The Internal Ribosome Entry Site-Mediated Translation of Antiapoptotic Protein XIAP Is Modulated by the Heterogeneous Nuclear Ribonucleoproteins C1 and C2

The X-chromosome-linked inhibitor of apoptosis, XIAP, is themost powerful and ubiquitous intrinsic inhibitor of apoptosis.We have shown previously that the translation of XIAP is controlledby a potent internal ribosome entry site (IRES) element. IRES-mediatedtranslation of XIAP is increased in response to cellular stress,suggesting the critical role for IRES translation during cellularstress. Here, we demonstrate that heterogeneous nuclear ribonucleoproteinsC1 and C2 (hnRNPC1 and -C2) are part of the RNP complex thatforms on XIAP IRES. Furthermore, the cellular levels of hnRNPC1and -C2 parallel the activity of XIAP IRES and the overexpressionof hnRNPC1 and -C2 specifically enhanced translation of XIAPIRES, suggesting that hnRNPC1 and -C2 may modulate XIAP expression.Given the central role of XIAP in the regulation of apoptosisthese results are important for our understanding of the controlof apoptosis.

INTRODUCTION

Top

Introduction

Programmed cell death, apoptosis, is an organized, geneticallydetermined process that is unique to multicellular organisms.Apoptosis is thought to have evolved specifically to regulatecellular homeostasis by removing damaged or redundant cellsthat could otherwise jeopardize survival of the whole organism.The study of mechanisms of apoptosis has been at the forefrontof molecular biology since it was recognized that the misregulationof the apoptotic process has devastating consequences. Indeed,the aberrant regulation of apoptosis has been implicated invarious disorders ranging from cancer to autoimmunity to neurodegeneration.Control of apoptosis has therefore emerged as a key pharmacologicaltarget (29). One group of genes involved in the regulation ofapoptosis, the inhibitor of apoptosis (IAP) family of genes,block cysteine proteases known as caspases. Since the activationand amplification of the caspase cascade are essential to theexecution of apoptosis, the IAP proteins are considered to bethe key regulators of apoptosis by virtue of their ability todirectly bind and inhibit distinct caspases (21). The X-linkedinhibitor of apoptosis, XIAP (GenBank accession no. U45880),is the prototype of the IAP family (reviewed in reference 12).XIAP is the most potent inhibitor of both the initiator (caspase-9)and effector (caspase-3 and -7) caspases. Furthermore, XIAPhas a number of other physiologically important cellular functions,including receptor-mediated signaling, ubiquitination, and cellcycle control (reviewed in reference 10).

We previously found that the expression of XIAP is controlledat the level of translation initiation; XIAP mRNA is translatedby internal ribosome initiation mediated by a potent internalribosome entry site (IRES) element located in its 5' untranslatedregion (UTR) (13). Significantly, the XIAP IRES is active underconditions of cellular stress such as serum starvation and low-dosegamma irradiation-induced apoptosis, conditions that lead tothe inhibition of cellular protein synthesis. This suggeststhat the function of XIAP IRES is to maintain or increase thesynthesis of the XIAP protein during cellular stress. Furthermore,we discovered that IRES-mediated upregulation of XIAP in responseto irradiation enhances the survival of some cancer cell lines,suggesting that enhanced IRES translation may, in fact, be criticallyinvolved in the progression of cancer (16). XIAP IRES-mediatedregulation, which is the first example of the regulation ofan antiapoptotic gene at the translational level, may thereforeconfer important survival activity to the cell under acute buttransient apoptotic situations.

Deletion and mutation analyses showed that the XIAP IRES was162 nucleotides (nt) long (13). We began to identify proteinsthat specifically interact with the RNA sequence of XIAP IRESand could therefore function as the regulators of XIAP IRESactivity. A sequence-specific RNA-protein complex that consistsof at least four cellular proteins assembles on the XIAP IRES(11). UV cross-linking experiments further revealed that theautoantigen La is an essential part of the XIAP IRES RNP complexbut excluded two other known IRES-binding proteins, PTB andPCBP, from binding to XIAP IRES (11). In the present paper weidentify heterogeneous nuclear ribonucleoproteins C1 and C2(hnRNPC1 and -C2) as part of the XIAP IRES RNP complex. Significantly,we found that the cellular levels of hnRNPC1 and -C2 correlatewith the XIAP IRES activity in vivo. Furthermore, overexpressionof hnRNPC1 and -C2 specifically increased XIAP IRES translation.Our data therefore suggest that hnRNPC1 and -C2 bind to theXIAP IRES element and are involved in the modulation of XIAPIRES translation.

MATERIALS AND METHODS

Top

Materials and Methods

Cell culture and reagents. Human embryonic kidney (293T), human squamous lung carcinomacells (H520), human non-small-lung-cell carcinoma cells (H661),and human ovary adenocarcinoma cells (SKOV3) were cultured instandard conditions as described previously (16). TransientDNA transfections were conducted by using Lipofectamine 2000reagent (Invitrogen) in accordance with the protocol providedby the manufacturer. The expression plasmids pFLAG-hnRNPC1 andpFLAG-hnRNPC2 were constructed by inserting reverse transcription-PCR(RT-PCR)-generated hnRNPC1 or hnRNPC2 cDNAs into the pcDNA3vector (Invitrogen) containing the coding sequence for the FLAGepitope sequence (generous gift from A. Kimchi). The glutathioneS-transferase (GST) fusion expression plasmids pGEX-hnRNPC1and pGEX-hnRNPC2 were constructed by inserting RT-PCR-generatedhnRNPC1 or hnRNPC2 cDNAs into the pGEX-KG vector (Amersham Pharmacia).The bicistronic vector pßgal/hUTR/CAT containing thehuman XIAP IRES element was described previously (13). The IRESelement of apoptotic protease-activating factor 1 (Apaf-1; GenBankaccession no. NM013229) was amplified by RT-PCR from total RNAisolated from BJAB cells with primers 5'-CTCGAGAAGAAGAAGTAGCGAGTGand 5'-CTCGAGCTTCCCTCAGATCTTTCTCTCTC and inserted into the linkerregion of the bicistronic vector pßgal/CAT (13).

Western blot analysis. Cells were harvested in ice-cold phosphate-buffered saline (PBS),lysed in radioimmunoprecipitation assay buffer (1% NP-40, 1%sodium deoxycholate, 0.1% sodium dodecyl sulfate [SDS], 0.15M NaCl, 0.01 M sodium phosphate [pH 7.2], 2 mM EDTA, 0.1 mMphenylmethylsulfonyl fluoride) for 30 min at 4°C, followedby centrifugation at 14,000 x g for 10 min. Protein concentrationwas assayed with a protein assay kit (Bradford assay; Bio-RadLaboratories), and equal amounts of protein samples were separatedby SDS-10% polyacrylamide gel electrophoresis (PAGE). Sampleswere analyzed by Western blotting using mouse monoclonal anti-hnRNPCantibody 4F4 (generous gift from G. Dreyfuss), a mouse monoclonalantiactin antibody (Sigma), or a mouse monoclonal anti-FLAGM2 antibody (Stratagene) at 1:10,000 dilution followed by asecondary antibody (horseradish peroxidase-conjugated sheepanti-mouse immunoglobulin G; Amersham). Antibody complexes weredetected by using the ECL system (Amersham).

Cell extracts and EMSAs. The cellular extracts (S10) were prepared as previously described(17). The GST fusion proteins were purified as described previously(11). For electrophoretic mobility shift assays (EMSAs), DNAtemplates for synthesis of the XIAP or Apaf-1 IRES RNA probeswere generated by PCR using XIAP IRES-specific primers describedpreviously (11) or the Apaf-1-specific primers described above.The 5' primers also incorporated the T7 promoter sequence (14).Internally labeled RNA probes were synthesized by in vitro transcriptionwith T7 polymerase (MAXIScript T7 RNA polymerase kit; Ambion)in the presence of [ ${alpha}$ -³²P]UTP (Amersham). The XIAP IRES and non-IRESprobes were described previously (11). EMSA analyses were carriedout as detailed previously (11). Briefly, 15,000 cpm of labeledRNA was mixed with 30 µg of 293T S10 extract in a totalvolume of 15 µl at room temperature for 30 min, followedby the addition of 1 µl of RNase T₁ (1 U/µl) andincubation for an additional 10 min at room temperature; heparinwas added to a final concentration of 5 mg/ml. The ribonucleoproteincomplex was electrophoresed on a 3% native acrylamide gel at4°C.

UV cross-linking and immunoprecipitation. RNA-protein complexes for UV cross-linking and immunoprecipitationwere prepared as described above. Before RNase T₁ was added,the samples were transferred into a 96-well dish and irradiatedon ice with a 254-nm UV light source at 400,000 µJ/cm².UV-irradiated RNA-protein complexes were treated with RNaseT₁ as described above and diluted in 50 µl of PBS-NP-40buffer (1x PBS, 2 mM EDTA, 2 mM EGTA, 0.05% NP-40), and 3 µlof monoclonal anti-hnRNPC antibody 4F4 and 20 µl of proteinA plus G agarose (Calbiochem) were added. The samples were incubatedat room temperature for 30 min and then washed five times inHEPES-NP-40 buffer (15 mM HEPES, 150 mM NaCl, 1 mM EDTA, 0.5%NP-40). The immunoprecipitated RNA-protein complexes were releasedfrom the agarose beads by boiling in SDS loading buffer (100mM Tris [pH 6.8], 2.5% SDS, 10% glycerol, 0.025% ß-mercaptoethanol,0.1% bromophenol blue), resolved on an SDS-10% PAGE gel, andvisualized by autoradiography. Alternatively, the RNA-proteincomplexes were formed with the purified GST, GST-hnRNPC1, orGST-hnRNPC2 fusion proteins and UV cross-linked as describedabove. The RNA-protein complexes were resolved on an SDS-10%PAGE gel and visualized by autoradiography.

XIAP mRNA was coimmunoprecipitated from whole-cell extractsby using the modified method of Seto et al. (31) as describedpreviously (11). Briefly, transfected 293T cells from a 35-mm-diameterdish were harvested in 1 ml of cold PBS and collected by low-speedcentrifugation at 4°C. The cell pellets were resuspendedin 100 µl of RNA binding buffer (above) supplemented with10 U of RNase inhibitor (5 Prime-3 Prime), and cell extractswere prepared by the freeze-thaw method. To whole-cell extracts,5 µl of monoclonal anti-hnRNPC antibody 4F4, anti-La antibodyA1 (3), or the antiactin antibody (Amersham), 20 µl ofprotein A plus G agarose beads (Calbiochem), and 5 U of RNaseinhibitor were added, and the samples were incubated for 60min at room temperature. The beads were then washed extensivelywith RNA binding buffer supplemented with RNase inhibitor. RNAassociated with the antibody-antigen complexes was isolatedby repeated phenol-chloroform extraction and precipitation with2 M ammonium acetate and 3 volumes of cold ethanol. RNA wasthen analyzed by RT-PCR using XIAP-specific primers (5' oligonucleotide,5'-ATGACTTTTAACAGTTTTGAAGG; 3' oligonucleotide, 5'-GCTCGTGCCAGTGTTGATGCTG).

Northern blot analysis. Total RNA was isolated from transiently transfected cells byguanidine isothiocyanate-phenol-chloroform extraction with theTRIzol reagent (Gibco) and the protocol provided by the manufacturer.RNA was denatured in formamide and separated on 0.8% agarosegel. RNA was then transferred onto a nylon membrane (Biodyne)and hybridized sequentially with [³²P]dCTP (Amersham)-labeled,randomly primed (Amersham Rediprime) DNA probes derived fromthe coding regions of the chloramphenicol acetyltransferase(CAT) and ß-galactosidase (ß-Gal) genes.Blots were hybridized overnight in hybridization buffer (5xSSPE [1x SSPE is 0.18 M NaCl, 10 mM NaH₂PO₄, and 1 mM EDTA],10x Denhardt's solution, 100 µg of salmon sperm DNA/ml,50% formamide, 2% SDS) and then washed with 0.2x SSC (1x SSCis 0.15 mM NaCl plus 0.015 mM sodium citrate)-0.1% SDS at 50°C.Membranes were exposed to an X-ray film (Kodak) by using anintensifying screen (Amersham).

ß-Gal and CAT analysis. Transiently transfected cells were harvested 24 h posttransfectionin CAT enzyme-linked immunosorbent assay (ELISA) kit lysis buffer(Roche), and cell extracts were prepared by using the protocolprovided by the manufacturer. ß-Gal enzymatic activityin cell extracts was determined by the spectrophotometric assayusing ONPG (o-nitrophenyl-ß-D-galactopyranoside) (22),and the CAT levels were determined by using the CAT ELISA kit(Roche) and the protocol provided by the manufacturer.

RESULTS

Top

Results

The 5' UTR of XIAP mRNA is unusually long and contains a veryefficient IRES element that is responsive to cellular stress(13, 16). In an attempt to identify cellular proteins that specificallymodulate XIAP IRES activity we characterized a sequence-specificRNP complex that assembles on the XIAP IRES and whose levelparallels IRES activity (11). The XIAP IRES RNP complex consistsof at least four proteins of which we identified the 50-kDaspecies as the autoantigen La (11). The identities of the remainingproteins remained unknown although we have excluded two of theknown IRES-binding proteins, PTB and PCBP.

A number of different cellular proteins that are recruited tothe IRES elements of viral or cellular RNAs have been identified(reviewed in references 9 and 23). Among these, hnRNPC1 and-C2 were shown to bind the differentiation-activated IRES elementof platelet-derived growth factor (PDGF) (30). One of the XIAPIRES cross-linked proteins that we observed had an apparentmolecular mass (45 kDa) close to those of hnRNPC1 and -C2 (Fig.1A). We therefore examined whether the hnRNPC proteins are alsocomponents of the XIAP IRES RNP complex. The 162-nt IRES probewas mixed with the S10 cellular extracts, UV cross-linked, andimmunoprecipitated with the anti-hnRNPC antibody 4F4 (Fig. 1B).The XIAP mRNA 5' UTR segment that is located upstream of theIRES element was used as a negative control. As shown in Fig.1B, the hnRNPC band was clearly detectable following immunoprecipitationof XIAP IRES, but not the non-IRES RNA-cross-linked proteins,with the anti-hnRNPC antibody. The appearance of a higher-molecular-massband, approximately 75 kDa, was also noted, but the identityof this protein remains to be determined.

View larger version (31K):
[in this window]
[in a new window]
FIG. 1. hnRNPC1 and -C2 are components of the XIAP IRES RNP complex in vivo and in vitro. (A) S10 extracts from 293T cells were incubated with the XIAP IRES or control RNA probes, UV irradiated, and separated on SDS-PAGE gel as described in Materials and Methods. The positions of the molecular mass markers are indicated on the left. (B) S10 extracts were incubated with the XIAP IRES RNA probe, UV cross-linked, immunoprecipitated with the anti-hnRNPC antibody 4F4, and then separated on SDS-PAGE gel as described in Materials and Methods. + and -, UV cross-linking or the absence of UV cross-linking before immunoprecipitation, respectively. (C) hnRNPC is associated with XIAP RNA in vivo. 293T cells were transfected with plasmid pCI-XIAP or pCI-IRES.XIAP, and whole-cell extracts were prepared 24 h later as described in Materials and Methods. Following coimmunoprecipitation with the indicated antibodies (anti-hnRNPC, anti-La, antiactin) the XIAP RNA was detected by RT-PCR analysis. The positive (cDNA; lane 2) and negative (no template; lane 3) controls for RT-PCR are shown on the left. The cell lysates in lanes 6 and 7 were treated with RNase A prior to immunoprecipitation. The molecular weights of DNA marker bands (lanes 1 and 10) are indicated on the left. (D) Equal amounts of purified GST, GST-hnRNPC1, or GST-hnRNPC2 fusion proteins (100 ng of total protein per lane) were incubated with the XIAP IRES or Apaf-1 IRES RNA probe, UV-cross-linked, and then separated on SDS-PAGE gel as described in Materials and Methods. The identities of fusion proteins are indicated above the lanes; the positions of the molecular mass markers are indicated on the left.

We next wished to determine if the hnRNPC interaction with XIAPIRES also takes place in vivo by immunoprecipitating the XIAPmRNA with the anti-hnRNPC antibody from whole-cell extracts.The endogenous XIAP mRNA is not very abundant in 293T cells.We therefore first enriched XIAP mRNA levels by transfecting293T cells with a construct expressing only the XIAP mRNA codingregion (pCI-XIAP) or the plasmid expressing the XIAP mRNA codingregion with 1 kb of 5' UTR that contains the XIAP IRES element(pCI-IRES.XIAP). Twenty-four hours after transfection, whole-cellextracts were prepared and RNA associated with the hnRNPC wasimmunoprecipitated with monoclonal anti-hnRNPC antibody 4F4and analyzed by RT-PCR using XIAP mRNA-coding-region-specificprimers. As a control we used either an antiactin or antiautoantigenLa antibody since we have shown previously that XIAP IRES associateswith the autoantigen La in vivo (11). The results of the coimmunoprecipitationexperiments are summarized in Fig. 1C. The specific XIAP RT-PCRsignal was obtained only if the expression plasmid containedthe XIAP mRNA 5' UTR sequence (lanes 3 versus 4). Furthermore,XIAP RNA was not detected if the cell extracts were pretreatedwith RNase prior to immunoprecipitation (lanes 5 and 6) or ifwe used a nonspecific antibody for immunoprecipitation (antiactin;lane 8). These results indicate that the hnRNPC proteins associatewith the XIAP RNA in vivo and that this interaction is mediatedby the 5' UTR sequence of XIAP RNA.

There exist two isoforms of the hnRNPC, hnRNPC1 and hnRNPC2,which differ only by the insertion of 13 amino acids into thehnRNPC2 isoform. We wished to elucidate which of the hnRNPCisoforms interacts with the XIAP IRES sequence or whether bothdo. To this end, the XIAP IRES RNA probe was incubated withaffinity-purified GST, GST-hnRNPC1, or GST-hnRNPC2 proteins,cross-linked, and separated on SDS-10% PAGE gel (Fig. 1C). Althoughboth the GST-hnRNPC1 and GST-hnRNPC2 fusion proteins were foundto bind the XIAP IRES element alone, the binding of hnRNPC1and -C2 together was the most efficient. To further demonstratethe specificity of XIAP IRES-hnRNPC binding, we used, as anRNA probe, an unrelated IRES element that was recently discoveredin the 5' UTR of the mRNA for apoptotic protease activatingfactor 1 (Apaf-1) (5). In contrast to what was found for theXIAP IRES, the hnRNPC proteins did not exhibit any affinityfor Apaf-1 IRES (Fig. 1D), further confirming that the bindingof the hnRNPC proteins to the XIAP IRES is sequence specific.

We next reasoned that if the XIAP IRES element requires auxiliaryproteins for its activity (e.g., hnRNPC1 and -C2), this activitycould therefore vary among different cell lines, reflectingthe presence or abundance of protein factors required for IRESfunction. We therefore initiated experiments to determine ifthe XIAP IRES activity is cell line specific. Several cell lineswere transiently transfected with the bicistronic reporter plasmidthat contains XIAP IRES (pßgal/hUTR/CAT). While weobserved insignificant differences in XIAP IRES activity amongthree cell lines (293T, H520, H661), one cell line, SKOV3, showeda marked reduction (fivefold) in the XIAP IRES activity (Fig.2A; Table 1). To confirm that the observed changes were notdue to a cryptic promoter activity in the XIAP mRNA 5' UTR,we transfected the promoterless construct pCATbasic/hUTR (13)into all four cell lines but detected no CAT activity (datanot shown). Alternatively, the lack of XIAP IRES activity couldbe due to a splicing event in the SKOV3 cells. However, therewere no observed differences in the integrity of the bicistronicRNA between SKOV3 and H661 cells, excluding this possibility(Fig. 2B). In contrast, Western blot analysis of the four celllines revealed a correlation between the activity of XIAP IRESand the levels of hnRNPC1 and -C2, since only the SKOV3 cellline had substantially less hnRNPC1 and -C2 than the other threecell lines tested (Fig. 2A, top). We wished to determine ifthe reduced levels of hnRNPC1 and -C2 could be responsible forthe observed reduction in XIAP IRES activity. To this end, wecotransfected the SKOV3 cell line with the expression vectorsencoding either hnRNPC1 or hnRNPC2 cDNAs and the bicistronicreporter construct pßgal/hUTR/CAT, which harbors theXIAP IRES element. We reasoned that, if the reduced levels ofhnRNPC proteins in SKOV3 are responsible for the reduction inXIAP IRES translation, then the overexpression of hnRNPCs shouldincrease the activity of XIAP IRES in this cell line. Indeed,transient overexpression of hnRNPC1 or hnRNPC2 increased thetranslation of XIAP IRES about twofold (Fig. 2C, Table 1). Moreover,the cotransfection of hnRNPC1 and hnRNPC2 increased the translationof XIAP IRES about 3.5-fold, suggesting that both isoforms ofhnRNPC participate in the modulation of XIAP IRES activity invivo. This translational activation was dose dependent, as increasingthe amount of hnRNPC-expressing plasmid DNA resulted in an increaseof XIAP IRES translation (Fig. 2C). Significantly, transientoverexpression of hnRNPC1 and -C2 had no effect on the activityof Apaf-1 IRES. These tissue culture results thus corroboratedour biochemical evidence that hnRNPC1 and hnRNCP2 bind specificallyto the XIAP IRES element and modulate its activity.

View larger version (31K):
[in this window]
[in a new window]
FIG. 2. hnRNPC1 and -C2 enhance XIAP IRES translation in cultured cells. (A) 293T, H520, H661, and SKOV3 cells were transiently transfected with the pßgal/hUTR/CAT construct (13), and the relative IRES activity was determined as described in Materials and Methods. Bars, averages ± standard deviations (SD) of three independent transfections performed in triplicate (*, P < 0.05 by one-way analysis of variance [ANOVA]). The levels of endogenous hnRNPC1, hnRNPC2, and actin in the same cell lines were determined by Western blot analysis using the anti-hnRNPC 4F4 (for hnRNPC1 and -C2) and antiactin (for actin) antibodies (top). (B) The integrity of the ßgal/hUTR/CAT bicistronic RNA ( $~$ 5.5 kb) in SKOV3 and H661 cells was examined by Northern blot analysis using either CAT (left) or ß-Gal (right) probes. The positions of the molecular weight markers are indicated on the left. (C) SKOV3 cells were cotransfected with bicistronic plasmid pßgal/hUTR/CAT or pßgal/Apaf-1/CAT and 1 or 2 µg of pcDNA3-GFP (pGFP), pcDNA3-hnRNPC1, or pcDNA3-hnRNPC2 DNA, and the relative IRES activity was determined 24 h posttransfection. The activity of each IRES in cells cotransfected with pGFP was set as 100. Bars, average ± SD of three independent transfections performed in triplicate (*, P < 0.05 by one-way ANOVA, relative to pGFP-transfected cells). The levels of expression of FLAG-tagged overexpressed proteins were assessed by Western blot analysis using either an anti-hnRNPC (4F4) or anti-FLAG antibody (top).

View this table:
[in this window]
[in a new window]
TABLE 1. Overexpression of hnRNPC enhances XIAP IRES- but not cap-dependent translation in SKOV3 cells

It has been shown previously that hnRNPC proteins bind, withhigh affinity, RNA sequences that contain several uridine residues(7). More specifically, RNA sequence AGUAUUUUUGUGGA was identifiedthrough the SELEX procedure as having a high affinity for thehnRNPC proteins (32). Interestingly, there are several uridine-richmotifs in the XIAP IRES that could potentially mediate hnRNPCbinding (13). We therefore used UV cross-linking combined withsequence-specific competitors to map the binding site of hnRNPC1and -C2 on the XIAP IRES element. Out of seven different nonoverlappingcompetitors only one was able to block the binding of hnRNPC1and -C2 to the XIAP IRES (Fig. 3A). This competitor spannedthe sequence -114 to -135 of XIAP IRES (GUUAUUUUUAUGUCAUAAGUGGAUAA),which has a striking similarity to the SELEX-identified hnRNPCbinding site. Indeed, the deletion derivative of the XIAP IRESthat lacks this sequence [pßgal/5'(-102)/CAT] hadsignificantly reduced IRES activity in transfected 293T cells(Fig. 3B). Furthermore, translation of this construct couldno longer be enhanced in SKOV3 cells by the overexpression ofhnRNPC1 and -C2 (Fig. 3C), confirming that the sequence -114to -135 is the binding site of hnRNPC1 and -C2.

View larger version (18K):
[in this window]
[in a new window]
FIG. 3. Mapping of the hnRNPC binding site. (A) Schematic representation of the 162-nt portion of XIAP IRES. Arrows, positions of competitor oligonucleotides; gray box, polypyrimidine tract. Purified GST-hnRNPC1 and GST-hnRNPC2 fusion proteins were mixed and incubated with the XIAP IRES RNA probe in the presence of the indicated cold competitors (comp.; 100-fold excess), UV-cross-linked, and then separated on SDS-PAGE gel as described in Materials and Methods. (B) 293T cells were transfected with the indicated plasmids as described in Materials and Methods. The levels of ß-Gal and CAT were determined 24 h posttransfection. The relative IRES activity (CAT normalized with ß-Gal) from the pßgal/hUTR/CAT construct was set at 100%. Bars, averages ± standard deviations (SD) of three independent transfections performed in triplicate; *, P < 0.05 by one-way analysis of variance (ANOVA). CMV, cytomegalovirus; LR, linker region. (C) SKOV3 cells were cotransfected with bicistronic plasmid pßgal/5'(-162)/CAT or pßgal/5'(-102)/CAT and either 2 µg of pcDNA3-GFP (pGFP) or 2 µg of pcDNA3-hnRNPC1 and pcDNA3-hnRNPC2 DNA, and the relative IRES activity was determined 24 h posttransfection. The activity of each IRES in cells cotransfected with pcDNA3 was set as 100. Bars, averages ± SD of three independent transfections performed in triplicate; *, P < 0.05 by one-way ANOVA.

DISCUSSION

Top

Discussion

The translation of mRNA of the intrinsic inhibitor of apoptosisXIAP is mediated by a potent IRES element. This mode of translationappears to be essential for proper XIAP function during earlystages of apoptosis because it allows continuous expressionof XIAP when the majority of the cellular protein synthesisis compromised (13). We have postulated that IRES-mediated translationof selected cellular mRNAs could be selectively regulated toachieve a balance between the pro- and antiapoptotic signals,safeguarding the cellular homeostasis (15). Identification ofspecific proteins that can selectively bind to and modulatedistinct IRES elements is therefore an important step in theunderstanding of IRES-mediated translation of cellular mRNAs.

In the present paper we have shown that a 45-kDa protein interactswith the XIAP IRES RNA. Immunoprecipitation with a monoclonalantibody identified that this protein existed in two isoforms,hnRNPC1 and -C2. hnRNPC1 and -C2 are among the most abundantcellular proteins involved in the processing of pre-mRNA. Thetwo isoforms, hnRNPC1 and -C2, are produced by alternative splicingand differ only by the insertion of 13 amino acids into thehnRNPC2 isoform. hnRNPC1 is more abundant than hnRNPC2, withhnRNPC2 expressed at about one-third the level of hnRNPC1 (20).The hnRNPC1 and hnRNPC2 proteins can form a stable (C1)₃C2 heterotetramerwith high binding affinity for uridine-rich RNA sequences (32).Not unexpectedly, we found that both hnRNPC1 and hnRNPC2 proteinsbind the XIAP IRES element. This result is not surprising sinceit was shown previously that both hnRNPC1 and hnRNPC2 have affinityfor similar sequences (2). In our experiments, however, hnRNPC2bound XIAP IRES more efficiently than hnRNPC1, although more-detailedbiochemical analysis needs to be performed in order to determinethe exact binding constants for both proteins. Our results alsoindicate that hnRNPC1 and -C2 can bind directly to the XIAPIRES element without the aid of additional cellular proteins.Additionally, both hnRNPC1 and -C2 can bind their target RNAsequences independently in vitro, demonstrating that bindingis not necessarily dependent on the formation of the hnRNPC1/C2tetramer. However, note that the combined effect of hnRNPC1and -C2 was stronger both in vitro and in vivo. Using sequence-specificcompetitors we determined that the binding site for hnRNPC1and -C2 on the XIAP IRES is located in the -114 to -135 segmentof the 5' UTR. This sequence, GUUAUUUUUAUGUCAUAAGUGGAUAA, issimilar to the SELEX-identified hnRNPC1 and -C2 binding siteAGUAUUUUUGUGGA (32). Importantly, the deletion of this segmentboth reduced the basal level of XIAP IRES activity and abolishedthe ability of hnRNPC1 and -C2 to enhance XIAP IRES-mediatedtranslation in vivo. These data suggest that, while hnRNPC1and -C2 are not essential, they positively modulate translationmediated by the XIAP IRES element.

We have shown previously that the XIAP IRES RNP core bindingsequence spans the -34 to -62 region of XIAP mRNA 5' UTR (11).In this work we mapped the hnRNPC1 and -C2 binding site to amore upstream region, -114 to -135. The inspection of the predictedsecondary structure of the XIAP IRES (Fig. 4) indicates, however,that there exists a partial overlap between these two bindingsites that could explain the apparent discrepancy in the mappingresults. Additional biochemical information is needed, however,to fully understand the RNA-protein interactions and the proteinsthat participate in the assembly of XIAP IRES RNP complex.

View larger version (16K):
[in this window]
[in a new window]
FIG. 4. Proposed secondary structure of the XIAP IRES element. The secondary structure of the 300-nt XIAP 5' UTR sequence was predicted by using the mfold algorithm (version 3.1; http://bioinfo.math.rpi.edu/ $~$ mfold/rna/) (24, 40). The RNP core binding site (11) and the hnRNPC1 and -C2 binding site are bracketed, with the first and the last nucleotides of each binding site shown in gray circles. The numbering of the 5' UTR begins with the first nucleotide (G) 5' to the initiator AUG, designated -1 (13). For clarity, only sequence relevant to this work is shown.

The biochemical evidence that hnRNPC1 and -C2 are part of theXIAP IRES RNP complex was further supported by results for culturedcells. We identified one cell line, SKOV3, which exhibits reducedlevels of hnRNPC1 and -C2 proteins. Significantly, the activityof the XIAP IRES element was dramatically reduced in this cellline. Transient overexpression of the expression vector encodinghnRNPC1 and -C2 in SKOV3 cells substantially enhanced XIAP IRESactivity, demonstrating that the interaction between XIAP IRESand hnRNPC2 occurs in vivo.

The biochemical function of hnRNPC1 and -C2 proteins remainssomewhat controversial. hnRNPC1 and -C2 were implicated in severalsteps of RNA biogenesis, including splicing (4), RNA turnover(8), and polyadenylation (38). The high abundance of these proteinsin the cell also suggests that they may have a pleiotropic effecton unrelated RNA templates (37). Additionally, the hnRNPC1 and-C2 proteins were implicated in DNA metabolism since they canbind the telomerase holoenzyme, and this binding correlatedwith the ability of telomerase to access the telomere (6). Ithas been found that mice with targeted deletion of the hnRNPClocus exhibit an embryonically lethal phenotype consistent withthe critical role of hnRNPC1 and -C2 in other cellular functions(37). Surprisingly, however, embryonic stem cells derived fromhnRNPC-null mice were able to grow and differentiate in vitro.

Recently, hnRNPC1 and -C2 were also implicated in translation.It has been shown that hnRNPC1 and -C2 bind to an IRES elementof PDGF/c-sis in a differentiation-induced manner although thedirect involvement of hnRNPC1 and -C2 in translation of PDGFmRNA was not demonstrated (30). The hnRNPC1 and -C2 proteinswere also shown to be associated with the polyuridine-rich 5'UTR of p27 mRNA and the binding of hnRNPC1 and -C2 occurredin parallel with p27 mRNA translation (25). It is noteworthythat the 5'UTR of p27 mRNA was recently demonstrated to possessan IRES activity (26). We have shown here that hnRNPC1 and -C2bind to the IRES element of XIAP. More importantly, the cellularlevels of hnRNPC correlate with the activity of the XIAP IRESelement, suggesting that hnRNPC may function as an enhancerof XIAP translation. How could hnRNPC1 and -C2, which are consideredto be exclusively nuclear proteins, be involved in translation?A growing number of studies suggest that the hnRNPC1 and -C2proteins also function in the cytoplasm (see, e.g., references25, 27, 28, 30, 35, and 39). Furthermore, the XIAP IRES elementis not active in the T7/vaccinia virus system, where the RNAis synthesized in the cytoplasm and does not enter the nucleus,suggesting that the XIAP IRES requires "nuclear experience"(G. Belsham, personal communication). We predict that this nuclearevent could be provided by nuclear RNA binding proteins, suchas hnRNPC1 and -C2. These proteins could interact with the XIAPIRES RNA in the nucleus and then be transported with the XIAPRNA to the cytoplasm, where they enhance XIAP mRNA translation.Alternatively, the binding of hnRNPC1 and -C2 to the XIAP IRESin the nucleus could impact the conformational state of theIRES element, which is essential for the binding of one or moreauxiliary proteins, which are then involved in the translationof XIAP. The requirement for the nuclear event is not uniqueto the XIAP IRES. Most cellular IRES elements do not function,or function very inefficiently, in cell-free translation systemsor in RNA transfection assays, suggesting that they may requirea nuclear event (18, 19, 33). Although the nature of this eventis yet to be understood, it is plausible that the nuclear experienceof at least some IRES elements may be mediated by the hnRNPC1and -C2 proteins.

Many cellular proteins are specifically cleaved during apoptosis.Recently, identification of proteins that are modified duringFas-induced apoptosis in Jurkat cells revealed that a largenumber of the apoptosis-modified proteins are, in fact, RNA-bindingproteins (34). More specifically, hnRNPC1 and hnRNPC2 were shownto be cleaved by caspases in cells induced to undergo apoptosisby a variety of triggers (1, 36). The advantage of regulatingapoptosis by modulating the RNA metabolism is not clear. Sincethe regulation of apoptosis requires rapid responses, it couldbe achieved by the regulation of RNA metabolism (e.g., splicing,turnover, and translation) more efficiently than by regulationof de novo mRNA synthesis (34). XIAP is a potent inhibitor ofapoptosis by virtue of blocking caspase activation. It is temptingto speculate that the proteolytic cleavage of hnRNPC1 and -C2at the onset of apoptosis is targeted to attenuate the synthesisof XIAP. This notion, and the effect of cleavage of hnRNPC1and -C2 on XIAP expression, however, await further experiments.

ACKNOWLEDGMENTS

We thank the members of our laboratory for useful discussion.We are grateful to Gideon Dreyfuss for the generous gift ofanti-hnRNPC monoclonal antibody 4F4 and to Adi Kimchi for thegift of FLAG epitope containing plasmid pECE.

This work was supported by grants from the Canadian Institutesof Health Research (CIHR), Medical Research Council of Canada(MRC), the Canadian Networks of Centers of Excellence (NCE),and the Howard Hughes Medical Institute (HHMI). R.G.K. is arecipient of an MRC Senior Scientist Award, a Fellow of theRoyal Society of Canada, and an HHMI International ResearchScholar. M.H. is a CIHR New Investigator.

FOOTNOTES

* Corresponding author. Mailing address: Molecular Genetics Laboratory, Children's Hospital of Eastern Ontario Research Institute, Room R310, 401 Smyth Rd., Ottawa, Ontario K1H 8L1, Canada. Phone: (613) 738-3207. Fax: (613) 738-4833. E-mail: martin{at}mgcheo.med.uottawa.ca.

REFERENCES

Top