Previous Article | Next Article ![]()
Molecular and Cellular Biology, August 2003, p. 5780-5789, Vol. 23, No. 16
0270-7306/03/$08.00+0 DOI: 10.1128/MCB.23.16.5780-5789.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
X-Ceptor Therapeutics, San Diego, California 92121,1 Division of Cellular and Molecular Medicine,2 Howard Hughes Medical Institute, University of CaliforniaSan Diego, La Jolla, California 920933
Received 12 December 2002/ Returned for modification 3 February 2003/ Accepted 20 May 2003
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
(LXR
) and LXRß are members of the nuclear receptor superfamily of ligand-activated transcription factors that are regulated by oxidized derivatives of cholesterol termed oxysterols (13, 20). Unlike the sterol response element binding proteins (SREBPs) that induce cholesterol biosynthesis when cellular cholesterol levels are low (2), oxysterol-dependent activation of LXRs induces cholesterol catabolism and/or efflux when cellular cholesterol levels are high. In rodent liver, LXRs positively regulate expression of cholesterol 7
-hydroxylase (Cyp7a), the rate-limiting enzyme in the conversion of cholesterol to bile acids (25). LXRs also regulate the mobilization of cholesterol by inducing expression of the ATP binding cassette (ABC) transporters ABCA1, ABCG1, ABCG5, and ABCG8 and apolipoprotein E (ApoE) (6, 17, 27, 29, 40). The ABC transporters promote the transport of free cholesterol across cell membranes and play important roles in regulating cellular cholesterol homeostasis (16, 19, 23). ABCA1, ABCG5, and ABCG8 are thought to decrease dietary cholesterol absorption by reducing the levels of cholesterol absorbed in the intestine and increasing the levels of cholesterol that are secreted from the liver into the bile for excretion (29, 42). In addition to influencing net cholesterol absorption, ABCA1 is believed to play an important role in reverse cholesterol transport, a mechanism by which cells transfer excess cholesterol to high-density-lipoprotein (HDL) acceptors. Loss of ABCA1 results in Tangier disease, a condition in which patients have extremely low levels of circulating HDL, massive accumulation of cholesterol in macrophages, and an increased risk for developing atherosclerosis (11, 18). In cultured macrophages and in skeletal muscle C2C12 cells, activation of LXR induces ABCA1 expression and cholesterol efflux (5, 24, 34, 39). Thus, the ability of LXR agonists to increase serum HDL levels may result, at least in part, from increased reverse cholesterol transport. Together the actions of LXR in response to elevated cholesterol in peripheral cells, the liver, and the intestine result in an overall net increase in cholesterol mobilization and catabolism, thus making LXR a pharmaceutical target for therapeutic intervention in hypercholesterolemia and atherosclerosis. In support of this finding, LXR agonists have recently been shown to decrease atherosclerotic lesion development in hypercholesterolemic mice (15).
In addition to regulating cholesterol homeostasis, LXR activation has been shown to regulate fatty acid metabolism that leads to increased serum and hepatic triglyceride levels (28, 33). SREBP1c, a transcription factor that regulates expression of many genes encoding enzymes involved in fatty acid synthesis, is a direct target of LXR (28). In addition to SREBP1c, LXR agonists increase hepatic expression of acetyl-CoA carboxylase, fatty acid synthase, and stearoyl CoA desaturase 1 (SCD-1) (28, 33). In the absence of LXRs, the mRNA expression levels of some of these genes in the liver are decreased compared to those in wild-type mice, suggesting that LXR is required to maintain their basal expression levels (28).
The mechanisms by which LXRs regulate programs of gene expression in a ligand-dependent manner remain relatively unexplored. Nuclear receptors activate gene transcription in response to ligands by recruiting coactivator proteins to target gene promoters (8, 22, 30). These coactivators function by altering local chromatin architecture through enzymatic modifications of histone tails (e.g., acetylation) and by recruiting basal transcriptional machinery. In the absence of ligand, many nuclear receptors repress gene transcription by recruiting corepressor proteins, exemplified by the nuclear receptor corepressor (NCoR) (12) and the silencing mediator of retinoic acid and thyroid hormone receptors (SMRT) (4). Corepressors are thought to function by antagonizing actions of coactivators (e.g., through associated histone deacetylase activities) and by recruiting factors that establish more repressive states of chromatin structure.
Here we report that loss of LXR has differential effects on triglyceride and HDL metabolism. Compared to LXR+/+ mice, LXR-/- mice have decreased levels of triglycerides in serum and increased levels of HDL. Analysis of cholesterol efflux and genes involved in reverse cholesterol transport suggests that LXR can function as both an activator and a repressor of reverse cholesterol transport in a gene- and tissue-specific fashion. Several lines of evidence indicate that active repression of LXR target genes is mediated, at least in part, by interactions with the corepressors NCoR and SMRT to repress basal expression of target promoters. The selective derepression of LXR target genes observed in LXR-/- mice is proposed to reflect differential promoter requirements for LXRs as ligand-dependent activators. Together our observations implicate transcriptional repression in the regulation of reverse cholesterol transport and HDL metabolism.
| MATERIALS AND METHODS |
|---|
|
|
|---|
ß+/+ (LXR+/+) and LXR
ß-/- (LXR-/-) mice (mixed background strain A129-C57BL/6) (28) were housed in a controlled environment and given access to feed (Purina 5001) and water ad libitum. Blood was collected from 8-week-old male animals during the middle of a 12-h light cycle. Triglycerides in plasma were measured by using an enzymatic, colorimetric assay (Sigma, St. Louis, Mo.). Plasma HDL levels were measured by an enzymatic assay for total cholesterol (Sigma) following precipitation of non-HDL cholesterol by a heparin-manganese precipitating reagent (Wako Diagnostics, Richmond, Va.). Fourteen wild-type and 11 LXR-/- mice were used for these studies. The P values were 10-6 and 0.0003 for the significance of the triglyceride and HDL tests, respectively. Macrophage isolation. Bone marrow-derived macrophages were obtained as described previously (3, 38). Peritoneal macrophages were isolated from mice 4 days after peritoneal injection of thioglycolate broth medium.
RNA isolation, RT PCR analysis, and Northern blot analysis.
Total RNA was isolated by using RNeasy kits (Qiagen Inc., Valencia, Calif.). Real-time (RT) PCR analysis was performed on an ABI PRISM 7700 sequence detection system with target-specific probes and primers designed with Primer Express (PE Biosystems, Foster City, Calif.). Samples were analyzed as described previously (24). For Northern blot studies, the total RNA was isolated by using Trizol reagent (Invitrogen Life Technologies, Carlsbad, Calif.). Total RNA samples (10 µg per lane) were separated in 1.2% agarose gels containing formaldehyde and transferred to GeneScreen nylon membranes (NEN, Boston, Mass.). Probes were labeled with [
-32P]dCTP (ICN, Costa Mesa, Calif.), and hybridization was performed with Quikhyb (Stratagene, La Jolla, Calif.). Membranes were exposed to X-AR films (Kodak, Rochester, N.Y.).
Cholesterol efflux. Efflux analysis was performed as described by Muscat et al. (24). Briefly, cells were incubated with 14C-labeled cholesterol for 48 h. The medium was then replaced with serum-free medium with or without 10 µg of ApoA1/ml together with ligand or vehicle. After a 24-h incubation, the levels of 14C in the medium and cell lysate were determined.
Transient transfections.
CV-1 cells and mouse embryonic fibroblasts (MEFs) were transfected by using FuGene6 (Roche Applied Science, Indianapolis, Ind.) according to the manufacturer's instructions. Medium containing ligand was added directly to the cells 5 h after transfection. The cells were harvested 18 h later and analyzed for luciferase and ß-galactosidase (ß-Gal) activities. Luciferase activity was normalized to ß-Gal activity. The GAL4-LXR gene constructs used in these assays encode full-length human LXR
and LXRß. In the two-hybrid analysis, the ligand binding domains of human LXR
(amino acids [aa] 164 to 447) and human LXRß (aa 155 to 461) were fused to the VP16 activation domain, and the receptor interacting domains (IDs) of human SMRT (ID1 and ID2; aa 2131 to 2352) and human NCoR (ID1 and ID2; aa 794 to 1397) were fused to the GAL4 DNA binding domain.
ChIP analysis.
The chromatin immunoprecipitation (ChIP) assay was conducted as previously described (14, 35). Briefly, bone marrow-derived macrophages were fixed with 1% formaldehyde and treated as described previously (10). Cross-linked adducts were resuspended and sonicated, resulting in DNA fragments of 200 to 1,200 bp. Immunoprecipitation was performed by using the following antibodies: anti-RXR
(Santa Cruz Biotechnology, Santa Cruz, Calif.), anti-NCoR (Affinity Bioreagents, Golden, Colo.), anti-SMRT (Affinity Bioreagents), anti-acetylated histone H3 (anti-acH3; acetylation on lysines 9 and 14) (Upstate Biotechnology, Lake Placid, N.Y.), anti-acH4 (acetylation on lysines 4, 7, 11, and 15) (Upstate Biotechnology), anti-upstream stimulating factor 1 (anti-USF1; H-86) (Santa Cruz Biotechnology), and anti-USF2 (N-18) (Santa Cruz Biotechnology). Rabbit preimmune serum (Jackson ImmunoResearch Laboratories, West Grove, Pa.) was used as a control for nonspecific binding. For each treatment and immunoprecipitation tested, we used 20 x 106 macrophages and 1 µg of specific antibody. Protein-bound, immunoprecipitated DNA was reverse cross-linked at 65°C overnight and then purified by using a PCR purification kit (Qiagen). Four microliters from a 50-µl DNA extraction volume was used for PCR amplification (25 to 30 cycles). The set of primers shown in Table 1 was used to amplify the regions on the promoter of the genes that were the subjects of this study.
|
EMSA.
Nuclear extracts were obtained as previously described (32). Electrophoretic mobility shift assays (EMSAs) were run as previously described (41). Briefly, nuclear extracts (2 µg) were incubated with EMSA buffer [20 mM Tris (pH 7.9), 60 mM KCl, 0.2 mM EDTA, 0.5 mM diothiothreitol, 1.3 mM MgCl2, 10% glycerol, 3% Ficoll, 2 µg of poly(dI-dC)] for 15 min at 4°C. For supershift experiments, 0.6 µg of specific antibody (Santa Cruz Biotechnology) was incubated with the mixture on ice for 30 min. A probe was prepared by labeling a double-strand oligonucleotide with Klenow enzyme in the presence of [
-32P]dCTP. The sequence for the oligonucleotide used was the following: 5'GGCGGGCCATGTCTCCACGTGCTTTCTGCT3'. The nuclear extracts were then incubated with the radiolabeled probe (2 x 105 cpm) at room temperature for 20 min. After the incubation process, the samples were subjected to electrophoretic separation with 6% retardation gels (Invitrogen) in 0.25x Tris-borate-EDTA buffer. The gel was dried and autoradiographed.
| RESULTS |
|---|
|
|
|---|
and LXRß) maintained on a normal chow diet containing 0.02% cholesterol confirmed that LXR-/- mice have significantly lower serum triglyceride levels than LXR+/+ mice (Fig. 1a) (33). Previous studies demonstrated a decreased level of expression of hepatic SREBP1c, FAS, and SCD-1 in the absence of LXR, suggesting that LXR is required for basal expression of genes in the fatty acid synthesis pathway (25, 28). Therefore, the decrease in triglycerides in serum is most likely a result of decreased fatty acid synthesis. Conversely, serum HDL levels were increased in the absence of LXR (Fig. 1a). LXR agonists have been shown to increase serum HDL levels (33). Therefore, the increased levels of HDL observed in the absence of LXR activity were paradoxical and suggested that LXR may negatively regulate HDL levels in the absence of agonists.
|
Since ABCA1 functions in reverse cholesterol transport, we examined the effects of LXR on cholesterol efflux. In correlation with the ABCA1 mRNA and protein levels, cholesterol efflux was increased by LXR agonist treatment in the LXR+/+ macrophages (Fig. 1e). Comparison of the basal efflux levels of LXR+/+ and LXR-/- macrophages revealed that, as with ABCA1 and ABCG1 expression, basal efflux was increased in the LXR-/- macrophages. These results are consistent with those of previous studies (5, 29, 40) and suggest that ABCA1 expression and cholesterol efflux are increased by LXR in the presence of ligand and repressed by LXR in the absence of ligand.
To determine if LXR represses other target genes in the absence of ligand, we examined the mRNA levels of SREBP1c, SCD-1, lipoprotein lipase (LPL), and ApoE in the same macrophages used to examine ABCA1 expression. As observed with the ABCA1 gene, all of the target genes were increased in LXR+/+ macrophages treated with T1317 (Fig. 2a). However, SREBP1c, SCD-1, LPL, and ApoE mRNA levels were not derepressed by loss of LXR, suggesting that LXR-mediated repression is gene specific.
|
LXRs contain a ligand-reversible repressive function.
To further explore transcriptional repression by LXR, we examined the ability of GAL4-LXR fusions to repress a synthetic GAL4 reporter. As shown in Fig. 3a, recruitment of LXR to a synthetic thymidine kinase promoter containing four copies of a GAL4 response element in CV-1 cells results in repression of basal transcription in the absence of ligand. Upon the addition of LXR agonist, both LXR
and LXRß activated transcription as expected (Fig. 3a). Nuclear receptors have been shown to repress basal transcription through the recruitment of corepressor proteins such as NCoR and SMRT (4, 12). Therefore, we analyzed the ability of LXR to interact with the corepressors NCoR and SMRT by a mammalian two-hybrid analysis, using receptor IDs from NCoR and SMRT and VP-16 fusions of LXR
and LXRß ligand binding domains. In the absence of ligand, both LXR
and LXRß interacted with the corepressor IDs (Fig. 3b). As expected, this interaction was inhibited in the presence of the LXR agonist. To further analyze the role of corepressors in LXR-dependent transcriptional repression, we measured the repressive activity of GAL4-LXR fusions in MEFs isolated from NCoR+/+ and NCoR-/- embryos (14). As was observed with CV-1 cells, unliganded GAL4-LXR
and GAL4-LXRß repressed basal expression of the GAL4-luciferase reporter in the NCoR+/+ MEFs (Fig. 3c). In contrast, LXR-dependent repression was significantly reduced in NCoR-/- MEFs, suggesting that association with the corepressor is required for LXR-mediated repression. The addition of an agonist induced the transcriptional activation of the luciferase reporter by both the GAL4-LXR
and GAL4-LXRß systems (Fig. 3d). Interestingly, the NCoR-/- MEFs showed higher levels of reporter activity upon treatment with ligand than the NCoR+/+ MEFs did, a finding which is consistent with the role of NCoR as a repressor of nuclear receptor-mediated transcription. Moreover, we performed rescue experiments by reconstituting NCoR expression in NCoR-/- MEFs. As shown in Fig. 3e, overexpression of full-length NCoR restored the capability of GAL4-LXRs to repress basal transcription in NCoR-/- cells.
|
or LXRß in ChIP assays are not currently available. Therefore, we used an antibody to the retinoid X receptor alpha (RXR
), the heterodimeric partner of LXR, as a marker for the RXR/LXR heterodimer. As shown in Fig. 4, RXR
occupies the ABCA1 and SREBP1c promoters in the LXR+/+ macrophages in the presence and absence of ligand. In the LXR-/- macrophages, we did not detect RXR
above background levels, confirming that the LXR/RXR heterodimer binds to the regions of the ABCA1 and SREBP1c promoter amplified in this assay. As a control, we also analyzed the recruitment of RXR
to the retinoic acid receptor (RAR) response element at the RARß2 promoter and observed no effect of LXR ligand or loss of LXR expression on the recruitment of RXR
to the RARß2 promoter (Fig. 4). Moreover, in other experiments we did not observe recruitment of RXR
to the ABCA1 or SREBP1c promoters in LXR-/- cells stimulated with T1317 (data not shown), which suggests that this compound does not promote the recruitment of a different RXR heterodimeric partner to these sites.
|
|
Dissociation of NCoR/SMRT does not account for differential regulation of LXR target genes. We next investigated whether differential recruitment of NCoR and SMRT could account for the lack of derepression of the SREBP1c gene in macrophages. ChIP experiments indicated that NCoR associated with the SREBP1c promoter under basal conditions in LXR+/+ macrophages, with lower levels of interaction observed in LXR-/- macrophages (Fig. 5c). The interaction of NCoR with the SREBP1c promoter was decreased upon ligand activation of LXR. Similar results were obtained for SMRT, although signal strength was lower than that observed for NCoR, as was the case for the ABCA1 promoter (data not shown). Agonist treatment of LXR+/+ macrophages also resulted in an increase in histone acetylation at the SREBP1c promoter, with a time course that was similar to that observed for ABCA1 (Fig. 5d). Interestingly, as is the case for the ABCA1 promoter, the acetylation of histone 3 at the SREBP1c promoter was greatly increased in the LXR-/- macrophages in comparison to that in the LXR+/+ macrophages (Fig. 5d). Thus, LXR-dependent recruitment of NCoR, its ligand-dependent dissociation, and hyperacetylation in the absence of LXR all occur on the SREBP1c promoter in a manner that is indistinguishable from that in the ABCA1 promoter.
The fact that SREBP1c expression is not up-regulated in LXR-/- cells indicates that transcriptional activation of SREBP1c requires the presence of an active LXR, while activation of ABCA1 can be achieved by additional tissue-specific factors in the absence of LXR. In extended ChIP assays, we did not detect methylation of histone 3, lysine 9, or arginine 17 on either promoter (data not shown), a finding which argues against silencing mechanisms being involved in permanent repression of the SREBP1c gene. Recent studies have identified two members of the helix-loop-helix transcription factor family, USF1 and USF2, as positive regulators of the human ABCA1 promoter (41). Western blot studies demonstrated that USF1 and USF2 were expressed in bone marrow-derived macrophages (data not shown). Therefore, EMSAs were performed using a radiolabeled oligonucleotide corresponding to the E-box present in the murine proximal ABCA1 promoter. This probe was recognized by a DNA binding activity in nuclear extracts prepared from bone marrow-derived macrophages that was almost completely shifted by antibodies directed against USF1 or USF2 but not against LXR
(Fig. 6a), a finding that is consistent with binding of USF1/USF2 heterodimers. Similar results were obtained in LXR-deficient macrophages (data not shown). ChIP analysis demonstrated binding of these factors to the murine ABCA1 promoter (Fig. 6b). Importantly, despite the existence of several E-box elements in the proximal SREBP1c promoter, no binding of USF1 or USF2 was detected on this promoter.
|
| DISCUSSION |
|---|
|
|
|---|
In our analysis of LXR activity, we confirmed earlier studies suggesting that basal ABCA1 levels and cholesterol efflux were higher in LXR-/- macrophages than in LXR+/+ macrophages. We also observed that HDL cholesterol levels were elevated in LXR-/- mice. These results suggest that LXR is capable of both activating and repressing target genes that control cholesterol efflux and HDL biogenesis, such as the ABCA1 gene. Further analysis revealed that LXR-mediated repression of ABCA1 is both gene and tissue specific. Out of six LXR target genes analyzed, only the two ABC transporters, ABCA1 and to a lesser extent ABCG1, were derepressed in the LXR-/- macrophages. Interestingly, LXR-mediated repression of ABCA1 occurred only in macrophages and intestinal mucosa, both of which are routinely exposed to sudden elevations in cellular cholesterol levels. This combination of repression and activation creates an environment in which the induction of ABCA1 expression upon ligand-mediated activation of LXR is greater in the intestinal mucosa and macrophages than in other tissues. Therefore, the combined ability to repress and activate ABCA1 expression allows for a tightly regulated and responsive system to handle sudden pronounced changes in cellular cholesterol levels.
ChIP experiments indicate that NCoR is recruited to the ABCA1 promoter in an LXR-dependent manner and that either addition of ligand or loss of LXR expression similarly results in decreased recruitment to the promoter. Two-hybrid analysis and studies of NCoR-/- cells further support a role for corepressors in transcriptional repression by LXR. Interestingly, the mRNA levels for the SREBP1c gene and several other LXR target genes are not increased by loss of LXR. Nevertheless, genetic deletion of LXR reduces corepressor binding at the SREBP1c promoter, suggesting that loss of corepressor recruitment is not sufficient to induce transcriptional activation. Therefore, while corepressor recruitment may be required for repression of basal transcription by nuclear receptors, corepressor release is clearly not sufficient for transcriptional activation. The results suggest that additional steps or mechanisms must account for the differential expression levels of ABCA1 and SREBP1c that are observed in the LXR-/- macrophages. Examination of the histone acetylation status of the ABCA1 promoter shows a significant increase in histone H3 acetylation upon loss of LXR expression. This result corresponds to the loss of corepressor recruitment and increased gene transcription. However, similar results were obtained with the SREBP1c promoter, indicating that changes in histone acetylation, at least in the vicinity of the nuclear receptor response elements, are not always synonymous with active gene transcription.
A model for regulation of the ABCA1 and SREBP1c genes suggesting the basis for differential consequences of LXR deletion is illustrated in Fig. 6c. The present study indicates that transcriptional activation of the SREBP1c gene requires agonist-bound LXRs but that activation of the ABCA1 gene does not. These observations imply that the ABCA1 promoter is occupied by additional activators, exemplified by USF1 and USF2, that recruit coactivators that possess histone acetyltransferase (HAT) activity and are also sufficient to drive promoter activity. In the absence of an LXR agonist, recruitment of NCoR is required to maintain the ABCA1 gene in a repressed state. NCoR is not recruited to the ABCA1 promoter in LXR-/- macrophages, and the ABCA1 gene is derepressed. In contrast, while the SREBP1c gene is also likely to be occupied by other activators that recruit HAT-containing coactivators, these factors are not sufficient to activate transcription in the absence of agonist-bound LXRs. Thus, failure of NCoR recruitment to the SREBP1c promoter in LXR-/- macrophages allows it to become hyperacetylated, but this hyperacetylation is not sufficient to promote transcriptional activation (Fig. 6c).
Bone marrow transplant studies reveal that loss of LXR expression in macrophages is proatherogenic (37). Since LXR-/- macrophages have increased levels of ABCA1 and cholesterol efflux activity, these results may appear contradictory. The levels of ABCA1 expression in LXR-/- macrophages, however, are not as great as they are in LXR+/+ macrophages treated with ligand, suggesting the possibility that the levels of ABCA1 needed for antiatherogenic activity in macrophages are not achieved by derepression alone. Additionally, LXR target genes in addition to the ABCA1 gene may be required to mediate the antiatherogenic activities of LXR in macrophages. One possible LXR target gene that may contribute to the antiatherogenic effect of LXR expression is the ApoE gene. Macrophage ApoE expression can significantly reduce lesion development, as revealed by the decreased lesion area observed when ApoE-/- mice receive a bone marrow transplant from ApoE+/+ donors (1, 21).
The increased serum HDL levels and decreased serum triglyceride levels observed in LXR-/- mice are expected to protect against development of atherosclerosis. Because loss of LXR expression results in decreased corepressor recruitment and increased histone acetylation in the LXRE-containing region of target gene promoters, ligands that release corepressors without recruiting coactivators may mimic the effects on HDL observed in the LXR-/- mice. Synthetic ligands with these properties may provide an improved therapeutic index over the first-generation LXR agonists such as T1317, which increase both HDL and triglycerides. Ligands that mediate corepressor release without recruiting coactivators have recently been identified for RARs, suggesting that it may be possible to identify similar ligands for LXRs (7).
| ACKNOWLEDGMENTS |
|---|
These studies were supported by a Biostar grant from the University of California, an NIH grant to the La Jolla Specialized Center of Research on Atherosclerosis (grant HL56989), and a grant from the Stanford Reynolds Center. A.F.V. was supported in part by a grant from the Ministry of Spain (Programa Formación de Personal Investigador en el Extranjero).
B. L. Wagner and A. F. Valledor contributed equally to the preparation of the manuscript and should be considered joint first authors.
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
2. Brown, M. S., and J. L. Goldstein. 1999. A proteolytic pathway that controls the cholesterol content of membranes, cells, and blood. Proc. Natl. Acad. Sci. USA 96:11041-11048.
3. Celada, A., P. W. Gray, E. Rinderknecht, and R. D. Schreiber. 1984. Evidence for a gamma-interferon receptor that regulates macrophage tumoricidal activity. J. Exp. Med. 160:55-74.
4. Chen, J. D., and R. M. Evans. 1995. A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature 377:454-457.[CrossRef][Medline]
5. Claudel, T., M. D. Leibowitz, C. Fievet, A. Tailleux, B. Wagner, J. J. Repa, G. Torpier, J. M. Lobaccaro, J. R. Paterniti, D. J. Mangelsdorf, R. A. Heyman, and J. Auwerx. 2001. Reduction of atherosclerosis in apolipoprotein E knockout mice by activation of the retinoid X receptor. Proc. Natl. Acad. Sci. USA 98:2610-2615.
6. Costet, P., Y. Luo, N. Wang, and A. R. Tall. 2000. Sterol-dependent transactivation of the ABC1 promoter by the liver X receptor/retinoid X receptor. J. Biol. Chem. 275:28240-28245.
7. Germain, P., J. Iyer, C. Zechel, and H. Gronemeyer. 2002. Co-regulator recruitment and the mechanism of retinoic acid receptor synergy. Nature 415:187-192.[CrossRef][Medline]
8. Glass, C. K., and M. G. Rosenfeld. 2000. The coregulator exchange in transcriptional functions of nuclear receptors. Genes Dev. 14:121-141.
9. Haghpassand, M., P. A. Bourassa, O. L. Francone, and R. J. Aiello. 2001. Monocyte/macrophage expression of ABCA1 has minimal contribution to plasma HDL levels. J. Clin. Investig. 108:1315-1320.[CrossRef][Medline]
10. Hecht, A., and M. Grunstein. 1999. Mapping DNA interaction sites of chromosomal proteins using immunoprecipitation and polymerase chain reaction. Methods Enzymol. 304:399-414.[Medline]
11. Hobbs, H. H., and D. J. Rader. 1999. ABC1: connecting yellow tonsils, neuropathy, and very low HDL. J. Clin. Investig. 104:1015-1017.[Medline]
12. Hörlein, A. J., A. M. Näär, T. Heinzel, J. Torchia, B. Gloss, R. Kurokawa, A. Ryan, Y. Kamei, M. Söderström, C. K. Glass, and M. G. Rosenfeld. 1995. Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature 377:397-404.[CrossRef][Medline]
13. Janowski, B. A., P. J. Willy, T. R. Devi, J. R. Falck, and D. J. Mangelsdorf. 1996. An oxysterol signalling pathway mediated by the nuclear receptor LXR
. Nature 383:728-731.[CrossRef][Medline]
14. Jepsen, K., O. Hermannson, O. Thandi, A. Gleiberman, V. Lunyak, R. Kurokawa, V. Kumar, F. Liu, E. Seto, S. Hedrick, G. Mandel, C. Glass, D. Rose, and M. Rosenfeld. 2000. Combinatorial roles of the nuclear receptor corepressor in transcription and development. Cell 102:753-763.[CrossRef][Medline]
15. Joseph, S. B., E. McKilligin, L. Pei, M. A. Watson, A. R. Collins, B. A. Laffitte, M. Chen, G. Noh, J. Goodman, G. N. Hagger, J. Tran, T. K. Tippin, X. Wang, A. J. Lusis, W. A. Hsueh, R. E. Law, J. L. Collins, T. M. Willson, and P. Tontonoz. 2002. Synthetic LXR ligand inhibits the development of atherosclerosis in mice. Proc. Natl. Acad. Sci. USA 99:7604-7609.
16. Klucken, J., C. Buchler, E. Orso, W. E. Kaminski, M. Porsch-Ozcurumez, G. Liebisch, M. Kapinsky, W. Diederich, W. Drobnik, M. Dean, R. Allikmets, and G. Schmitz. 2000. ABCG1 (ABC8), the human homolog of the Drosophila white gene, is a regulator of macrophage cholesterol and phospholipid transport. Proc. Natl. Acad. Sci. USA 97:817-822.
17. Laffitte, B. A., J. J. Repa, S. B. Joseph, D. C. Wilpitz, H. R. Kast, D. J. Mangelsdorf, and P. Tontonoz. 2001. LXRs control lipid-inducible expression of the apolipoprotein E gene in macrophages and adipocytes. Proc. Natl. Acad. Sci. USA 98:507-512.
18. Lawn, R. M., D. P. Wade, M. R. Garvin, X. Wang, K. Schwartz, J. G. Porter, J. J. Seilhamer, A. M. Vaughan, and J. F. Oram. 1999. The Tangier disease gene product ABC1 controls the cellular apolipoprotein-mediated lipid removal pathway. J. Clin. Investig. 104:R25-R31.
19. Lee, M.-H., K. Lu, S. Hazard, H. Yu, S. Shulenin, H. Hidaka, H. Kojima, R. Allikmets, N. Sakuma, R. Pegoraro, A. K. Srivastava, G. Salen, M. Dean, and S. B. Patel. 2001. Identification of a gene, ABCG5, important in the regulation of dietary cholesterol absorption. Nat. Genet. 27:79-83.[Medline]
20. Lehmann, J. M., S. A. Kliewer, L. B. Moore, T. A. Smith-Oliver, B. B. Oliver, J. L. Su, S. S. Sundseth, D. A. Winegar, D. E. Blanchard, T. A. Spencer, and T. M. Willson. 1997. Activation of the nuclear receptor LXR by oxysterols defines a new hormone response pathway. J. Biol. Chem. 272:3137-3140.
21. Linton, M. F., J. B. Atkinson, and S. Fazio. 1995. Prevention of atherosclerosis in apolipoprotein E-deficient mice by bone marrow transplantation. Science 267:1034-1037.
22. McKenna, N. J., and B. W. O'Malley. 2002. Combinatorial control of gene expression by nuclear receptors and coregulators. Cell 108:465-474.[CrossRef][Medline]
23. McNeish, J., R. J. Aiello, D. Guyot, T. Turi, C. Gabel, C. Aldinger, K. L. Hoppe, M. L. Roach, L. J. Royer, J. de Wet, C. Broccardo, G. Chimini, and O. L. Francone. 2000. High density lipoprotein deficiency and foam cell accumulation in mice with targeted disruption of ATP-binding cassette transporter-1. Proc. Natl. Acad. Sci. USA 97:4245-4250.
24. Muscat, G. E., B. L. Wagner, J. Hou, R. K. Tangirala, E. D. Bischoff, P. Rohde, M. Petrowski, J. Li, G. Shao, G. Macondray, and I. G. Schulman. 2002. Regulation of cholesterol homeostasis and lipid metabolism in skeletal muscle by liver X receptors. J. Biol. Chem. 277:40722-40728.
25. Peet, D. J., S. D. Turley, W. Ma, B. A. Janowski, J.-M. A. Lobaccaro, R. E. Hammer, and D. J. Mangelsdorf. 1998. Cholesterol and bile acid metabolism are impaired in mice lacking the nuclear oxysterol receptor LXR
. Cell 93:693-704.[CrossRef][Medline]
26. Qiu, Y., L. Cavelier, S. Chiu, X. Yang, E. Rubin, and J. F. Cheng. 2001. Human and mouse ABCA1 comparative sequencing and transgenesis studies revealing novel regulatory sequences. Genomics 73:66-76.[CrossRef][Medline]
27. Repa, J. J., K. E. Berge, C. Pomajzl, J. A. Richardson, H. Hobbs, and D. J. Mangelsdorf. 2002. Regulation of ATP-binding cassette sterol transporters ABCG5 and ABCG8 by the liver X receptors
and ß. J. Biol. Chem. 277:18793-18800.
28. Repa, J. J., G. Liang, J. Ou, Y. Bashmakov, J.-M. A. Lobaccaro, I. Shimomura, B. Shan, M. S. Brown, J. L. Goldstein, and D. J. Mangelsdorf. 2000. Regulation of mouse sterol regulatory element-binding protein-1c (SREBP-1c) by oxysterol receptors LXR
and LXRß. Genes Dev. 14:2819-2830.
29. Repa, J. J., S. D. Turley, J. A. Lobaccaro, J. Medina, L. Li, K. Lustig, B. Shan, R. A. Heyman, J. M. Dietschy, and D. J. Mangelsdorf. 2000. Regulation of absorption and ABC1-mediated efflux of cholesterol by RXR heterodimers. Science 289:1524-1529.
30. Rosenfeld, M. G., and C. K. Glass. 2001. Coregulator codes of transcriptional regulation by nuclear receptors. J. Biol. Chem. 276:36865-36868.
31. Santamarina-Fojo, S., K. Peterson, C. Knapper, Y. Qiu, L. Freeman, J. F. Cheng, J. Osorio, A. Remaley, X. P. Yang, C. Haudenschild, C. Prades, G. Chimini, E. Blackmon, T. Francois, N. Duverger, E. M. Rubin, M. Rosier, P. Denefle, D. S. Fredrickson, and H. B. Brewer, Jr. 2000. Complete genomic sequence of the human ABCA1 gene: analysis of the human and mouse ATP-binding cassette A promoter. Proc. Natl. Acad. Sci. USA 97:79877992.
32. Schreiber, E., P. Matthias, M. M. Muller, and W. Schaffner. 1989. Rapid detection of octamer binding proteins with 'mini-extracts', prepared from a small number of cells. Nucleic Acids Res. 17:6419.
33. Schultz, J. R., H. Tu, A. Luk, J. J. Repa, J. C. Medina, L. Li, S. Schwendner, S. Wang, M. Thoolen, D. J. Mangelsdorf, K. D. Lustig, and B. Shan. 2000. Role of LXRs in control of lipogenesis. Genes Dev. 14:2831-2838.
34. Schwartz K., R. M. Lawn, D. P. Wade. 2000. ABC1 gene expression and ApoA-I-mediated cholesterol efflux are regulated by LXR. Biochem. Biophys. Res. Commun. 274:794-802.[CrossRef][Medline]
35. Shang, Y., and M. Brown. 2002. Molecular determinants for the tissue specificity of SERMs. Science 295:2465-2468.
36. Tall, A. R., and N. Wang. 2000. Tangier disease as a test of the reverse cholesterol transport hypothesis. J. Clin. Investig. 106:1205-1207.[Medline]
37. Tangirala, R. K., E. D. Bischoff, S. B. Joseph, B. L. Wagner, R. Walczak, B. A. Laffitte, C. L. Daige, D. Thomas, R. A. Heyman, D. J. Mangelsdorf, X. Wang, A. J. Lusis, P. Tontonoz, and I. G. Schulman. 2002. Identification of macrophage liver X receptors as inhibitors of atherosclerosis. Proc. Natl. Acad. Sci. USA 99:11896-11901.
38. Valledor, A. F., J. Xaus, L. Marques, and A. Celada. 1999. Macrophage colony-stimulating factor induces the expression of mitogen-activated protein kinase phosphatase-1 through a protein kinase C-dependent pathway. J. Immunol. 163:2452-2462.
39. Venkateswaran, A., B. A. Laffitte, S. B. Joseph, P. A. Mak, D. C. Wilpitz, P. A. Edward, and P. Tontonoz. 2000. Control of cellular cholesterol efflux by the nuclear oxysterol receptor LXR
. Proc. Natl. Acad. Sci. USA 97:12097-12102.
40. Venkateswaran, A., J. J. Repa, J. M. Lobaccaro, A. Bronson, D. J. Mangelsdorf, and P. A. Edwards. 2000. Human white/murine ABC8 mRNA levels are highly induced in lipid-loaded macrophages. A transcriptional role for specific oxysterols. J. Biol. Chem. 275:14700-14707.
41. Yang, X-P., L. A. Freeman, C. L. Knapper, M. J. A. Amar, A. Remaley, H. B. Brewer, Jr., and S. Santamarina-Fojo. 2002. The E-box motif in the proximal ABCA1 promoter mediates transcriptional repression of the ABCA1 gene. J. Lipid Res. 43:297-306.
42. Yu, L., J. Li-Hawkins, R. E. Hammer, K. E. Berge, J. D. Horton, J. C. Cohen, and H. H. Hobbs. 2002. Overexpression of ABCG5 and ABCG8 promotes biliary cholesterol secretion and reduces fractional absorption of dietary cholesterol. J. Clin. Investig. 110:671-680.[CrossRef][Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||