda-1 mutation can affect both gonadogenesis and vulval development in postembryonic C. elegans, perhaps acting through distinct corepressor complexes.
In summary, we have provided compelling evidence that the gon-10(e1795) mutant is an hda-1 mutant. We have shown that mutation in this ubiquitous histone deacetylase causes surprisingly specific defects during C. elegans development, compromising the development of somatic gonad tissues (germ cells and the vulva). Our findings highlight the essential and specific roles ubiquitously expressed histone deacetylases play in a multicellular organisms and suggest possible important functions for HDAC-containing corepressor complexes in the development of reproductive systems of other organisms as well.
| ACKNOWLEDGMENTS |
|---|
This work was supported in part by a grant from the National Institutes of Health (GM58012) to Y.S. P.D. was supported by a fellowship from the Lalor Foundation. M.V. was supported by a fellowship from the DAAD (German Scientific Exchange Service) and the Taplin Foundation. The Caenorhabditis Genetic Center is supported in part by the National Institutes of Health's National Center for Research Resources.
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
2.
Berset, T., E. F. Hoier, G. Battu, S. Canevascini, and A. Hajnal. 2001. Notch inhibition of RAS signaling through MAP kinase phosphatase LIP-1 during C. elegans vulval development. Science 291:1055-1058.
3.
Brenner, S. 1974. The genetics of Caenorhabditis elegans. Genetics 77:71-94.
4. Burdine, R. D., C. S. Branda, and M. J. Stern. 1998. EGL-17(FGF) expression coordinates the attraction of the migrating sex myoblasts with vulval induction in C. elegans. Development 125:1083-1093.[Abstract]
5. Calvo, D., M. Victor, F. Gay, G. Sui, M. P. Luke, P. Dufourcq, G. Wen, M. Maduro, J. Rothman, and Y. Shi. 2001. A POP-1 repressor complex restricts inappropriate cell type-specific gene transcription during Caenorhabditis elegans embryogenesis. EMBO J. 20:7197-7208.[CrossRef][Medline]
6. Ceol, C. J., and H. R. Horvitz. 2001. dpl-1 DP and efl-1 E2F act with lin-35 Rb to antagonize Ras signaling in C. elegans vulval development. Mol. Cell 7:461-473.[CrossRef][Medline]
7.
Chen, Z., and M. Han. 2001. Role of C. elegans lin-40 MTA in vulval fate specification and morphogenesis. Development 128:4911-4921.
8. Fay, D. S., and M. Han. 2000. The synthetic multivulval genes of C. elegans: functional redundancy, Ras-antagonism, and cell fate determination. Genesis 26:279-284.[CrossRef][Medline]
9.
Ferguson, E. L., and H. R. Horvitz. 1989. The multivulva phenotype of certain Caenorhabditis elegans mutants results from defects in two functionally redundant pathways. Genetics 123:109-121.
10. Finney, M., and G. Ruvkun. 1990. The unc-86 gene product couples cell lineage and cell identity in C. elegans. Cell 63:895-905.[CrossRef][Medline]
11. Finnin, M. S., J. R. Donigian, A. Cohen, V. M. Richon, R. A. Rifkind, P. A. Marks, R. Breslow, and N. P. Pavletich. 1999. Structures of a histone deacetylase homologue bound to the TSA and SAHA inhibitors. Nature 401:188-193.[CrossRef][Medline]
12. Fire, A., S. Xu, M. K. Montgomery, S. A. Kostas, S. E. Driver, and C. C. Mello. 1998. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391:806-811.[CrossRef][Medline]
13.
Fischle, W., S. Emiliani, M. J. Hendzel, T. Nagase, N. Nomura, W. Voelter, and E. Verdin. 1999. A new family of human histone deacetylases related to Saccharomyces cerevisiae HDA1p. J. Biol. Chem. 274:11713-11720.
14. Fitzgerald, K., and I. Greenwald. 1995. Interchangeability of Caenorhabditis elegans DSL proteins and intrinsic signaling activity of their extracellular domains in vivo. Development 121:4275-4282.[Abstract]
15.
Francis, R., and R. H. Waterston. 1991. Muscle cell attachment in Caenorhabditis elegans. J. Cell Biol. 114:465-479.
16. Gray, S. G., and T. J. Ekstrom. 2001. The human histone deacetylase family. Exp. Cell Res. 262:75-83.[CrossRef][Medline]
17.
Greenwald, I. 1998. LIN-12/Notch signaling: lessons from worms and flies. Genes Dev. 12:1751-1762.
18. Greenwald, I. S., P. W. Sternberg, and H. R. Horvitz. 1983. The lin-12 locus specifies cell fates in Caenorhabditis elegans. Cell 34:435-444.[CrossRef][Medline]
19.
Grozinger, C. M., C. A. Hassig, and S. L. Schreiber. 1999. Three proteins define a class of human histone deacetylases related to yeast Hda1p. Proc. Natl. Acad. Sci. USA 96:4868-4873.
20. Grunstein, M. 1997. Histone acetylation in chromatin structure and transcription. Nature 389:349-352.[CrossRef][Medline]
21.
Gu, T., S. Orita, and M. Han. 1998. Caenorhabditis elegans SUR-5, a novel but conserved protein, negatively regulates LET-60 Ras activity during vulval induction. Mol. Cell. Biol. 18:4556-4564.
22. Hall, D. H., V. P. Winfrey, G. Blaeuer, L. H. Hoffman, T. Furuta, K. L. Rose, O. Hobert, and D. Greenstein. 1999. Ultrastructural features of the adult hermaphrodite gonad of Caenorhabditis elegans: relations between the germ line and soma. Dev. Biol. 212:101-123.[CrossRef][Medline]
23. Hanna-Rose, W., and M. Han. 2002. The Caenorhabditis elegans EGL-26 protein mediates vulval cell morphogenesis. Dev. Biol. 241:247-258.[CrossRef][Medline]
24.
Hassig, C. A., J. K. Tong, T. C. Fleischer, T. Owa, P. G. Grable, D. E. Ayer, and S. L. Schreiber. 1998. A role for histone deacetylase activity in HDAC1-mediated transcriptional repression. Proc. Natl. Acad. Sci. USA 95:3519-3524.
25. Henderson, S. T., D. Gao, E. J. Lambie, and J. Kimble. 1994. lag-2 may encode a signaling ligand for the GLP-1 and LIN-12 receptors of C. elegans. Development 120:2913-2924.[Abstract]
26. Herman, T., and H. R. Horvitz. 1997. Mutations that perturb vulval invagination in C. elegans. Cold Spring Harbor Symp. Quant. Biol. 62:353-359.
27. Imai, S., C. M. Armstrong, M. Kaeberlein, and L. Guarente. 2000. Transcriptional silencing and longevity protein Sir2 is an NAD-dependent histone deacetylase. Nature 403:795-800.[CrossRef][Medline]
28. Imhof, A., X. J. Yang, V. V. Ogryzko, Y. Nakatani, A. P. Wolffe, and H. Ge. 1997. Acetylation of general transcription factors by histone acetyltransferases. Curr. Biol. 7:689-692.[CrossRef][Medline]
29. Kelly, W. G., S. Xu, M. K. Montgomery, and A. Fire. 1997. Distinct requirements for somatic and germline expression of a generally expressed Caenorhabditis elegans gene. Genetics 146:227-238.[Abstract]
30. Kimble, J., and D. Hirsh. 1979. The postembryonic cell lineages of the hermaphrodite and male gonads in Caenorhabditis elegans. Dev. Biol. 70:396-417.[CrossRef][Medline]
31. Kimble, J., and P. Simpson. 1997. The LIN-12/Notch signaling pathway and its regulation. Annu. Rev. Cell Dev. Biol. 13:333-361.
32. Knoepfler, P. S., and R. N. Eisenman. 1999. Sin meets NuRD and other tails of repression. Cell 99:447-450.[CrossRef][Medline]
33.
Landry, J., A. Sutton, S. T. Tafrov, R. C. Heller, J. Stebbins, L. Pillus, and R. Sternglanz. 2000. The silencing protein SIR2 and its homologs are NAD-dependent protein deacetylases. Proc. Natl. Acad. Sci. USA 97:5807-5811.
34. Longman, D., I. L. Johnstone, and J. F. Caceres. 2000. Functional characterization of SR and SR-related genes in Caenorhabditis elegans. EMBO J. 19:1625-1637.[CrossRef][Medline]
35. Lu, X., and H. R. Horvitz. 1998. lin-35 and lin-53, two genes that antagonize a C. elegans Ras pathway, encode proteins similar to Rb and its binding protein RbAp48. Cell 95:981-991.[CrossRef][Medline]
36.
Mannervik, M., and M. Levine. 1999. The Rpd3 histone deacetylase is required for segmentation of the Drosophila embryo. Proc. Natl. Acad. Sci. USA 96:6797-6801.
37. Mello, C. C., J. M. Kramer, D. Stinchcomb, and V. Ambros. 1991. Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10:3959-3970.[Medline]
38. Ng, H. H., and A. Bird. 2000. Histone deacetylases: silencers for hire. Trends Biochem. Sci. 25:121-126.[CrossRef][Medline]
39. Pazin, M. J., and J. T. Kadonaga. 1997. What's up and down with histone deacetylation and transcription? Cell 89:325-328.[CrossRef][Medline]
40. Pettitt, J., W. B. Wood, and R. H. Plasterk. 1996. cdh-3, a gene encoding a member of the cadherin superfamily, functions in epithelial cell morphogenesis in Caenorhabditis elegans. Development 122:4149-4157.[Abstract]
41. Roth, S. Y., and C. D. Allis. 1996. Histone acetylation and chromatin assembly: a single escort, multiple dances? Cell 87:5-8.[CrossRef][Medline]
42. Sharma-Kishore, R., J. G. White, E. Southgate, and B. Podbilewicz. 1999. Formation of the vulva in Caenorhabditis elegans: a paradigm for organogenesis. Development 126:691-699.[Abstract]
43.
Shi, Y., and C. Mello. 1998. A CBP/p300 homolog specifies multiple differentiation pathways in Caenorhabditis elegans. Genes Dev. 12:943-955.
44.
Smith, J. S., C. B. Brachmann, I. Celic, M. A. Kenna, S. Muhammad, V. J. Starai, J. L. Avalos, J. C. Escalante-Semerena, C. Grubmeyer, C. Wolberger, and J. D. Boeke. 2000. A phylogenetically conserved NAD+-dependent protein deacetylase activity in the Sir2 protein family. Proc. Natl. Acad. Sci. USA 97:6658-6663.
45. Solari, F., and J. Ahringer. 2000. NURD-complex genes antagonise Ras-induced vulval development in Caenorhabditis elegans. Curr. Biol. 10:223-226.[CrossRef][Medline]
46. Tax, F. E., J. J. Yeargers, and J. H. Thomas. 1994. Sequence of C. elegans lag-2 reveals a cell-signaling domain shared with Delta and Serrate of Drosophila. Nature 368:150-154.[CrossRef][Medline]
47.
Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins. 1997. The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25:4876-4882.
48. von Zelewsky, T., F. Palladino, K. Brunschwig, H. Tobler, A. Hajnal, and F. Muller. 2000. The C. elegans Mi-2 chromatin-remodeling proteins function in vulval cell fate determination. Development 127:5277-5284.[Abstract]
49. Wilkinson, H. A., K. Fitzgerald, and I. Greenwald. 1994. Reciprocal changes in expression of the receptor lin-12 and its ligand lag-2 prior to commitment in a C. elegans cell fate decision. Cell 79:1187-1198.[CrossRef][Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|