![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Molecular and Cellular Biology, June 2003, p. 3990-3999, Vol. 23, No. 11
0270-7306/03/$08.00+0 DOI: 10.1128/MCB.23.11.3990-3999.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Division of Genetics and Development, Department of Molecular and Cell Biology, University of California, Berkeley, California 94720,1 Department of Cell and Developmental Biology, Weill Medical College of Cornell University, New York, New York 100212
Received 16 September 2002/ Returned for modification 3 January 2003/ Accepted 21 February 2003
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1 kb 5' of the core promoter (32, 33, 37). It contains overlapping binding sites for sequence-specific transcriptional activators and repressors, including the Bicoid activator and the Krüppel repressor. The Krüppel repressor is not thought to interfere with the binding of the RNA polymerase II transcription complex at the core promoter due to the large distance separating the eve enhancer and core promoter. Rather, it was proposed that Krüppel mediates repression by blocking the binding of the Bicoid activator to overlapping sites within the enhancer. Although the organization of Bicoid and Krüppel binding sites within the eve stripe 2 enhancer strongly suggested repression by competition, subsequent studies demonstrated that the repressor binding sites need not overlap the activator sites (6, 8). Krüppel can inhibit adjacent activators even when the Krüppel binding sites are positioned 100 bp away from the activator sites. Presumably, the Krüppel repressor does not impede the binding of activators over this distance. Instead, it was suggested that Krüppel mediates repression via quenching, whereby activators and repressors bind to linked sites and the repressors somehow inhibit the function of the activators.
Repression by quenching appears to depend on a corepressor protein called CtBP, which was originally identified as a protein that binds to the carboxyl terminus of the adenovirus E1A protein in cultured cells (2, 31). CtBP-E1A interactions attenuate E1A-mediated transcriptional activation and tumorigenesis (36). CtBP binds to a conserved peptide motif in the E1A protein: PLDLS (2, 31). A variant of this motif is conserved in the Krüppel repressor (PxDLSxH) (20, 21). Alanine substitutions in this motif severely disrupt the repression activity of an otherwise normal Krüppel protein in transgenic Drosophila embryos (21, 22). The Drosophila CtBP (dCtBP) protein is maternally expressed and uniformly distributed throughout the cytoplasm of the unfertilized egg and early embryo (20, 23). Embryos derived from mutant eggs containing reduced levels of dCtBP exhibit a variety of patterning defects due to a reduction in the activities of three short-range sequence-specific transcriptional repressors in the early embryo: Krüppel, Knirps, and Snail (21). All three zinc finger repressors contain at least one copy of the conserved dCtBP interaction motif, PxDLSxBasic. These motifs mediate the binding of dCtBP in vitro and are essential for transcriptional repression in vivo.
Recent studies suggest that all three repressors retain the ability to repress a subset of target genes in the absence of dCtBP. Krüppel continues to repress the hairy stripe 7 enhancer (16), Knirps represses the eve stripe 3 enhancer (13), and there is genetic evidence that Snail represses at least one neurogenic gene in the absence of dCtBP (J. Cowden and M. Levine, unpublished results). These findings suggest that Krüppel, Knirps, and Snail may interact with additional, unknown corepressor proteins. Alternatively, it is conceivable that some of these target enhancers may be repressed by competition, whereby activator and repressor sites overlap and the DNA-binding domains of the repressors are sufficient to exclude activators from DNA. To address these issues, we have examined the dCtBP-independent repression activities of Krüppel.
We investigate the role of dCtBP for each of the three modes of repression: quenching, direct repression, and competition. First, an in vivo repression assay demonstrates that only the dCtBP interaction motif within the carboxyl-terminal Krüppel repression domain is required for quenching and direct repression. Second, it is shown that the quenching activity of Krüppel and the direct-repression activities of Krüppel and Knirps are abolished in dCtBP mutant embryos. Third, an artificial enhancer that contains a 14-bp sequence with optimal Bicoid, Dorsal, and Krüppel binding sites was created. These recognition sequences directly overlap one another so that the binding of Krüppel interferes with the binding of the Bicoid and Dorsal activators. The synthetic enhancer thereby permits the visualization of repression by competition in transgenic embryos. No repression activity was observed in mutant embryos that lack Krüppel. However, Krüppel continues to repress the synthetic enhancer in dCtBP mutant embryos. These studies demonstrate that Krüppel can mediate repression by simple competition without the dCtBP corepressor. We conclude that competition and quenching plus direct repression represent two distinct mechanisms of short-range transcriptional repression.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-32P]ATP and T4 polynucleotide kinase, and an amount of the probe corresponding to approximately 50,000 cpm was incubated for 15 min at room temperature after the addition of each protein in 10 mM Tris (pH 7.9)-50 mM NaCl-1 mM EDTA-10 µM ZnSO4-8% glycerol-20 mg of bovine serum albumin. Protein-DNA complexes were resolved by electrophoresis through an 8% acrylamide-bisacrylamide (29:1) gel in 0.5x Tris-boric acid-EDTA (40 mM Tris, 45 mM boric acid, 1 mM EDTA) at 200 V for 1 h. The gels were dried and autoradiographed with an intensifying screen.
Plasmid constructions.
Gal4-Krüppel fusion genes Gal4-Kr 402-502 and Gal4-Kr 402-502
PED were placed under the control of either the twist or Krüppel 2.5 enhancer. The details of these fusion genes are described in reference 21.
The Gal4-Kr 62-92 fusion gene was constructed as follows. The putative N-terminal repression domain (amino acids [aa] 62 to 92) of Krüppel (16) was amplified by PCR from cDNA using PCR primers containing KpnlI and XbaI sites, digested, and cloned into KpnlI and XbaI sites of either a TWIG vector, which contains the twist enhancer and Gal4 DNA-binding domain, or a KREG vector, which contains the Krüppel enhancer and the Gal4 DNA-binding domain. The following primers were used: 5'-TAAGGTACCGCCTCAGCTTTTGGAATGCTA and 5'-ATTTCTAGACTACAATGTGCTCATGGGCAGTTGG.
All of the transgenic lacZ reporter genes except NEE-5xUAS-lacZ (see Fig. 1 and 2) were described previously (21). The NEE-5xUAS-lacZ reporter gene containing five copies of the upstream activation sequence (UAS) was constructed as follows. A CaSpeR-AUG-ßgal transformation vector (38) containing the eve basal promoter, starting at -42 bp and continuing through codon 22 fused in frame with lacZ (33), was modified by adding multiple restriction enzyme sites (BglII, AscI, PacI, NotI, PmeI, and EcoRI sites; GAATTAGATCTATGGCGCGCCTCTTAATTAACTGCGGCCGCTAGTTTAAACTAGCATGCTTGAATTC) at the original unique EcoRI site (this new version is called the Casp-GANE vector). A 0.7-kb BamHI NEE region lacking a Snail site fragment was inserted into the unique BglII site of the Casp-GANE vector. A NotI-BglII fragment containing five copies of the UAS and the hsp70 promoter region of pUAST was created by PCR amplification using primers 5'-TAAGCGGCCGCTTGCATGCCTGCAGGTCGG and 5'-TAGAGACATCCATCAAACAGG (a NotI site is underlined) and subsequent digestion with NotI and BglII. The fragment was cloned into NotI and BamHI sites of the Casp-GANE vector containing the NEE enhancer by removing the eve promoter.
|
|
The following oligonucleotides were used to create a synthetic enhancer which contains optimal Bicoid, Dorsal, and Krüppel binding sites: 5'-gatctGGGATTAACCCGTTgtacGGGATTAACCCGTTg-3' and 5'-gatccAACGGGTTAATCCCgtacAACGGGTTAATCCCa-3'. Lowercase letters represent the linker or spacer sequences. These were annealed, kinased, ligated, and digested by both BamHI and BglII. Three or seven (corresponding to 6 or 14 copies of the binding sites) head-to-tail tandem repeats of the oligonucleotides were inserted within the BamHI-BglII sites of modified pBluescript II KS(+) plasmid pBlueG, which contains a unique BglII site in place of SmaI. An additional EcoRI site was then created in pBlueG between the BamHI and XbaI sites. Six or 14 copies of the binding sites were isolated as EcoRI fragments and were inserted into the unique EcoRI site of the CaSpeR-AUG-ßgal transformation vector containing the eve basal promoter, starting at -42 bp and continuing through codon 22 fused in frame with lacZ.
For transfection assays, the six head-to-tail tandem copies of overlapping Bicoid, Dorsal, and Krüppel sites plus the adjacent eve promoter were amplified by PCR from the CaSpeR-AUG-ßgal vector, which is described above, with the appropriate primers containing BglII and NcoI sites and then inserted into pGL3-Basic. To construct the Krüppel DNA binding domain, expression vectors pPac Kr and pPac Kr9, which both correspond to aa 217 to 401, were amplified by PCR from plasmids previously described (32). The primers contained BamHI sites, and the upstream and downstream primers introduced start and stop codons, respectively. The products were cut with BamHI and ligated into the pPac vectors pPac Kr DBD and pPac Kr9 DBD, respectively. pPac Dorsal was a gift from Stephen Small.
In situ hybridization assays and transgenic embryos. Embryos were collected from wild-type (yw) and mutant adults carrying different lacZ transgenes and then fixed and hybridized with digoxigenin-labeled antisense lacZ RNA probes as described previously (12). Transgenic strains were obtained by injecting yw embryos with various P element transformation vectors as described previously (27).
Germ line mosaics and fly stocks. dCtBP germ line clones were generated as described previously (21) by the FLP-DFS technique (3). Briefly, hsFLP; FRT82B ovoD1/TM3 Sb males were mated with FRT82B P1590/TM3 Sb females. Embryos were collected for 24 h, aged another 48 h, heat shocked for 3 successive days at 37°C for 3 h, and then grown to adults. Virgin females lacking the Sb marker were selected and mated with yw males carrying lacZ reporter genes. Embryos were collected from this final mating and then fixed and hybridized with digoxigenin-labeled lacZ RNA probes.
The mutant alleles used in this study were bicoid (bcdE1), Krüppel (Kr1), and gastrulation defective (gd7). For the maternal mutation, males carrying the transgene were mated with virgin females homozygous for bcd or gd. For the Krüppel mutant, male flies containing both a single copy of the Kr1 allele and a single copy of the transgene were crossed to virgin females heterozygous for Kr1.
The following transgenic reporter strains were used in these studies: 2UG3-1 and 2UG3-2 (st2.UAS-st3-lacZ; see Fig. 2A to D) (21), G18.2 and G18.3 (NEE.UAS-lacZ; see Fig. 2E to H) (21), and RUCPT-3 and RUCPT-5 (NEE.UAS-twi-lacZ; see Fig. 2I to L) (21). The following Gal4-Kr driver lines were used in these studies: YN20-2, -3, and -4 (twi-Gal4-Kr 402-502; see Fig. 2B) (21); YN18-2, -3, and -4 (Kr-Gal4-Kr 402-502; see Fig. 2F, J, and N) (21); YN21-1, -2, and -3 (twi-Gal4-Kr 402-502PED; see Fig. 2C) (21); and YN19-1, -2, and -3 (Kr-Gal4-Kr 402-502PED; see Fig. 2G, K, and O). The laboratory fly stock G5.5 was used for the modified 700-bp NEE enhancer containing two synthetic Krüppel binding sites (see Fig. 3A to C) (8). G27.2 was used for the twist-NEE fusion gene containing a single Krüppel binding site proximal to the promoter (see Fig. 3D to F) (8). Strain A58 was used for the NEE-twist enhancer containing two Knirps binding sites proximal to the promoter (see Fig. 3G to I) (1).
|
|
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
A Gal4-Krüppel fusion protein containing aa 402 to 502 (Fig. 1H) created gaps in the staining patterns directed by st2.UAS-st3-lacZ, NEE.UAS-lacZ, and NEE.UAS-twi-lacZ (Fig. 2B, F, and J). For the st2.UAS-st3-lacZ and NEE.UAS-twi-lacZ reporter genes, repression was observed only for the staining pattern produced by the enhancer containing UAS binding sites. For example, the binding of the Gal4-Krüppel fusion protein to the stripe 2 enhancer did not alter expression from the neighboring stripe 3 enhancer (Fig. 2B) (34). Similarly, the binding of the fusion protein to the rhomboid NEE enhancer did not alter expression from the twist enhancer (Fig. 2J). Substitutions in three of the amino acid residues within the dCtBP interaction motif (PEDLSMH to AAALSMH) (Fig. 1I) eliminated the repression activity of an otherwise normal Gal4-Krüppel fusion protein (Fig. 2C, G, and K).
There is a second potential dCtBP interaction motif, located between aa 414 and 420 (PLDLSED), that weakly binds dCtBP in vitro (data not shown; Fig. 1G). However, this second motif was not sufficient to support discernible repression activity in vivo (Fig. 2C, G, and K). These results suggest that most or all of the repression activity of the Gal4-Krüppel 402-502 fusion protein resides within the major dCtBP interaction motif between amino acid residues 464 and 470. Moreover, repression was not observed for a Gal4-Krüppel fusion protein that contains the N-terminal repression domain (aa 62 to 92). These results suggest that the C-terminal dCtBP motif mediates most or all of the quenching activity in the early embryo.
The proximal UAS site within the NEE.UAS-lacZ reporter gene (Fig. 1C and 2E) is located 120 bp 5' of the core promoter, slightly beyond the range of Krüppel-mediated repression (8, 21). In contrast, the UAS sites map within 50 bp of critical Dorsal sites within the NEE. Thus, repression of the reporter gene is most likely due to quenching rather than the direct repression of the core promoter. Another lacZ reporter was created to investigate this issue, NEE-5xUAS-lacZ (Fig. 1E and 2M). The most distal UAS site is located 250 bp 5' of the most proximal Dorsal binding site within the modified 700-bp NEE enhancer, while the most proximal UAS site is located just 57 bp 5' of the transcription start site of the hsp70 promoter. The Gal4-Krüppel 402-502 fusion protein attenuated lacZ expression (compare Fig. 2N with O and P). This direct repression was not obtained with the mutagenized fusion protein lacking the dCtBP interaction motif or with a fusion protein containing the N-terminal repression domain (Fig. 2O and P). These results suggest that the C-terminal dCtBP interaction motif is essential for both quenching and direct repression.
dCtBP is essential for both quenching and direct repression. Previous studies suggest that Krüppel mediates quenching by recruiting dCtBP to distal enhancers, such as the eve stripe 2 enhancer (21). An NEE-lacZ reporter gene that contains two synthetic Krüppel recognition sequences located 50 bp 5' of the most distal Dorsal binding site and 50 bp 3' of the most proximal site was created (Fig. 3A) (8, 21). This enhancer lacks the native Snail repressor sites and therefore directs lacZ expression in both lateral and ventral regions of early embryos. lacZ staining was diminished in central regions due to the localized expression of the Krüppel repressor (Fig. 3B). This gap in the pattern was eliminated in Kr1/Kr1 mutant embryos (data not shown; see below). Krüppel also failed to repress the reporter gene in mutant embryos derived from dCtBP germ line clones (Fig. 3C). These results indicate that dCtBP+ gene activity is required for the quenching activity of the Krüppel repressor.
Subsequent experiments were done to determine whether dCtBP is required for the direct-repression activity of Krüppel and another short-range repressor, Knirps. lacZ transgenes with either Krüppel or Knirps binding sites located near the core promoter were examined (Fig. 3D and G). Both transgenes contain two tandem copies of the 250-bp twist proximal enhancer placed either upstream or downstream of rhomboid lateral stripe enhancers (NEE). In wild-type embryos, the enhancers direct additive patterns of expression in the lateral neurogenic ectoderm and ventral mesoderm (1, 8). A single Krüppel binding site located 75 bp 5' of the transcription start site (Fig. 3D) was sufficient to create a central gap in both staining patterns (Fig. 3E). Staining directed by the tandem twist enhancers was nearly eliminated, whereas the lateral stripe produced by the rhomboid NEE was diminished (Fig. 3E). Repression of the twist pattern is almost certainly due to direct repression, since the solo Krüppel site mapped more than 800 bp from the nearest Dorsal activator site in the twist enhancer (Fig. 3D). Krüppel-mediated repression was lost when the transgene was introduced into embryos obtained from dCtBP germ line clones (Fig. 3F). There was no longer a central gap in the staining pattern. Moreover, there was a fusion of the expression patterns directed by the twist and NEE enhancers due to a loss in the activity of the Snail repressor. Normally, Snail binds to the NEE enhancer and represses expression in the ventral mesoderm, thereby restricting the staining pattern to lateral stripes in the neurogenic ectoderm (Fig. 3D and G). The broad uniform staining pattern obtained in dCtBP mutants suggests that the dCtBP corepressor is required for the direct repression of the core promoter.
Similar results were obtained with the Knirps repressor. In this case, two tandem Knirps binding sites were placed 55 bp 5' of the transcription start site (Fig. 3G). In wild-type embryos, there was a clean gap in both the NEE-mediated lateral stripes and the twist-mediated staining pattern in the ventral mesoderm (Fig. 3H). This gap coincided with the site of Knirps expression in the presumptive abdomen. As seen for Krüppel, the gap in the staining patterns disappeared in dCtBP mutant embryos (Fig. 3I). These results suggest that dCtBP is required for the direct repression activities of both Krüppel and Knirps.
Competitive binding of the Krüppel repressor and Dorsal activator. The preceding experiments suggest that dCtBP is required for both quenching and the direct repression of the core promoter. A synthetic lacZ reporter gene was prepared to determine whether Krüppel can mediate repression by competition and, if so, whether dCtBP is required for this repression. A 14-bp oligonucleotide that contains overlapping Dorsal and Krüppel binding sites was synthesized (Fig. 4A). Each subunit of the Dorsal homodimer binds to an inverted half-site: GGG...CCC (10). Krüppel binds DNA as a monomer, and the core recognition sequence includes the CCC Dorsal half-site. This short sequence also contains an optimal Bicoid binding site (GGATTA) (see, e.g., reference 33). This motif is located between the two half-sites of the Dorsal recognition sequence and overlaps the Krüppel consensus sequence.
Gel shift assays were done to determine whether Dorsal and Krüppel bind the synthetic 14-bp sequence in a mutually exclusive manner (Fig. 4B and C). A 30-bp fragment that contains the 14-bp sequence along with 8 bp of flanking sequence at each end was synthesized. In the first set of experiments, a full-length Krüppel protein produced in E. coli was mixed with the 30-bp fragment and fractionated on an agarose gel (Fig. 4B, lane 1). A shifted Krüppel-DNA complex was observed. The addition of increasing amounts of the Dorsal DNA-binding domain (Dl DBD; aa 1 to 403) resulted in the gradual loss of this complex (Fig. 4B, lanes 2 to 6). A new complex that is identical in size to those obtained with the Dorsal protein alone was observed (Fig. 4B, lanes 7 to 11). These results suggest that high concentrations of the Dorsal DNA-binding domain can displace Krüppel.
Similar results were obtained in reciprocal DNA-binding assays (Fig. 4C). In this case, the shifted Dorsal-DNA complex was formed in the absence of Krüppel (Fig. 4C, lane 12). The addition of increasing amounts of the Krüppel protein resulted in the gradual loss of the Dorsal-DNA complex (Fig. 4C, lanes 13 to 17). A new complex was obtained that has the same size as the one observed with increasing amounts of Krüppel in the absence of the Dorsal protein (Fig. 4C, lanes 18 to 22). These results suggest that increasing amounts of Krüppel can displace Dorsal-DNA complexes. Thus, the gel shift assays indicate mutually exclusive binding of Dorsal and Krüppel to the overlapping binding sites contained within the 14-bp fragment.
Transient-transfection assays were used to determine whether the Krüppel DNA-binding domain is sufficient to mediate transcriptional repression. Six tandem copies of the synthetic oligonucleotide used in the preceding DNA-binding assays were attached to an eve-luciferase reporter gene containing the minimal eve promoter. This reporter gene was introduced into mbn-2 cultured cells (a Drosophila blood cell line) along with various expression vectors containing Dorsal or Krüppel coding sequences (Fig. 4D). An expression vector containing the full-length Dorsal coding sequence (Dl FL) produced a 6x induction in luciferase activity (Fig. 4D, compare lane 2 with lane 1). However, an expression vector containing the Krüppel DNA-binding domain (Kr DBD; aa 217 to 401) reduced luciferase activity to background levels (Fig. 4D, lane 3). This reduction in reporter gene expression was not obtained with a Krüppel expression vector that contains a single amino acid substitution in the zinc finger DNA-binding domain (Kr9 DBD; Fig. 4D, lane 4). These results suggest that Krüppel can repress the synthetic enhancer by simply binding DNA and excluding the Dorsal activator. Repression does not depend on Krüppel protein sequences that map outside the DNA-binding domain. Subsequent experiments were done to determine whether Krüppel can mediate repression by competition in transgenic embryos.
dCtBP is dispensable for the competition activity of Krüppel. Either 6 or 14 tandem copies of the 14-bp synthetic enhancer sequence were attached to a lacZ reporter gene containing the minimal, 42-bp eve promoter region (Fig. 5A). Similar results were obtained with both fusion genes, and most of the following results were obtained with individual strains carrying the transgene with six copies attached. The transgene exhibits a combinatorial pattern of lacZ staining in wild-type (yw) embryos (Fig. 5B to D). Staining was first detected in the anterior 40% of 120-min embryos, presumably in response to the broad Bicoid activator gradient (Fig. 5B) and was also detected in both anterior regions and along the entire length of the ventral mesoderm (Fig. 5B). Mesoderm expression was first seen at the time when the maternal Dorsal protein was released from the cytoplasm and entered nuclei (see, e.g., reference 10). During cellularization, staining was lost in central regions, presumably due to the onset of Krüppel expression (Fig. 5C). In addition, there was a refinement in the anterior staining pattern, so that it became restricted to the anterior one-fourth of the embryo and exhibited a reasonably sharp posterior border. This staining pattern persisted during gastrulation and germ band elongation (Fig. 5D).
|
One of the central goals of this study was to determine whether Krüppel requires dCtBP when it mediates repression by competition. This issue was investigated by crossing the transgene into mutant embryos derived from germ line clones produced in dCtBP/+ females (Fig. 5H). Krüppel continued to induce a central gap of repression in these mutants (Fig. 5H). In fact, the repression obtained in dCtBP mutants was comparable to that observed in wild-type embryos (Fig. 5H versus C). These results provide a clear example of Krüppel-mediated repression in the absence of the dCtBP corepressor. In contrast, Krüppel failed to repress transcription in dCtBP mutants when Krüppel and Dorsal sites did not overlap (Fig. 3).
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
An implication of this study is that the residual activity of the Krüppel repressor observed in dCtBP mutants might be due to repression by competition. For example, Krüppel can repress the hairy stripe 7 enhancer when misexpressed throughout early embryos using the heat-inducible hsp70 promoter (16). This repression is retained in dCtBP mutants. Moreover, a mutant form of Krüppel that lacks the dCtBP interaction motif can repress hairy stripe 7 expression (16). hairy stripe 7 is activated, at least in part, by Caudal and repressed by Krüppel (15). Interestingly, five Krüppel binding sites directly overlap Caudal activator sites within the hairy stripe 7 enhancer. Similar arguments apply to the Knirps repressor, which helps establish the posterior border of eve stripe 3 (35). The stripe 3 pattern expands in kni-/kni- mutant embryos but is essentially unchanged in dCtBP mutants (13). Knirps repressor sites might overlap critical activator sites, such as binding sites for D-Stat (40) or an unknown activator(s) within the stripe 3 enhancer. Previous studies suggest that Brinker can also function independently of corepressors when bound to sites that directly overlap critical Smad activator sites within cis regulatory regions of Dpp target genes (14, 29, 30). Direct evidence for simple competition was obtained in transient-transfection assays. The Krüppel DNA-binding domain is sufficient to inhibit activation of the synthetic enhancer by Dorsal in cultured mbn-2 cells (Fig. 4D).
The results reported in this study exclude another possible explanation for the residual activity of the Krüppel and Knirps repressors in dCtBP mutants: direct repression of the core promoter. In principle, direct repression could involve distinct corepressor proteins (Fig. 6). If so, then target genes that contain promoter-proximal Krüppel and Knirps binding sites might be repressed in dCtBP mutants. However, the lacZ fusion genes containing either a single Krüppel site or two tandem Knirps sites located near the transcription start site are no longer repressed in dCtBP mutants. Thus, we favor the possibility that the residual Krüppel and Knirps repression activities depend on competition between overlapping activator and repressor binding sites within selected target enhancers.
The demonstration that both quenching and direct repression require dCtBP raises the possibility that these two seemingly distinct forms of repression employ similar mechanisms. At least three types of models come to mind. First, dCtBP could disrupt physical interactions between upstream activators and the RNA polymerase II transcription machinery/mediator complex at the core promoter (18, 39). Perhaps dCtBP masks or modifies the activation domains of upstream activators. However, this model can account for quenching but not direct repression. A second type of model involves local chromatin modification. dCtBP contains a well-conserved dehydrogenase catalytic center and binds NADH (41). Perhaps dCtBP modifies proteins such as histones and helps condense DNA within the limits of a nucleosome. In Saccharomyces cerevisiae, the Rpd3 histone deacetylase (HDAC) causes histone deacetylation over a distance of just two nucleosomes (28). A third model is that dCtBP "poisons" the RNA polymerase II transcription machinery and impedes its binding, assembly, or function at the core promoter. This poisoning can be accomplished by placing dCtBP-dependent repressors near the core promoter or by looping distal enhancers to the promoter. According to the latter model, the linkage requirement seen for short-range repressors (they must bind within 100 bp of adjacent activators) might reflect a reliance of the repressors on linked activators in order to loop to the core promoter.
|
ACKNOWLEDGMENTS |
|---|
Y.N. was supported by the Uehara Memorial Foundation. This work was funded by an NIH grant (GM 34431).
|
FOOTNOTES |
|---|
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Boyd, J. M., T. Subramanian, U. Schaeper, M. La Regina, S. Bayley, and G. Chinnadurai. 1993. A region in the C-terminus of adenovirus 2/5 E1a protein is required for association with a cellular phosphoprotein and important for the negative modulation of T24-ras mediated transformation, tumorigenesis and metastasis. EMBO J. 12:469-478.[Medline]
3. Chou, T. B., and N. Perrimon. 1996. The autosomal FLP-DFS technique for generating germline mosaics in Drosophila melanogaster. Genetics 144:1673-1679.[Abstract]
4. Gateff, E., L. Gissmann, R. Shrestha, N. Plus, H. Pfister, J. Schroeder, and H. Zur Hausen. 1980. Characterization of two tumorous blood cell lines of Drosophila melanogaster and the viruses they contain, p. 517-533. In E. Kurstak, K. Maramarosch, and A. Dubendorfer (ed.), Invertebrate systems in vitro. Elsevier/North-Holland Biomedical Press, Amsterdam, The Netherlands.
5. Gaul, U., and H. Jackle. 1989. Analysis of maternal effect mutant combinations elucidates regulation and function of the overlap of hunchback and Kruppel gene expression in the Drosophila blastoderm embryo. Development 107:651-662.[Abstract]
6. Gray, S., P. Szymanski, and M. Levine. 1994. Short-range repression permits multiple enhancers to function autonomously within a complex promoter. Genes Dev. 8:1829-1838.
7. Gray, S., H. Cai, S. Barolo, and M. Levine. 1995. Transcriptional repression in the Drosophila embryo. Phil. Trans. R. Soc. Lond. B Biol. Sci. 349:257-262.[Medline]
8. Gray, S., and M. Levine. 1996. Short-range transcriptional repressors mediate both quenching and direct repression within complex loci in Drosophila. Genes Dev. 10:700-710.
9. Gray, S., and M. Levine. 1996. Transcriptional repression in development. Curr. Opin. Cell Biol. 8:358-364.[CrossRef][Medline]
10. Ip, Y. T., R. Kraut, M. Levine, and C. A. Rushlow. 1991. The dorsal morphogen is a sequence-specific DNA-binding protein that interacts with a long-range repression element in Drosophila. Cell 64:439-446.[CrossRef][Medline]
11. Ip, Y. T., R. E. Park, D. Kosman, E. Bier, and M. Levine. 1992. The dorsal gradient morphogen regulates stripes of rhomboid expression in the presumptive neuroectoderm of the Drosophila embryo. Genes Dev. 6:1728-1739.
12. Jiang, J., D. Kosman, Y. T. Ip, and M. Levine. 1991. The dorsal morphogen gradient regulates the mesoderm determinant twist in early Drosophila embryos. Genes Dev. 5:1881-1891.
13. Keller, S. A., Y. Mao, P. Struffi, C. Margulies, C. E. Yurk, A. R. Anderson, R. L. Amey, S. Moore, J. M. Ebels, K. Foley, M. Corado, and D. N. Arnosti. 2000. dCtBP-dependent and -independent repression activities of the Drosophila Knirps protein. Mol. Cell. Biol. 20:7247-7258.
14. Kirkpatrick, H., K. Johnson, and A. Laughon. 2001. Repression of dpp targets by binding of brinker to Smad sites. J. Biol. Chem. 276:18216-18222.
15. La Rosee, A., T. Häder, H. Taubert, R. Rivera-Pomar, and H. Jäckle. 1997. Mechanism and Bicoid-dependent control of hairy stripe 7 expression in the posterior region of the Drosophila embryo. EMBO J. 16:4403-4411.[CrossRef][Medline]
16. La Rosee-Borggreve, A., T. Häder, D. Wainwright, F. Sauer, and H. Jäckle. 1999. hairy stripe 7 element mediates activation and repression in response to different domains and levels of Krüppel in the Drosophila embryo. Mech. Dev. 89:133-140.[CrossRef][Medline]
17. Licht, J. D., W. Hanna-Rose, J. C. Reddy, M. A. English, M. Ro, M. Grossel, R. Shaknovich, and U. Hansen. 1994. Mapping and mutagenesis of the amino-terminal transcriptional repression domain of the Drosophila Krüppel protein. Mol. Cell. Biol. 14:4057-4066.
18. Malik, S., and R. G. Roeder. 2000. Transcriptional regulation through Mediator-like coactivators in yeast and metazoan cells. Trends Biochem. Sci. 25:277-283.[CrossRef][Medline]
19. Mannervik, M., Y. Nibu, H. Zhang, and M. Levine. 1999. Transcriptional coregulators in development. Science 284:606-609.
20. Nibu, Y., H. Zhang, and M. Levine. 1998. Interaction of short-range repressors with Drosophila CtBP in the embryo. Science 280:101-104.
21. Nibu, Y., H. Zhang, E. Bajor, S. Barolo, S. Small, and M. Levine. 1998. dCtBP mediates transcriptional repression by Knirps, Krüppel, and Snail in the Drosophila embryo. EMBO J. 17:7009-7020.[CrossRef][Medline]
22. Nibu, Y., H. Zhang, and M. Levine. 2001. Local action of long-range repressors in the Drosophila embryo. EMBO J. 20:2246-2253.[CrossRef][Medline]
23. Poortinga, G., M. Watanabe, and S. M. Parkhurst. 1998. Drosophila CtBP: a Hairy-interacting protein required for embryonic segmentation and hairy-mediated transcriptional repression. EMBO J. 17:2067-2078.[CrossRef][Medline]
24. Ptashne, M., and A. Gann. 2001. Genes and signals. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
25. Redemann, N., U. Gaul, and H. Jackle. 1988. Disruption of a putative Cys-zinc interaction eliminates the biological activity of the Kruppel finger protein. Nature 332:90-92.[CrossRef][Medline]
26. Rio, D. C., and G. M. Rubin. 1985. Transformation of cultured Drosophila melanogaster cells with a dominant selectable marker. Mol. Cell. Biol. 5:1833-1838.
27. Rubin, G. M., and A. C. Spradling. 1982. Genetic transformation of Drosophila with transposable element vectors. Science 218:348-353.
28. Rundlett, S. E., A. A. Carmen, N. Suka, B. M. Turner, and M. Grunstein. 1998. Transcriptional repression by UME6 involves deacetylation of lysine 5 of histone H4 by RPD3. Nature 392:831-835.[CrossRef][Medline]
29. Rushlow, C., P. F. Colosimo, M. C. Lin, M. Xu, and N. Kirov. 2001. Transcriptional regulation of the Drosophila gene zen by competing Smad and Brinker inputs. Genes Dev. 15:340-351.
30. Saller, E., and M. Bienz. 2001. Direct competition between Brinker and Drosophila Mad in Dpp target gene transcription. EMBO Rep. 2:298-305.[CrossRef][Medline]
31. Schaeper, U., J. M. Boyd, S. Verma, E. Uhlmann, T. Subramanian, and G. Chinnadurai. 1995. Molecular cloning and characterization of a cellular phosphoprotein that interacts with a conserved C-terminal domain of adenovirus E1A involved in negative modulation of oncogenic transformation. Proc. Natl. Acad. Sci. USA 92:10467-10471.
32. Small, S., R. Kraut, T. Hoey, R. Warrior, and M. Levine. 1991. Transcriptional regulation of a pair-rule stripe in Drosophila. Genes Dev. 5:827-839.
33. Small, S., A. Blair, and M. Levine. 1992. Regulation of even-skipped stripe 2 in the Drosophila embryo. EMBO J. 11:4047-4057.[Medline]
34. Small, S., D. N. Arnosti, and M. Levine. 1993. Spacing ensures autonomous expression of different stripe enhancers in the even-skipped promoter. Development 119:767-772.[Abstract]
35. Small, S., A. Blair, and M. Levine. 1996. Regulation of two pair-rule stripes by a single enhancer in the Drosophila embryo. Dev. Biol. 175:314-324.[CrossRef][Medline]
36. Sollerbrant, K., G. Chinnadurai, and C. Svensson. 1996. The CtBP binding domain in the adenovirus E1A protein controls CR1-dependent transactivation. Nucleic Acids Res. 24:2578-2584.
37. Stanojevic, D., T. Hoey, and M. Levine. 1989. Sequence-specific DNA-binding activities of the gap proteins encoded by hunchback and Krüppel in Drosophila. Nature 341:331-335.[CrossRef][Medline]
38. Thummel, C. S., A. M. Boulet, and H. D. Lipshitz. 1988. Vectors for Drosophila P-element-mediated transformation and tissue culture transfection. Gene 74:445-456.[CrossRef][Medline]
39. Woychik, N. A., and M. Hampsey. 2002. The RNA polymerase II machinery: structure illuminates function. Cell 108:453-463.[CrossRef][Medline]
40. Yan, R., S. Small, C. Desplan, C. R. Dearolf, and J. E. Darnell, Jr. 1996. Identification of a Stat gene that functions in Drosophila development. Cell 84:421-430.[CrossRef][Medline]
41. Zhang, Q. D., W. Piston, and R. H. Goodman. 2002. Regulation of corepressor function by nuclear NADH. Science 295:895-897.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|
