Previous Article | Next Article 
Molecular and Cellular Biology, August 2003, p. 5293-5300, Vol. 23, No. 15
0270-7306/03/$08.00+0 DOI: 10.1128/MCB.23.15.5293-5300.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Transposable Elements: Targets for Early Nutritional Effects on Epigenetic Gene Regulation
Robert A. Waterland and Randy L. Jirtle*
Department of Radiation Oncology, Duke University Medical Center, Durham, North Carolina 27710
Received 7 January 2003/
Returned for modification 14 April 2003/
Accepted 8 May 2003

ABSTRACT
Early nutrition affects adult metabolism in humans and other
mammals, potentially via persistent alterations in DNA methylation.
With viable yellow agouti (
Avy) mice, which harbor a transposable
element in the
agouti gene, we tested the hypothesis that the
metastable methylation status of specific transposable element
insertion sites renders them epigenetically labile to early
methyl donor nutrition. Our results show that dietary methyl
supplementation of
a/a dams with extra folic acid, vitamin B
12,
choline, and betaine alter the phenotype of their
Avy/a offspring
via increased CpG methylation at the
Avy locus and that the
epigenetic metastability which confers this lability is due
to the
Avy transposable element. These findings suggest that
dietary supplementation, long presumed to be purely beneficial,
may have unintended deleterious influences on the establishment
of epigenetic gene regulation in humans.

INTRODUCTION
Human epidemiologic and animal model data indicate that susceptibility
to adult-onset chronic disease is influenced by persistent adaptations
to prenatal and early postnatal nutrition (
1,
2,
13,
14); however,
the specific biological mechanisms underlying such adaptations
remain largely unknown. Cytosine methylation within CpG dinucleotides
of DNA acts in concert with other chromatin modifications to
heritably maintain specific genomic regions in a transcriptionally
silent state (
4). Genomic patterns of CpG methylation are reprogrammed
in the early embryo and maintained thereafter (
20). Because
diet-derived methyl donors and cofactors are necessary for the
synthesis of
S-adenosylmethionine, required for CpG methylation
(
23), early nutrition may therefore influence adult phenotype
via DNA methylation (
26).
Accordingly, it is important to identify genomic regions that are likely targets for early nutritional influences on CpG methylation. Most regions of the adult mammalian genome exhibit little interindividual variability in tissue-specific CpG methylation levels. Conversely, CpG methylation is determined probabilistically at specific transposable element insertion sites in the mouse genome, causing cellular epigenetic mosaicism and individual phenotypic variability (19). Transposable elements (including retrotransposons and DNA transposons) are parasitic elements which are scattered throughout and constitute over 35% of the human genome (32). Most transposable elements in the mammalian genome are normally silenced by CpG methylation (32). The epigenetic state of a subset of transposable elements, however, is metastable and can affect regions encompassing neighboring genes. (19). We hypothesized that the epigenetic metastability of such regions renders them susceptible to nutritional influences during early development.
We tested this hypothesis in viable yellow agouti (Avy) mice. The murine agouti gene encodes a paracrine signaling molecule that signals follicular melanocytes to switch from producing black eumelanin to yellow phaeomelanin. Transcription is initiated from a hair cycle-specific promoter in exon 2 of the agouti (A) allele (Fig. 1A). Transient agouti expression in hair follicles during a specific stage of hair growth results in a subapical yellow band on each hair, causing the brown (agouti) coat color of wild-type mice (8). The nonagouti (a) allele was caused by a loss-of-function mutation in A (5); a/a homozygotes are therefore black. The Avy allele (Fig. 1A) resulted from the insertion of an intracisternal A particle (IAP) retrotransposon into the 5' end of the A allele (8). Ectopic agouti transcription is initiated from a cryptic promoter in the proximal end of the Avy IAP. CpG methylation in this region varies dramatically among individual Avy mice and is correlated inversely with ectopic agouti expression. This epigenetic variability causes a wide variation in individual coat color (Fig. 2A), adiposity, glucose tolerance, and tumor susceptibility among isogenic Avy/a littermates (15).
Dietary methyl supplementation of
a/a dams shifts the coat color
distribution of their
Avy/a offspring (
30). Because
Avy/a coat
color correlates with
Avy methylation status (
15), it has been
inferred that supplementation alters phenotype via
Avy methylation
(
7). Nevertheless, no study has yet compared
Avy methylation
among the offspring of supplemented and unsupplemented dams
(
25). Therefore, to test our hypothesis that transposable elements
are targets for early nutritional effects on epigenetic gene
regulation, we had to determine if CpG methylation plays a role
in diet-induced phenotypic alterations in
Avy/a mice.
Agouti pseudoexon 1A (PS1A) was formed when a 4.1-kb genomic region containing exon 1A underwent duplication and inversion (Fig. 1A) (6). In mice that carry the light-bellied agouti (Aw) allele, exon 1A is oriented properly with respect to the agouti gene and drives agouti expression (and yellow pigmentation) throughout the hair growth cycle in ventral follicles. The orientation of the duplication is reversed in mice carrying the A allele (Fig. 1A). In these animals, exon 1A points away from agouti, causing a loss of ventral follicle-specific agouti expression (6). Early genetic analyses concluded that the Avy IAP is located within agouti exon 1A (8); however, this conclusion has not been reevaluated since the subsequent characterization of the inverted repeat in the region (6).
In this study, after determining the actual location of the Avy IAP, we showed that dietary methyl donor supplementation of a/a dams alters Avy/a offspring phenotype by increasing CpG methylation at the Avy locus. Furthermore, we demonstrated that the epigenetic metastability which confers this lability is due to the Avy IAP.

MATERIALS AND METHODS
Animals and diets.
Avy mice were obtained from the colony at the Oak Ridge National
Laboratory (
29). The
Avy mutation arose spontaneously in the
C3H/HeJ strain. Mice carrying the mutation were backcrossed
with C57BL/6J mice for one to three generations before being
propagated by sibling mating. These animals therefore include
6.25% to 25% of the C3H/HeJ genome and 75% to 93.75% of the
C57BL/6J genome (
31). This congenic colony has been propagated
by sibling mating and forced heterozygosity for the
Avy allele
for over 200 generations, resulting in an essentially invariant
genetic background.
Virgin a/a females, 8 weeks of age, were assigned randomly to NIH-31 diet or NIH-31 supplemented with the methyl donors and cofactors folic acid, vitamin B12, choline chloride, and anhydrous betaine (Harlan Teklad) (30). All ingredients were provided by Harlan Teklad except for the anhydrous betaine (Finnsugar Bioproducts). The diets were provided for 2 weeks before the females were mated with Avy/a males and throughout pregnancy and lactation. Upon weaning to a stock maintenance diet at age 21 days, the Avy/a offspring were weighed, tail tipped, photographed, and rated for coat color phenotype (Fig. 2A). Animals in this study were maintained in accordance with all relevant federal guidelines, and the study protocol was approved by the Duke University Animal Care and Use Committee.
Phenotypic classification.
The coat color phenotype of Avy/a mice was assessed at 21 and 100 days of age. A single observer classified coat color by visual estimation of the proportion of brown fur: yellow (<5% brown), slightly mottled (
5% but less than half), mottled (about half), heavily mottled (greater than half but
95%), and pseudoagouti (>95%). The term pseudoagouti is used to describe Avy/a animals in which ectopic agouti expression was silenced (or nearly silenced) by CpG methylation, recapitulating the brown agouti phenotype of an A/- mouse.
Long-range PCR.
The Expand Long-Template PCR system (Roche) was used per the manufacturer's instructions. Primers were designed to amplify either the PS1A or exon 1A region (6) from genomic DNA (22): exon 1A forward, 1A-F (TCAGATTCTGGAGTGACAGATAGATCC) and reverse, 1A-R1 (TTCCAGGATTCATCAATAATCGCT), 1A-R2 (AGGTACTGAAATTAACACGGCGTT), and 1A-R3 (GCGGAGAGACTTCTAAATTATTCCGT); PS1A forward, 1A-F, and reverse, PS1A-R1 (AAAGCATTTTTGAAGAAAACCATGAATC), PS1A-R2 (GAAGAAAACCATGAATCAGAAAGGATTTAG), and PS1A-R3 (TGAATCAGAAAGGATTTAGTAAAATGGCTC).
Genomic sequencing.
The PS1A and exon 1A regions were amplified from genomic DNA (22) from two Avy/Avy and two a/a animals. The primers used were 1A-F and 1A-R1 in exon 1A and 1A-F and PS1A-R1 in PS1A (see above). The PCR products were gel purified and sequenced independently (Perkin Elmer dye terminator cycle sequencing system). Regions of identical sequence among isogenic homozygotes were assembled into contigs with GeneJockey II software (Biosoft).
Methylation assay.
A G/A single-nucleotide polymorphism (position 1092 in accession number AF540972, present in both exon 1A and PS1A) that allowed the a and Avy alleles to be cleaved selectively by AloI and SacI, respectively, was identified. We digested 0.5 µg of genomic DNA (22) overnight with 5 U of either AloI or SacI. Bisulfite modification was performed by a procedure adapted from the recently optimized protocol of Gruanau et al. (9). Specifically, each digested genomic DNA sample was precipitated with ethanol, washed, and denatured in 50 µl of 0.3 M NaOH (20 min at 37°C). Deamination was initiated by addition of 450 µl of a solution of saturated sodium bisulfite (Sigma) and 10 mM hydroquinone (Sigma), pH 5.0. Each sample was overlaid with mineral oil and incubated for 4 h at 55°C in the dark. The samples were desalted with the Wizard DNA clean-up system (Promega) and resolved in 50 µl 1 mM Tris-Cl, pH 8.0. DNA samples were desulfonated by addition of 5.5 µl of 3 M NaOH and incubation at 37°C for 20 min, then ethanol precipitated, washed in 75% ethanol, and suspended in 10 µl of 1 mM Tris-Cl, pH 8.0. Because of the possible differential stability of methylated and unmethylated DNA under long-term storage conditions, all studies were conducted with freshly isolated genomic DNA.
Bisulfite-modified DNA (4 µl) was PCR amplified in 50-µl reactions with Platinum Taq DNA polymerase (Invitrogen) per the manufacturer's instructions (40 cycles). PCR bands were agarose gel purified (GenElute Minus EtBr Spin Columns; Sigma) and sequenced manually (Thermo Sequenase radiolabeled terminator cycle sequencing kit; USB Corporation) according to the manufacturer's instructions. Sequencing products were resolved by polyacrylamide gel electrophoresis, with blank lanes between the C and T lanes to avoid signal overlap. Percent methylation at each CpG site was quantitated by phosphor imaging (percent methylation = 100 x [(C volume)/(C volume + T volume)]). Sequencing confirmed that endonuclease digestion was complete. The seven CpG sites studied in the PS1A region (and corresponding exon 1A region) are located at positions 910, 916, 934, 943, 956, 972, and 991 of accession number AF540972. These sites were chosen due to their relative proximity to the regions of dissimilarity between PS1A and exon 1A, enabling region-specific PCR amplification following bisulfite conversion. To analyze CpG methylation within the proximal long terminal repeat of the IAP, we PCR amplified the IAP-PS1A junction with the Avy IAP sequence (8). The nine CpG sites studied are located 138, 130, 124, 101, 80, 40, 27, 24, and 12 nucleotides upstream of the IAP-PS1A junction (8).
Primers used for bisulfite sequencing studies.
For the exon 1A region, we used forward primer 1ABF3 (ATTGTGGTGTAAATAGGTTAGATAG), reverse primer 1ABR3 (TAAACTAAATCAAAATACAAAACCCACC), and sequencing primer 1ABF4 (ATTGTGAATGAAATTTTTTGG). For the PS1A region, we used forward primer 1ABF3, reverse primer PS1ABR2 (CCATAAATCAAAAAAAATTTAATAAAATAAC), and sequencing primer 1ABF4. For the Avy IAP, we used forward primer IAPF3 (ATTTTTAGGAAAAGAGAGTAAGAAGTAAG), reverse primer IAPR4 (TAATTCCTAAAAATTTCAACTAATAACTCC), and sequencing primer IAPF5 (ATTATTTTTTGATTGTTGTAGTTTATGG).
Statistical analysis.
Because the supplements were provided to the dams, they were the appropriate units of analysis. Therefore, all analyses used within-litter averages for 9 litters (30 Avy/a offspring) and 10 litters (39 Avy/a offspring) for the unsupplemented and supplemented groups, respectively. Group comparisons of litter size and day 21 weights were performed by t test. Percent methylation data were not distributed normally and were therefore transformed dichotomously (<20% = 0,
20% = 1) before analysis. Relationships among supplementation, Avy methylation, and coat color were analyzed by mediational regression analysis (3) with SAS software.
Nucleotide sequence accession numbers.
The following sequence data were submitted to GenBank: Avy PS1A (accession number AF540972), a PS1A (accession number AF540973), Avy exon 1A (accession number AF540974), and a exon 1A (accession number AF540975).

RESULTS AND DISCUSSION
To determine if the IAP insertion causes the epigenetic metastability
in the
Avy region, we needed first to determine the IAP location
in the
Avy allele. Exploiting sequence dissimilarities between
exon 1A and PS1A (
6) (Fig.
1A), long-range PCR was used to amplify
the sequence bracketing the consensus IAP insertion site of
both regions. This demonstrated clearly that the 4.5-kb IAP
insert is contained within PS1A and not in exon 1A, as previously
reported (
8) (Fig.
1B).
To distinguish between the Avy and a alleles and thus enable Avy-specific quantitation of PS1A methylation in Avy/a mice, we sequenced the PS1A region downstream from the consensus IAP insertion site in a/a and Avy/Avy homozygotes. We identified and exploited a single-nucleotide polymorphism within an AloI consensus sequence to cleave the PS1A region of the a allele while leaving the Avy allele intact. Hence, by digesting genomic DNA with AloI and employing reverse primers specific to PS1A, bisulfite sequencing (9) was used to quantify site-specific CpG methylation of the Avy PS1A in Avy/a mice. Importantly, because each Avy/a cell contains only one copy of the Avy allele, our assay quantitates the percentage of cells in which each Avy CpG site examined is methylated.
Dietary supplementation of a/a dams throughout the reproductive cycle did not affect litter size or offspring body weight at age 21 days (data not shown). Supplementation did shift the coat color distribution of Avy/a offspring toward the brown (pseudoagouti) phenotype (Fig. 2B). To determine if this phenotypic change was caused by increased Avy CpG methylation, we quantitated PS1A CpG methylation at seven CpG sites (
600 bp downstream from the IAP insertion site) in tail tip DNA from all Avy/a offspring born to nine unsupplemented and 10 supplemented dams. We chose to measure CpG methylation in this region for two reasons: (ii) amplification of bisulfite-treated DNA was more reliable in this region than in the IAP long terminal repeat, and (ii) the correlations between average percent methylation and coat color phenotype are comparable in the two regions (IAP long terminal repeat r2 = 0.82, downstream of PS1A r2 = 0.85), indicating that measurements of CpG methylation 600 bp downstream of the IAP insertion site are representative of average methylation levels throughout the PS1A region encompassing the Avy transcription start site.
Percent methylation in Avy PS1A was distributed bimodally in unsupplemented Avy/a offspring (Fig. 3A), suggesting a probabilistic epigenetic switch that tends to assume one of two methylation states (19). Maternal supplementation caused a general increase in methylation at each site (Fig. 3A). We examined the relationships among supplementation, CpG methylation, and coat color by mediational regression analysis (3). The highly significant effect of supplementation on coat coloration vanished when Avy methylation was included in the model (Fig. 3B). This provides the first experimental evidence that Avy CpG methylation mediates the effect of supplementation on Avy/a coat color.
To determine if the nutritional effect on
Avy PS1A methylation
in tail DNA extends to other tissues, average percent methylation
of
Avy PS1A was also measured in liver, kidney, and brain samples
from animals representing the five coat color phenotypes. PS1A
methylation in the tail correlated highly with that in the other
tissues (Fig.
4A). The tissues studied were derived from the
three germ layers of the early embryo: endoderm (liver), mesoderm
(kidney), and ectoderm (brain). These data thus indicate that
Avy methylation is determined in the early embryo and maintained
with high fidelity throughout development. This is consistent
with previous studies showing high
agouti expression in all
tissues of yellow but not pseudoagouti
Avy/a mice (
31). Hence,
the nutritional effect on
Avy methylation likely occurs during
early embryonic development and affects all tissues.
Coat color phenotype and
Avy methylation also persisted to adulthood.
Independent classification of coat color phenotype at age 100
days agreed with the day 21 classification in 48 of 50
Avy/a mice (data not shown). Similarly, mean
Avy PS1A methylation
in day 21 tail DNA predicted that in day 100 liver DNA (Fig.
4B). These data further support the idea that
Avy PS1A methylation
levels in tail DNA reflect those in other tissues and demonstrate
that average
Avy methylation is maintained quantitatively from
weaning to adulthood. Hence, transient exposure of
Avy/a mice
to methyl supplementation in utero causes a shift in epigenotype
that persists to influence the adult phenotype.
Alleles such as Avy, whose epigenetic marks are determined probabilistically but subsequently maintained stably, have been termed metastable epialleles (19). Metastable epialleles are commonly associated with transposable elements (19), which can interfere with the expression of neighboring genes (27). Nonetheless, it remains unclear if the epigenetic metastability of the Avy allele is due to the IAP insert or if some unique characteristic of the PS1A sequence contributes to its probabilistic variability in CpG methylation. Because the exon 1A region is nearly identical to the PS1A region (Fig. 1A), it provides an ideal cis negative control region by which to examine the IAP's influence on epigenetic metastability. Similarly, the PS1A region on the a allele of Avy/a heterozygotes provides a negative control region in trans.
We therefore measured site-specific methylation of seven homologous CpG sites within exon 1A and PS1A of the a and Avy alleles in Avy/a animals of divergent phenotypes (Fig. 5). The extreme interindividual variability of Avy PS1A (P < 0.0001 by analysis of variance; Fig. 5B) was not observed in consensus sites within PS1A and exon 1A on the a allele (Fig. 5C and D). Instead, methylation in those regions was tightly regulated in a site-specific fashion and did not differ significantly among individuals. Notably, the interindividual coefficient of variation in percent methylation at each site was only slightly greater than that obtained by serial digestion and bisulfite sequencing of replicate DNA samples from a single individual (data not shown). Percent methylation at individual CpG sites was quantitatively similar between the two regions on a. Methylation of Avy exon 1A, which lies approximately 15 kb upstream of the IAP, was also not significantly different among individual mice (Fig. 5A), but was hypermethylated relative to consensus sites on the a allele (P < 0.0001). Clearly, the epigenetic metastability that renders Avy nutritionally labile is associated with the IAP insertion.
Conversely, proximity to PS1A apparently destabilizes IAP methylation.
We performed bisulfite sequencing of the IAP/PS1A junction to
quantify methylation at nine CpG sites within the cryptic promoter
of the IAP (data not shown). Each animal's average percent methylation
in the PS1A region was predicted by that in the neighboring
IAP regardless of maternal diet (
r2 = 0.92,
n = 22 animals).
Hence, whereas most IAPs in the mouse genome are heavily methylated
(
24), methylation at the
Avy IAP correlates with that in the
neighboring PS1A region and varies dramatically among individuals.
Therefore, epigenetic metastability at the
Avy locus occurs
via a mutual interaction between a transposable element and
its specific genomic region.
These results indicate that epigenetic metastability caused by juxtaposition of transposable elements and genomic promoter region DNA renders a subset of mammalian genes epigenetically labile to the effects of nutrition and other environmental influences during early development. Our findings have important implications for humans because transposable elements constitute over 35% of the human genome (32) and are found within about 4% of human genes (16). Furthermore, many human genes are transcribed from a cryptic promoter within the L1 retrotransposon (17), analogous to ectopic agouti transcription originating in the Avy IAP. It has been proposed that transposable elements in the mammalian genome cause considerable phenotypic variability, making each individual mammal a "compound epigenetic mosaic" (27). Our results provide compelling evidence that the specific composition of each individual's "epigenetic mosaic" is influenced by early nutrition.
Our findings are also important in the context of epigenetic inheritance at the Avy locus. When Avy/a animals inherit the Avy allele maternally, agouti expression and coat color phenotype are correlated with maternal phenotype in that yellow dams produce fewer pseudoagouti offspring than do pseudoagouti dams (28, 30). This phenotypic inheritance was originally attributed to a maternal effect on metabolic differentiation (28). A recent study (15), however, suggests that this parental effect is caused by incomplete erasure of epigenetic marks at the Avy locus in the female germ line. Our findings show that early nutrition can influence the establishment of epigenetic marks at the Avy locus in the early embryo, thereby affecting all tissues, including, presumably, the germ line. Hence, incomplete erasure of nutritionally induced epigenetic alterations at Avy provides a plausible mechanism by which adaptive evolution (10) may occur in mammals.
The moderate nature of the nutritional treatment used in these studies further underscores their relevance to humans. Whereas severe methyl donor deficiency has been demonstrated to induce gene-specific DNA hypomethylation in rodents (12), we show here that merely supplementing a mother's nutritionally adequate diet with extra folic acid, vitamin B12, choline, and betaine can permanently affect the offspring's DNA methylation at epigenetically susceptible loci. This finding supports the conjecture that population-based supplementation with folic acid, intended to reduce the incidence of neural tube defects, may have unintended influences on the establishment of epigenetic gene-regulatory mechanisms during human embryonic development (21).
It is increasingly evident that epigenetic gene regulatory mechanisms play important roles in the etiology of human diseases (11, 18). Our findings demonstrate that mammalian metastable epialleles associated with transposable elements enable early environmental influences, including nutrition, to persistently affect these important regulatory mechanisms. Hence, epigenetic alterations at metastable epialleles are a likely mechanistic link between early nutrition and adult chronic disease susceptibility.

ACKNOWLEDGMENTS
We thank George Wolff for providing
Avy animals, Michael Babyak
for statistical advice, and Kay Nolan and Susan Murphy for suggestions
on the manuscript.
This work was supported by a Dannon Institute fellowship (R.A.W.) and NIH grants CA25951 and ES08823.

FOOTNOTES
* Corresponding author. Mailing address: Duke University Medical Center, Department of Radiation Oncology, Box 3433, Durham, NC 27710. Phone: (919) 684-6203. Fax: (919) 684-5584. E-mail:
jirtle{at}radonc.duke.edu.


REFERENCES
1 - Barker, D. J. 1997. Intrauterine programming of coronary heart disease and stroke. Acta Paediatr. Suppl. 423:178-183.[Medline]
2 - Barker, D. J. 1994. Programming the baby, p. 14-36. In D. J. Barker (ed.), Mothers, babies, and disease in later life. BMJ Publishing Group, London, UK.
3 - Baron, R. M., and D. A. Kenny. 1986. The moderator-mediator variable distinction in social psychological research: conceptual, strategic, and statistical considerations. J. Pers. Soc. Psychol. 51:1173-1182.[CrossRef][Medline]
4 - Bird, A. 2002. DNA methylation patterns and epigenetic memory. Genes Dev. 16:6-21.[Free Full Text]
5 - Bultman, S. J., E. J. Michaud, and R. P. Woychik. 1992. Molecular characterization of the mouse agouti locus. Cell 71:1195-1204.[CrossRef][Medline]
6 - Chen, Y., D. M. Duhl, and G. S. Barsh. 1996. Opposite orientations of an inverted duplication and allelic variation at the mouse agouti locus. Genetics 144:265-277.[Abstract]
7 - Cooney, C. A., A. A. Dave, and G. L. Wolff. 2002. Maternal methyl supplements in mice affect epigenetic variation and DNA methylation of offspring. J. Nutr. 132:2393S-2400S.[Abstract/Free Full Text]
8 - Duhl, D. M., H. Vrieling, K. A. Miller, G. L. Wolff, and G. S. Barsh. 1994. Neomorphic agouti mutations in obese yellow mice. Nat. Genet. 8:59-65.[CrossRef][Medline]
9 - Grunau, C., S. J. Clark, and A. Rosenthal. 2001. Bisulfite genomic sequencing: systematic investigation of critical experimental parameters. Nucleic Acids Res. 29:E65-E66.
10 - Jablonka, E., and M. J. Lamb. 1989. The inheritance of acquired epigenetic variations. J. Theor. Biol. 139:69-83.[Medline]
11 - Jones, P. A., and S. B. Baylin. 2002. The fundamental role of epigenetic events in cancer. Nat. Rev. Genet. 3:415-428.[Medline]
12 - Kim, Y. I., I. P. Pogribny, A. G. Basnakian, J. W. Miller, J. Selhub, S. J. James, and J. B. Mason. 1997. Folate deficiency in rats induces DNA strand breaks and hypomethylation within the p53 tumor suppressor gene. Am. J. Clin. Nutr. 65:46-52.[Abstract/Free Full Text]
13 - Lucas, A. 1998. Programming by early nutrition: an experimental approach. J. Nutr. 128:401S-406S.
14 - Lucas, A. 1991. Programming by early nutrition in man. Ciba Found. Symp. 156:38-50.[Medline]
15 - Morgan, H. D., H. G. Sutherland, D. I. Martin, and E. Whitelaw. 1999. Epigenetic inheritance at the agouti locus in the mouse. Nat. Genet. 23:314-318.[CrossRef][Medline]
16 - Nekrutenko, A., and W. H. Li. 2001. Transposable elements are found in a large number of human protein-coding genes. Trends Genet. 17:619-621.[CrossRef][Medline]
17 - Nigumann, P., K. Redik, K. Matlik, and M. Speek. 2002. Many human genes are transcribed from the antisense promoter of L1 retrotransposon. Genomics 79:628-634.[CrossRef][Medline]
18 - Petronis, A. 2001. Human morbid genetics revisited: relevance of epigenetics. Trends Genet. 17:142-146.[CrossRef][Medline]
19 - Rakyan, V. K., M. E. Blewitt, R. Druker, J. I. Preis, and E. Whitelaw. 2002. Metastable epialleles in mammals. Trends Genet. 18:348-351.[CrossRef][Medline]
20 - Reik, W., W. Dean, and J. Walter. 2001. Epigenetic reprogramming in mammalian development. Science 293:1089-1093.[Abstract/Free Full Text]
21 - Stover, P. J., and C. Garza. 2002. Bringing individuality to public health recommendations. J. Nutr. 132:2476S-2480S.[Abstract/Free Full Text]
22 - Strauss, W. M. 2001. Preparation of genomic DNA from mammalian tissue, p. 2.2.1-2.2.3. In F. M. Ausubel et al. (ed.), Current protocols in molecular biology, vol. 1. J. Wiley & Sons, New York, N.Y.
23 - Van den Veyver, I. 2002. Genetic effects of methylation diets. Annu. Rev. Nutr. 22:255-282.[CrossRef][Medline]
24 - Walsh, C. P., J. R. Chaillet, and T. H. Bestor. 1998. Transcription of IAP endogenous retroviruses is constrained by cytosine methylation. Nat. Genet. 20:116-117.[CrossRef][Medline]
25 - Waterland, R. A. 2003. Do maternal methyl supplements in mice affect DNA methylation of offspring? J. Nutr. 133:238.[Free Full Text]
26 - Waterland, R. A., and C. Garza. 1999. Potential mechanisms of metabolic imprinting that lead to chronic disease. Am. J. Clin. Nutr. 69:179-197.[Abstract/Free Full Text]
27 - Whitelaw, E., and D. I. Martin. 2001. Retrotransposons as epigenetic mediators of phenotypic variation in mammals. Nat. Genet. 27:361-365.[CrossRef][Medline]
28 - Wolff, G. L. 1978. Influence of maternal phenotype on metabolic differentiation of agouti locus mutants in the mouse. Genetics 88:529-539.[Abstract/Free Full Text]
29 - Wolff, G. L. 1996. Variability in gene expression and tumor formation within genetically homogeneous animal populations in bioassays. Fundam. Appl. Toxicol. 29:176-184.[CrossRef][Medline]
30 - Wolff, G. L., R. L. Kodell, S. R. Moore, and C. A. Cooney. 1998. Maternal epigenetics and methyl supplements affect agouti gene expression in Avy/a mice. FASEB J. 12:949-957.[Abstract/Free Full Text]
31 - Yen, T. T., A. M. Gill, L. G. Frigeri, G. S. Barsh, and G. L. Wolff. 1994. Obesity, diabetes, and neoplasia in yellow A(vy)/- mice: ectopic expression of the agouti gene. FASEB J. 8:479-488.[Abstract]
32 - Yoder, J. A., C. P. Walsh, and T. H. Bestor. 1997. Cytosine methylation and the ecology of intragenomic parasites. Trends Genet. 13:335-340.[CrossRef][Medline]
Molecular and Cellular Biology, August 2003, p. 5293-5300, Vol. 23, No. 15
0270-7306/03/$08.00+0 DOI: 10.1128/MCB.23.15.5293-5300.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Miller, J. W, Garrod, M. G, Allen, L. H, Haan, M. N, Green, R.
(2009). Metabolic evidence of vitamin B-12 deficiency, including high homocysteine and methylmalonic acid and low holotranscobalamin, is more pronounced in older adults with elevated plasma folate. Am. J. Clin. Nutr.
90: 1586-1592
[Abstract]
[Full Text]
-
Tobi, E. W., Lumey, L.H., Talens, R. P., Kremer, D., Putter, H., Stein, A. D., Slagboom, P. E., Heijmans, B. T.
(2009). DNA methylation differences after exposure to prenatal famine are common and timing- and sex-specific. Hum Mol Genet
18: 4046-4053
[Abstract]
[Full Text]
-
Nadeau, J. H.
(2009). Transgenerational genetic effects on phenotypic variation and disease risk. Hum Mol Genet
18: R202-R210
[Abstract]
[Full Text]
-
Plagemann, A., Harder, T., Brunn, M., Harder, A., Roepke, K., Wittrock-Staar, M., Ziska, T., Schellong, K., Rodekamp, E., Melchior, K., Dudenhausen, J. W.
(2009). Hypothalamic proopiomelanocortin promoter methylation becomes altered by early overfeeding: an epigenetic model of obesity and the metabolic syndrome. J. Physiol.
587: 4963-4976
[Abstract]
[Full Text]
-
Haycock, P. C.
(2009). Fetal Alcohol Spectrum Disorders: The Epigenetic Perspective. Biol. Reprod.
81: 607-617
[Abstract]
[Full Text]
-
Hoyo, C., Murphy, S. K, Jirtle, R. L
(2009). Imprint regulatory elements as epigenetic biosensors of exposure in epidemiological studies. J. Epidemiol. Community Health
63: 683-684
[Full Text]
-
Waterland, R. A., Kellermayer, R., Rached, M.-T., Tatevian, N., Gomes, M. V., Zhang, J., Zhang, L., Chakravarty, A., Zhu, W., Laritsky, E., Zhang, W., Wang, X., Shen, L.
(2009). Epigenomic profiling indicates a role for DNA methylation in early postnatal liver development. Hum Mol Genet
18: 3026-3038
[Abstract]
[Full Text]
-
Babyak, M. A
(2009). Understanding confounding and mediation. Evid. Based Ment. Health
12: 68-71
[Full Text]
-
Morley, R., Saffery, R., Hacking, D. F., Craig, J. M.
(2009). Epigenetics and Neonatology: The Birth of a New Era. NeoReviews
10: e387-e395
[Abstract]
[Full Text]
-
Lippman, S. M., Hawk, E. T.
(2009). Cancer Prevention: From 1727 to Milestones of the Past 100 Years. Cancer Res.
69: 5269-5284
[Abstract]
[Full Text]
-
Lawrance, A K, Deng, L, Rozen, R
(2009). Methylenetetrahydrofolate reductase deficiency and low dietary folate reduce tumorigenesis in Apcmin/+ mice. Gut
58: 805-811
[Abstract]
[Full Text]
-
Lippman, S. M.
(2009). Cancer Prevention Research: Back to the Future. Cancer Prevention Research
2: 503-513
[Full Text]
-
Haberg, S E, London, S J, Stigum, H, Nafstad, P, Nystad, W
(2009). Folic acid supplements in pregnancy and early childhood respiratory health. Arch. Dis. Child.
94: 180-184
[Abstract]
[Full Text]
-
Arai, J. A., Li, S., Hartley, D. M., Feig, L. A.
(2009). Transgenerational Rescue of a Genetic Defect in Long-Term Potentiation and Memory Formation by Juvenile Enrichment. J. Neurosci.
29: 1496-1502
[Abstract]
[Full Text]
-
Zeisel, S. H
(2009). Importance of methyl donors during reproduction. Am. J. Clin. Nutr.
89: 673S-677S
[Abstract]
[Full Text]
-
Green, R.
(2009). Is it time for vitamin B-12 fortification? What are the questions?. Am. J. Clin. Nutr.
89: 712S-716S
[Abstract]
[Full Text]
-
Davison, J. M., Mellott, T. J., Kovacheva, V. P., Blusztajn, J. K.
(2009). Gestational Choline Supply Regulates Methylation of Histone H3, Expression of Histone Methyltransferases G9a (Kmt1c) and Suv39h1 (Kmt1a), and DNA Methylation of Their Genes in Rat Fetal Liver and Brain. J. Biol. Chem.
284: 1982-1989
[Abstract]
[Full Text]
-
Johnston, R. B. Jr
(2009). Folic Acid: Preventive Nutrition for Preconception, the Fetus, and the Newborn. NeoReviews
10: e10-e19
[Abstract]
[Full Text]
-
van der Maarel, S M
(2008). Epigenetic mechanisms in health and disease. Ann Rheum Dis
67: iii97-iii100
[Abstract]
[Full Text]
-
Heijmans, B. T., Tobi, E. W., Stein, A. D., Putter, H., Blauw, G. J., Susser, E. S., Slagboom, P. E., Lumey, L. H.
(2008). Persistent epigenetic differences associated with prenatal exposure to famine in humans. Proc. Natl. Acad. Sci. USA
105: 17046-17049
[Abstract]
[Full Text]
-
Oh, G., Petronis, A.
(2008). Environmental Studies of Schizophrenia Through the Prism of Epigenetics. Schizophr Bull
34: 1122-1129
[Abstract]
[Full Text]
-
Kitami, T., Rubio, R., O'Brien, W., Quackenbush, J., Nadeau, J. H.
(2008). Gene-environment interactions reveal a homeostatic role for cholesterol metabolism during dietary folate perturbation in mice. Physiol. Genomics
35: 182-190
[Abstract]
[Full Text]
-
Morgan, H. D., Jin, X. L., Li, A., Whitelaw, E., O'Neill, C.
(2008). The Culture of Zygotes to the Blastocyst Stage Changes the Postnatal Expression of an Epigentically Labile Allele, Agouti Viable Yellow, in Mice. Biol. Reprod.
79: 618-623
[Abstract]
[Full Text]
-
Kim, Y.-I.
(2008). Folic Acid Supplementation and Cancer Risk: Point. Cancer Epidemiol. Biomarkers Prev.
17: 2220-2225
[Full Text]
-
Ulrich, C. M.
(2008). Folate and Cancer Prevention--Where to Next? Counterpoint. Cancer Epidemiol. Biomarkers Prev.
17: 2226-2230
[Full Text]
-
Issa, J.-P.
(2008). Cancer Prevention: Epigenetics Steps Up to the Plate. Cancer Prevention Research
1: 219-222
[Full Text]
-
Fu, V. X., Dobosy, J. R., Desotelle, J. A., Almassi, N., Ewald, J. A., Srinivasan, R., Berres, M., Svaren, J., Weindruch, R., Jarrard, D. F.
(2008). Aging and Cancer-Related Loss of Insulin-like Growth Factor 2 Imprinting in the Mouse and Human Prostate. Cancer Res.
68: 6797-6802
[Abstract]
[Full Text]
-
Szeto, I. M. Y., Aziz, A., Das, P. J., Taha, A. Y., Okubo, N., Reza-Lopez, S., Giacca, A., Anderson, G. H.
(2008). High multivitamin intake by Wistar rats during pregnancy results in increased food intake and components of the metabolic syndrome in male offspring. Am. J. Physiol. Regul. Integr. Comp. Physiol.
295: R575-R582
[Abstract]
[Full Text]
-
Barbieri, R. L.
(2008). Update in Female Reproduction: A Life-Cycle Approach. J. Clin. Endocrinol. Metab.
93: 2439-2446
[Abstract]
[Full Text]
-
Wang, F., Tong, Q.
(2008). Transcription factor PU.1 is expressed in white adipose and inhibits adipocyte differentiation. Am. J. Physiol. Cell Physiol.
295: C213-C220
[Abstract]
[Full Text]
-
Dion, V., Lin, Y., Hubert, L. Jr., Waterland, R. A., Wilson, J. H.
(2008). Dnmt1 deficiency promotes CAG repeat expansion in the mouse germline. Hum Mol Genet
17: 1306-1317
[Abstract]
[Full Text]
-
Kotsopoulos, J., Sohn, K.-J., Kim, Y.-I.
(2008). Postweaning Dietary Folate Deficiency Provided through Childhood to Puberty Permanently Increases Genomic DNA Methylation in Adult Rat Liver. J. Nutr.
138: 703-709
[Abstract]
[Full Text]
-
Masten, A. S., Faden, V. B., Zucker, R. A., Spear, L. P.
(2008). Underage Drinking: A Developmental Framework. Pediatrics
121: S235-S251
[Abstract]
[Full Text]
-
Kucharski, R., Maleszka, J., Foret, S., Maleszka, R.
(2008). Nutritional Control of Reproductive Status in Honeybees via DNA Methylation. Science
319: 1827-1830
[Abstract]
[Full Text]
-
Feinberg, A. P.
(2008). Epigenetics at the Epicenter of Modern Medicine. JAMA
299: 1345-1350
[Abstract]
[Full Text]
-
Miller, R. L., Ho, S.-m.
(2008). Environmental Epigenetics and Asthma: Current Concepts and Call for Studies. Am. J. Respir. Crit. Care Med.
177: 567-573
[Abstract]
[Full Text]
-
Smith, A D., Kim, Y.-I., Refsum, H.
(2008). Is folic acid good for everyone?. Am. J. Clin. Nutr.
87: 517-533
[Abstract]
[Full Text]
-
Sinclair, K. D., Allegrucci, C., Singh, R., Gardner, D. S., Sebastian, S., Bispham, J., Thurston, A., Huntley, J. F., Rees, W. D., Maloney, C. A., Lea, R. G., Craigon, J., McEvoy, T. G., Young, L. E.
(2007). DNA methylation, insulin resistance, and blood pressure in offspring determined by maternal periconceptional B vitamin and methionine status. Proc. Natl. Acad. Sci. USA
104: 19351-19356
[Abstract]
[Full Text]
-
Szyf, M.
(2007). The Dynamic Epigenome and its Implications in Toxicology. Toxicol Sci
100: 7-23
[Abstract]
[Full Text]
-
Kovacheva, V. P., Mellott, T. J., Davison, J. M., Wagner, N., Lopez-Coviella, I., Schnitzler, A. C., Blusztajn, J. K.
(2007). Gestational Choline Deficiency Causes Global and Igf2 Gene DNA Hypermethylation by Up-regulation of Dnmt1 Expression. J. Biol. Chem.
282: 31777-31788
[Abstract]
[Full Text]
-
Cropley, J. E., Suter, C. M., Martin, D. I. K.
(2007). Methyl donors change the germline epigenetic state of the Avy allele. FASEB J.
21: 3021-3021
[Full Text]
-
Yajnik, C. S., Godbole, K., Otiv, S. R., Lubree, H. G.
(2007). Fetal Programming of Type 2 Diabetes: Is sex important?. Diabetes Care
30: 2754-2755
[Full Text]
-
Waterland, R. A., Travisano, M., Tahiliani, K. G.
(2007). Diet-induced hypermethylation at agouti viable yellow is not inherited transgenerationally through the female. FASEB J.
21: 3380-3385
[Abstract]
[Full Text]
-
Zeisel, S. H
(2007). Nutrigenomics and metabolomics will change clinical nutrition and public health practice: insights from studies on dietary requirements for choline. Am. J. Clin. Nutr.
86: 542-548
[Abstract]
[Full Text]
-
Ross, S. A, Milner, J. A
(2007). Epigenetic modulation and cancer: effect of metabolic syndrome?. Am. J. Clin. Nutr.
86: 872S-877S
[Abstract]
[Full Text]
-
Smith, F. M., Holt, L. J., Garfield, A. S., Charalambous, M., Koumanov, F., Perry, M., Bazzani, R., Sheardown, S. A., Hegarty, B. D., Lyons, R. J., Cooney, G. J., Daly, R. J., Ward, A.
(2007). Mice with a Disruption of the Imprinted Grb10 Gene Exhibit Altered Body Composition, Glucose Homeostasis, and Insulin Signaling during Postnatal Life. Mol. Cell. Biol.
27: 5871-5886
[Abstract]
[Full Text]
-
Dolinoy, D. C., Huang, D., Jirtle, R. L.
(2007). Maternal nutrient supplementation counteracts bisphenol A-induced DNA hypomethylation in early development. Proc. Natl. Acad. Sci. USA
104: 13056-13061
[Abstract]
[Full Text]
-
Zighelboim, I., Goodfellow, P. J., Schmidt, A. P., Walls, K. C., Mallon, M. A., Mutch, D. G., Yan, P. S., Huang, T. H.-M., Powell, M. A.
(2007). Differential Methylation Hybridization Array of Endometrial Cancers Reveals Two Novel Cancer-Specific Methylation Markers. Clin. Cancer Res.
13: 2882-2889
[Abstract]
[Full Text]
-
Musaad, S., Haynes, E. N.
(2007). Biomarkers of Obesity and Subsequent Cardiovascular Events. Epidemiol Rev
0: mxm005v1-
[Abstract]
[Full Text]
-
Meyer, K., Lubo Zhang,
(2007). Fetal Programming of Cardiac Function and Disease. Reproductive Sciences
14: 209-216
[Abstract]
-
Heijmans, B. T., Kremer, D., Tobi, E. W., Boomsma, D. I., Slagboom, P. E.
(2007). Heritable rather than age-related environmental and stochastic factors dominate variation in DNA methylation of the human IGF2/H19 locus. Hum Mol Genet
16: 547-554
[Abstract]
[Full Text]
-
Herceg, Z.
(2007). Epigenetics and cancer: towards an evaluation of the impact of environmental and dietary factors. Mutagenesis
22: 91-103
[Abstract]
[Full Text]
-
Bobetsis, Y.A., Barros, S.P., Lin, D.M., Weidman, J.R., Dolinoy, D.C., Jirtle, R.L., Boggess, K.A., Beck, J.D., Offenbacher, S.
(2007). Bacterial Infection Promotes DNA Hypermethylation. JDR
86: 169-174
[Abstract]
[Full Text]
-
Wong, J J L, Hawkins, N J, Ward, R L
(2007). Colorectal cancer: a model for epigenetic tumorigenesis. Gut
56: 140-148
[Full Text]
-
(2007). Oral Presentation Abstracts. J. Nutr.
137: 275S-277S
[Full Text]
-
Cropley, J. E., Suter, C. M., Beckman, K. B., Martin, D. I. K.
(2006). From The Cover: Germ-line epigenetic modification of the murine Avy allele by nutritional supplementation. Proc. Natl. Acad. Sci. USA
103: 17308-17312
[Abstract]
[Full Text]
-
Cooney, C. A.
(2006). Germ cells carry the epigenetic benefits of grandmother's diet. Proc. Natl. Acad. Sci. USA
103: 17071-17072
[Full Text]
-
Langley-Evans, S C, Carrington, L J
(2006). Diet and the developing immune system. Lupus
15: 746-752
[Abstract]
-
Whitelaw, N. C., Whitelaw, E.
(2006). How lifetimes shape epigenotype within and across generations. Hum Mol Genet
15: R131-R137
[Abstract]
[Full Text]
-
Kim, Y-I
(2006). Folate: a magic bullet or a double edged sword for colorectal cancer prevention?. Gut
55: 1387-1389
[Full Text]
-
Van Guelpen, B, Hultdin, J, Johansson, I, Hallmans, G, Stenling, R, Riboli, E, Winkvist, A, Palmqvist, R
(2006). Low folate levels may protect against colorectal cancer. Gut
55: 1461-1466
[Abstract]
[Full Text]
-
Jablonka, E.
(2006). Commentary: Induction and selection of variations during cancer development. Int J Epidemiol
35: 1163-1165
[Full Text]
-
Kareta, M. S., Botello, Z. M., Ennis, J. J., Chou, C., Chedin, F.
(2006). Reconstitution and Mechanism of the Stimulation of de Novo Methylation by Human DNMT3L. J. Biol. Chem.
281: 25893-25902
[Abstract]
[Full Text]
-
Ross, J.
(2006). [In Process Citation]. Cancer Epidemiol. Biomarkers Prev.
15: 1057-1058
[Full Text]
-
Anway, M. D., Skinner, M. K.
(2006). Epigenetic Transgenerational Actions of Endocrine Disruptors. Endocrinology
147: s43-s49
[Abstract]
[Full Text]
-
Pechenik, J. A.
(2006). Larval experience and latent effects--metamorphosis is not a new beginning. Integr. Comp. Biol.
46: 323-333
[Abstract]
[Full Text]
-
Waterland, R. A.
(2006). Assessing the Effects of High Methionine Intake on DNA Methylation. J. Nutr.
136: 1706S-1710S
[Abstract]
[Full Text]
-
Callinan, P. A., Feinberg, A. P.
(2006). The emerging science of epigenomics.. Hum Mol Genet
15: R95-R101
[Abstract]
[Full Text]
-
Waterland, R. A., Lin, J.-R., Smith, C. A., Jirtle, R. L.
(2006). Post-weaning diet affects genomic imprinting at the insulin-like growth factor 2 (Igf2) locus. Hum Mol Genet
15: 705-716
[Abstract]
[Full Text]
-
Ulrich, C. M., Potter, J. D.
(2006). Folate supplementation: too much of a good thing?. Cancer Epidemiol. Biomarkers Prev.
15: 189-193
[Full Text]
-
Stover, P. J
(2006). Influence of human genetic variation on nutritional requirements. Am. J. Clin. Nutr.
83: 436S-442S
[Abstract]
[Full Text]
-
Niculescu, M. D., Craciunescu, C. N., Zeisel, S. H.
(2006). Dietary choline deficiency alters global and gene-specific DNA methylation in the developing hippocampus of mouse fetal brains. FASEB J.
20: 43-49
[Abstract]
[Full Text]
-
Weaver, I. C. G., Champagne, F. A., Brown, S. E., Dymov, S., Sharma, S., Meaney, M. J., Szyf, M.
(2005). Reversal of Maternal Programming of Stress Responses in Adult Offspring through Methyl Supplementation: Altering Epigenetic Marking Later in Life. J. Neurosci.
25: 11045-11054
[Abstract]
[Full Text]
-
Colvis, C. M., Pollock, J. D., Goodman, R. H., Impey, S., Dunn, J., Mandel, G., Champagne, F. A., Mayford, M., Korzus, E., Kumar, A., Renthal, W., Theobald, D. E. H., Nestler, E. J.
(2005). Epigenetic Mechanisms and Gene Networks in the Nervous System. J. Neurosci.
25: 10379-10389
[Full Text]
-
Kim, Y.-I.
(2005). Nutritional Epigenetics: Impact of Folate Deficiency on DNA Methylation and Colon Cancer Susceptibility. J. Nutr.
135: 2703-2709
[Abstract]
[Full Text]
-
Gallou-Kabani, C., Junien, C.
(2005). Nutritional Epigenomics of Metabolic Syndrome: New Perspective Against the Epidemic. Diabetes
54: 1899-1906
[Abstract]
[Full Text]
-
Fenech, M.
(2005). The Genome Health Clinic and Genome Health Nutrigenomics concepts: diagnosis and nutritional treatment of genome and epigenome damage on an individual basis. Mutagenesis
20: 255-269
[Abstract]
[Full Text]
-
Luedi, P. P., Hartemink, A. J., Jirtle, R. L.
(2005). Genome-wide prediction of imprinted murine genes. Genome Res
15: 875-884
[Abstract]
[Full Text]
-
Hanson, M. A., Gluckman, P. D.
(2005). Developmental processes and the induction of cardiovascular function: conceptual aspects. J. Physiol.
565: 27-34
[Abstract]
[Full Text]
-
Ernest, S., Hosack, A., O'Brien, W. E., Rosenblatt, D. S., Nadeau, J. H.
(2005). Homocysteine levels in A/J and C57BL/6J mice: genetic, diet, gender, and parental effects. Physiol. Genomics
21: 404-410
[Abstract]
[Full Text]
-
Wong, A. H.C., Gottesman, I. I., Petronis, A.
(2005). Phenotypic differences in genetically identical organisms: the epigenetic perspective. Hum Mol Genet
14: R11-R18
[Abstract]
[Full Text]
-
Ulrey, C. L., Liu, L., Andrews, L. G., Tollefsbol, T. O.
(2005). The impact of metabolism on DNA methylation. Hum Mol Genet
14: R139-R147
[Abstract]
[Full Text]
-
Gluckman, P. D, Hanson, M. A, Spencer, H. G, Bateson, P.
(2005). Environmental influences during development and their later consequences for health and disease: implications for the interpretation of empirical studies. Proc R Soc B
272: 671-677
[Abstract]
[Full Text]
-
Mcmillen, I. C., Robinson, J. S.
(2005). Developmental Origins of the Metabolic Syndrome: Prediction, Plasticity, and Programming. Physiol. Rev.
85: 571-633
[Abstract]
[Full Text]
-
Kauwell, G. P. A.
(2005). Emerging Concepts in Nutrigenomics: A Preview of What Is to Come. Nutr Clin Pract
20: 75-87
[Abstract]
[Full Text]
-
Allegrucci, C., Thurston, A., Lucas, E., Young, L.
(2005). Epigenetics and the germline. Reproduction
129: 137-149
[Abstract]
[Full Text]
-
Drake, A. J., Walker, B. R., Seckl, J. R.
(2005). Intergenerational consequences of fetal programming by in utero exposure to glucocorticoids in rats. Am. J. Physiol. Regul. Integr. Comp. Physiol.
288: R34-R38
[Abstract]
[Full Text]
-
de Fourmestraux, V., Neubauer, H., Poussin, C., Farmer, P., Falquet, L., Burcelin, R., Delorenzi, M., Thorens, B.
(2004). Transcript Profiling Suggests That Differential Metabolic Adaptation of Mice to a High Fat Diet Is Associated with Changes in Liver to Muscle Lipid Fluxes. J. Biol. Chem.
279: 50743-50753
[Abstract]
[Full Text]
-
Baker, J. L, Michaelsen, K. F, Rasmussen, K. M, Sorensen, T. I.
(2004). Maternal prepregnant body mass index, duration of breastfeeding, and timing of complementary food introduction are associated with infant weight gain. Am. J. Clin. Nutr.
80: 1579-1588
[Abstract]
[Full Text]
-
Zeisel, S. H.
(2004). Nutritional Importance of Choline for Brain Development. J. Am. Coll. Nutr.
23: 621S-626S
[Abstract]
[Full Text]
-
Kim, Y.-I.
(2004). Will mandatory folic acid fortification prevent or promote cancer?. Am. J. Clin. Nutr.
80: 1123-1128
[Abstract]
[Full Text]
-
Slominski, A., Tobin, D. J., Shibahara, S., Wortsman, J.
(2004). Melanin Pigmentation in Mammalian Skin and Its Hormonal Regulation. Physiol. Rev.
84: 1155-1228
[Abstract]
[Full Text]
-
van Heyningen, V., Yeyati, P. L.
(2004). Mechanisms of non-Mendelian inheritance in genetic disease. Hum Mol Genet
13: R225-R233
[Abstract]
[Full Text]
-
Jablonka, E.
(2004). Epigenetic epidemiology. Int J Epidemiol
33: 929-935
[Full Text]
-
Craig, S. A.
(2004). Betaine in human nutrition. Am. J. Clin. Nutr.
80: 539-549
[Abstract]
[Full Text]
-
Weidman, J. R., Murphy, S. K., Nolan, C. M., Dietrich, F. S., Jirtle, R. L.
(2004). Phylogenetic Footprint Analysis of IGF2 in Extant Mammals. Genome Res
14: 1726-1732
[Abstract]
[Full Text]
-
Gaudet, F., Rideout, W. M. III, Meissner, A., Dausman, J., Leonhardt, H., Jaenisch, R.
(2004). Dnmt1 Expression in Pre- and Postimplantation Embryogenesis and the Maintenance of IAP Silencing. Mol. Cell. Biol.
24: 1640-1648
[Abstract]
[Full Text]