MCB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Waggoner, S. A.
Right arrow Articles by Liebhaber, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Waggoner, S. A.
Right arrow Articles by Liebhaber, S. A.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, October 2003, p. 7055-7067, Vol. 23, No. 19
0270-7306/03/$08.00+0     DOI: 10.1128/MCB.23.19.7055-7067.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Identification of mRNAs Associated with {alpha}CP2-Containing RNP Complexes

Shelly A. Waggoner and Stephen A. Liebhaber*

Departments of Genetics and Medicine, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104

Received 12 March 2003/ Returned for modification 10 June 2003/ Accepted 1 July 2003


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Posttranscriptional controls in higher eukaryotes are central to cell differentiation and developmental programs. These controls reflect sequence-specific interactions of mRNAs with one or more RNA binding proteins. The {alpha}-globin poly(C) binding proteins ({alpha}CPs) comprise a highly abundant subset of K homology (KH) domain RNA binding proteins and have a characteristic preference for binding single-stranded C-rich motifs. {alpha}CPs have been implicated in translation control and stabilization of multiple cellular and viral mRNAs. To explore the full contribution of {alpha}CPs to cell function, we have identified a set of mRNAs that associate in vivo with the major {alpha}CP2 isoforms. One hundred sixty mRNA species were consistently identified in three independent analyses of {alpha}CP2-RNP complexes immunopurified from a human hematopoietic cell line (K562). These mRNAs could be grouped into subsets encoding cytoskeletal components, transcription factors, proto-oncogenes, and cell signaling factors. Two mRNAs were linked to ceroid lipofuscinosis, indicating a potential role for {alpha}CP2 in this infantile neurodegenerative disease. Surprisingly, {alpha}CP2 mRNA itself was represented in {alpha}CP2-RNP complexes, suggesting autoregulatory control of {alpha}CP2 expression. In vitro analyses of representative target mRNAs confirmed direct binding of {alpha}CP2 within their 3' untranslated regions. These data expand the list of mRNAs that associate with {alpha}CP2 in vivo and establish a foundation for modeling its role in coordinating pathways of posttranscriptional gene regulation.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Programs of gene expression in eukaryotic cells are coordinated at multiple levels. A significant component of these controls is mediated by posttranscriptional mechanisms. Processing, transport, localization, stability, and translation of an mRNA are often controlled via sequence-specific interactions with RNA binding proteins. Most of these interactions are discovered in the course of exploring specific pathways of gene regulation. Such gene-specific discovery approaches, while highly informative, are not able to focus on the wider impact of particular RNA binding proteins on cell function. A complementary approach that can more effectively address this question would involve the identification of the full spectrum of mRNA targets for a particular RNA binding protein (46). Such an approach would set the stage for constructing an integrated view of how particular RNA binding proteins contribute to coordination of gene expression profiles (21).

Limited examples of coordinate control by RNA binding proteins can be cited from the literature. An initial example is represented by the iron response element binding protein (8). This iron-binding protein can reversibly block translation of ferritin mRNA via 5' untranslated region (UTR) binding and reversibly stabilize transferrin receptor mRNA via 3' UTR binding. These distinct actions of the iron response element binding protein coordinate an integrated cellular response to intracellular iron levels. By defining the full-spectrum target mRNAs for specific RNA binding proteins, it may be possible to define even more complex posttranscriptional control networks. Recent examples are the identification of subsets of mRNAs bound by the K homology (KH)-domain fragile X mental retardation protein (5) and segregation of nuclear mRNAs into distinct sets of RNPs during nuclear-cytoplasmic export (17). The concept of coordinate control of multiple genes by RNA-binding proteins has been recently proposed in terms of posttranscriptional operons (21).

The {alpha}-globin poly(C) binding proteins ({alpha}CPs), also known as hnRNP E (34) or poly(C) binding proteins (PCBP) (1, 23, 24), comprise a family of highly abundant and widely expressed RNA binding proteins. Multiple {alpha}CP isoforms are encoded by four dispersed paralogous loci (29, 31, 32, 48). The two most abundant and widely expressed of these proteins, {alpha}CP2 and {alpha}CP2-KL, are encoded by alternative splicing of the {alpha}CP2 transcript (10). {alpha}CPs are conserved across several genera: orthologues of {alpha}CPs are found in Xenopus laevis, Drosophila melanogaster, Caenorhabditis elegans, and Saccharomyces cerevisiae (32). The abundant expression, widespread tissue distribution (24, 29, 31), and evolutionary conservation of {alpha}CPs suggest that they serve fundamental functions.

Each {alpha}CP isoform contains a characteristic triple repeat of the 70-amino-acid heteronuclear ribonucleoprotein (hnRNP) KH domain. The KH domain is common to a wide spectrum of RNA binding proteins (13) and can interact via a molecular vise with four to five contiguous bases in a target RNA (25, 26). Since KH domains can interact independently with RNA sequences, arrays of such motifs in a protein can generate substantial complexity and specificity of RNA interactions.

{alpha}CPs have a characteristic preference for binding to single-stranded C-rich motifs, and binding to these elements has been linked to a number of posttranscriptional controls (2, 12, 35, 36, 38, 45, 52, 53). The initial function defined for {alpha}CPs was stabilization of human {alpha}2-globin ({alpha}-globin) mRNA (6, 23, 52, 53) via binding to a 3' UTR C-rich motif (52). {alpha}CP1 and {alpha}CP2 have also been linked to stabilization of {alpha}1(I) collagen and tyrosine hydroxylase mRNAs via interacting with respective C-rich 3' UTR motifs (38, 45). Based on these and other studies (9, 55), it has been proposed that the complex between {alpha}CP and the cis-acting stability elements, referred to as the {alpha}-complex (52), constitutes a general determinant of high-level mRNA stability (18).

In addition to its role in mRNA stabilization, {alpha}CP also functions in a range of translation controls. Binding of {alpha}CP1 and hnRNP K to the 3' UTR of 15-lipoxygenase mRNA maintains the mRNA in a translationally silent state until the final stages of erythroid differentiation (35). {alpha}CP2-mediated translational control also appears to be involved in the pathological block in CCAAT/enhancer binding protein {alpha} (c/EBP{alpha}) expression in myelogenous leukemia via binding to a C-rich intercistronic motif (39). {alpha}CPs can also facilitate translation of cellular mRNAs. For example, translational activation is mediated by binding of {alpha}CP to the 5' UTR of the folate receptor {alpha} mRNA (54) and binding to a 3' UTR C-rich motif in the phosphatase 2A mRNA (36). {alpha}CPs bind to several viral mRNAs, and the corresponding RNP complexes are involved in many aspects of the viral life cycle (3, 4, 7, 11, 12, 14, 16, 33, 37, 44, 51). Several of these studies indicate that functional interactions may be specific for particular {alpha}CP isoforms, may work in conjunction with additional RNA binding proteins, and may be impacted by cellular differentiation (7, 35).

Five mRNAs have been identified in a screen for {alpha}CP1 binding targets: mitochondrial NADH dehydrogenase subunit 3, mitochondrial cytochrome c oxidase subunit II (coxII), ribosomal protein of the large subunit (L27a), palmitoylated erythrocyte membrane protein p55, manganese superoxide dismutase, and the CD81 receptor (TAPA-1) (49). The mRNAs encoding TAPA-1 and coxII were further shown to contain {alpha}CP1 binding sites in the 3' UTRs by in vitro binding assays. It is unknown whether these mRNAs constitute {alpha}CP1 binding targets in vivo, and the function of these {alpha}CP1-RNP complexes remains undefined.

The variety of {alpha}CP targets and control mechanisms suggests that the {alpha}CP-RNP complexes play significant and multifaceted roles in gene expression. Identification of additional mRNA targets would facilitate further exploration of this potential. In this study, we have attempted to identify a spectrum of in vivo binding targets of the major {alpha}CP2 isoforms by microarray analysis of immunopurified cytoplasmic {alpha}CP2-RNPs. Three independent studies revealed that 160 mRNAs were specifically and reproducibly present in the {alpha}CP2-RNP complexes. These data expand the list of {alpha}CP2 binding mRNAs and suggest targets for subsequent studies of potential coordinated cell functions.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Preparation of cytoplasmic extracts. Extracts were prepared (20) from logarithmically growing (0.5 x 106 to 1.0 x 106 cells/ml) K562 cells (ATCC no. CCL-243) grown under standard conditions. Cells were harvested by centrifugation at 258 x g for 5 min at 4°C, washed with 150 packed cell volumes (pcv) of phosphate-buffered saline (PBS) (Invitrogen) and washed again in 2 pcv of PBS. After sedimentation at 157 x g for 5 min at 4°C, the pellets were resuspended in 3.1 pcv of extraction buffer (15 mM Tris HCl [pH 7.4], 15 mM MgCl2, 150 mM NaCl, and 0.65% Igepal). The lysate was incubated on ice for 10 min with shaking and centrifuged at 11,750 x g for 10 min at 4°C. The cytoplasmic lysate was supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF) (Sigma), 3 µg of leupeptin/ml (Roche), 1 µg of aprotinin/ml (Sigma), and 13% glycerol and was stored at -80°C.

RNP IP. Protein A-Sepharose (PAS) (Amersham) was washed three times in PBS (Invitrogen) at room temperature. Two hundred microliters of a 50% slurry of PAS and PBS was incubated with 5 µl of FF3 (anti-{alpha}CP2 and {alpha}CP2-KL) or anti-c-myc (Santa Cruz) antibodies in the presence of 0.35 U of anti-RNase/µl (Ambion) in PBS in a volume of 1.0 ml. The FF3 immunoprecipitates (IPs) are referred to as anti-{alpha}CP2, and the c-myc IPs are referred to as control. The mixtures were incubated for 1 h at 4°C, and the PAS was washed once with PBS. The K562 cytoplasmic extract (2.1 mg/IP) was centrifuged at 11,750 x g for 10 min at 4°C. The supernatant was diluted fourfold in binding buffer (BB) (20 mM HEPES [pH 7.9] and 150 mM NaCl) containing 0.05% Triton X-100. Anti-RNase (Ambion) was added to 0.15 U/µl. This extract was added to the PAS, incubated for 1 h at 4°C, and washed twice in BB containing 0.05% Triton X-100, followed by two washes in BB containing 1% Triton X-100. The PAS was resuspended in BB containing 0.05% Triton X-100, and the suspension was transferred to a fresh tube. The PAS was pelleted and resuspended in elution buffer (100 mM Tris-HCl [pH 7.4], 12.5 mM EDTA, 150 mM NaCl, and 1% sodium dodecyl sulfate [SDS]). The mixture was incubated for 3 min at 100°C, phenol extracted, ethanol precipitated with glycogen (20 µg; Boehringer), and resuspended in 20 µl of H2O.

Reverse transcription-PCR. Copurified RNA (1.5 µl) was incubated with 1 pmol of reverse primer (listed in Table 1), 1 mM each dNTPs, 2.5 U of anti-RNase (Ambion), 50 U of Moloney murine leukemia virus reverse transcriptase (Promega), and 1x Moloney murine leukemia virus reverse transcription (RT) buffer (Promega) in a volume of 12.5 µl. After incubation at 37°C for 1 h, the samples were used as a template for PCR. The PCR primers are listed in Table 1. The forward primer (8 pmol) was end labeled by incubation with 5 µl of [{gamma}-32P]rATP (6,000 Ci/mmol), 1x forward reaction buffer (Gibco), and 10 U of T4 polynucleotide kinase (Gibco) for 30 min at 37°C and at 65°C for 10 min. The PCRs included 5 µl of the RT product, 0.2 mM dNTPs, 1.5 mM MgCl2, 2.5 µl of the labeled primer, 2.5 µg of each primer, 0.25 U of AmpliTaq (Perkin Elmer), and 1x PCR buffer II (Perkin Elmer). Thermocycler conditions were 95°C for 3 min followed by 30 cycles of 95°C for 1 min, 52°C for 1 min, and 72°C for 1 min followed by a final cycle of 72°C for 10 min. Samples were visualized by 5% polyacrylamide gel electrophoresis (PAGE) and quantified by the PhosphorImager (ImageQuant; Molecular Dynamics).


View this table:
[in this window]
[in a new window]
 
TABLE 1. RT-PCR primers

 
Amplification of antisense mRNA probes. The copurified RNA was amplified as described previously (40) with modifications. One hundred picomoles of T7-oligo(dT)24 primer (Affymetrix sequence; GenSet Oligos) was added to the RNA. After heating at 70°C for 10 min and 42°C for 5 min, first-strand cDNA was synthesized using the SuperScript Choice kit (InVitrogen). Conditions consisted of 0.01 M dithiothreitol (DTT), 0.5 mM dNTPs, 10 U of Superscript II reverse transcriptase/µl and 1x first-strand buffer in a volume of 20 µl. After incubation at 42°C for 1 h, second-strand cDNA was synthesized with 0.2 mM dNTPs, 0.26 U of DNA polymerase I/µl, 0.013 U of RNaseH/µl, 0.07 U of DNA ligase/µl, and 1x second-strand buffer. The samples were incubated at 16°C for 2 h. T4 DNA polymerase was added (0.07 U/µl) and incubated for 10 min at 16°C. The product was phenol extracted followed by purification using a YM-50 filter (Millipore). Antisense mRNA was synthesized using the T7 MEGAscript kit (Ambion) and was extracted and purified on a YM-50 filter (Millipore). Random hexamers (2 µg; Amersham) were added, and the volume was adjusted to 20 µl. After incubation at 70°C for 10 min, on ice for 2 min, and at room temperature for 10 min, first-strand cDNA was synthesized using the SuperScript Choice kit (InVitrogen) in a volume of 40 µl. The samples were treated with 0.1 U of RNase H/µl, incubated at 37°C for 20 min and 94°C for 2 min, and placed on ice. T7-oligo(dT)24 primer was added (final concentration, 200 pmol) and incubated at 70°C for 5 min and then at 42°C for 10 min. Second-strand synthesis was performed as described above except that the volume was 300 µl and the DNA ligase was omitted. After incubation at 16°C for 2 h, the product was extracted and purified using a YM-50 filter (Millipore). This double-stranded (ds) cDNA was used in another RNA amplification by repeating the antisense mRNA and ds cDNA synthesis [i.e., with the first strand being primed by using random hexamers and second strand being primed by using the T7-oligo(dT)24]. The ds cDNA contained a T7 promoter followed by cDNA encoding the antisense mRNA of the copurified mRNA. This cDNA was then used as template to generate radiolabeled antisense mRNA to probe the slot blot or to generate biotinylated antisense mRNA to probe the microarray (see below).

In vitro RNA synthesis. 32P-labeled RNA for the slot blot hybridization was synthesized using the T7 MEGAshortscript kit (Ambion). The ds cDNA from the antisense mRNA amplification (see above) was used as a template. The final concentration of rATP, rGTP, and rUTP was 5.6 mM, and the final concentration of unlabeled rCTP was 0.08 mM. Three microliters of [{alpha}-32P]rCTP (400 Ci/mmol) was used per reaction. The RNA was purified using an RNAeasy column (Qiagen), and 3.3 x 106 cpm of probe was used per slot blot.

Biotinylated RNA probe for the microarray hybridization was synthesized using a BioArray high-yield RNA transcript labeling kit (Enzo). The ds cDNA from the antisense mRNA amplification (see above) was used as a template. The RNA was purified, quantified, and fragmented according to Affymetrix protocols. Equal masses of probe (7 to 12 µg/microarray for three studies) were used for each set of microarrays.

4-thio-rUTP RNA probes for the cross-linking studies were synthesized as described previously (50). Two micrograms of EcoRI-linearized pSP6-(Trx2 or SAP49 or {alpha}-Globin)3'UTRpolyA (see below) and 1 µg of pTRI-ß-actin-mouse (which generates ß-actin antisense RNA) (Ambion) were used as template. The Maxiscript SP6 kit (Ambion) was utilized with final concentrations of rUTP (0.5 mM), rCTP (12 µM), and 4-thio-rUTP (0.25 mM) and 2.6 µl of [{alpha}-32P]rCTP (3,000 Ci/mmol). The RNA was purified using an RNAeasy column (Qiagen), and 1.5 x 106 cpm of RNA was used per reaction.

RNA probes for the electrophoretic mobility shift assay (EMSA) studies were generated using the Maxiscript SP6 kit (Ambion) with 1 µg of EcoRI-linearized pSP6-(Trx2 or SAP49 or {alpha}-Globin)3'UTRpolyA, 0.5 µg of pTRI-ß-actin-mouse (Ambion), with a rCTP (12 µM) and 5 µl of [{alpha}-32P]rCTP (400 Ci/mmol). RNA was purified (RNAeasy; Qiagen), and 7 x 105 to 9 x 105 cpm of RNA was used in each EMSA.

Slot blot hybridization. Tenfold dilutions of plasmids (8 to 800 ng) containing the cDNAs encoding h{alpha}2-globin and ß-actin cDNA or PUC19 vector were diluted 100-fold in 0.4 M NaOH, transferred via slot blot vacuum manifold to Zetabind nylon (Cuno), and incubated in 0.4 M NaOH at room temperature for 5 min. The membrane was neutralized in 0.2x SSC (1x SSC is 150 mM NaCl and 15 mM sodium citrate)-0.2 M Tris (pH 7.5) at room temperature for 2 min and cross-linked in the UV Stratalinker 2400 (autocross-link) (Stratagene). The membrane was washed in 0.1x SSC-0.1% SDS at 65°C for 30 min and prehybridized in 0.5 M NaPO4 (pH 7.2), 7% SDS, 1% bovine serum albumin, and 0.1 mM EDTA at 65°C for 4 h. Then, 3.3 x 106 cpm was incubated with the membrane at 42°C overnight in a buffer of 5x SSC, 5x Denhardt's, 50% formamide and 1% SDS. After washing two times with 1x SSC-0.1% SDS at 42°C for 15 min and at 42°C for 30 min, the membranes were rinsed in 2x SSC and exposed to the PhosphorImager, and signals were quantified (ImageQuant; Molecular Dynamics).

Microarray hybridization and data analysis. The biotinylated cRNAs were hybridized to the Affymetrix human genome U95A microarrays at the MIT biopolymers lab. For each set of microarray experiments, an equal mass of antisense RNA was used as the probe. The image ("dat") files were analyzed using Microarray Suite (MAS) version 5.0 (Affymetrix). A comparison analysis was performed between the experimental {alpha}CP2 microarray and the baseline control microarray for each experiment. The comparison files for each of three independent experiments were compiled into a single Excel file. This file was sorted to include those mRNAs that were designated "present" (i.e., detected) by MAS and those which showed an enrichment in the {alpha}CP2 microarray relative to the control microarray. The cutoff value for enrichment was twofold. The signal log ratio value, which reflects the abundance of an mRNA, was averaged among the three independent microarray experiments for each mRNA. This average signal log ratio was used to calculate the fold enrichment according to equations from Affymetrix. These fold enrichment values were normalized to the fold enrichment value calculated for the {gamma}-globin mRNA negative control. The individual normalized fold change (INFC) for each independent microarray experiment and the averaged normalized fold change (Avg NFC) for all three studies are represented in Table 2. The ranking of the mRNAs is based on the Avg NFC value.


View this table:
[in this window]
[in a new window]
 
TABLE 2. mRNAs (160) enriched in the {alpha}CP2 immunoprecipitate relative to the control immunoprecipitate

 
Cloning of the Trx2 and SAP49 3' UTRs. The 3' UTRs of Trx2 and SAP49 were amplified using primers that contained HindIII or SacI sites (underlined), namely, 5'AAGCTTGCTGATTGGCTGACAAGCAGGG3' and 5'GAGCTCGACATTGCAGATGGTGCAGACCC3' (for Trx2) and 5'AAGCTTCAGTAAATTCACATTTTCCTTCC3' and 5'GAGCTCAAACAAGGAGTTTAGTTTTATTTTC3' (for SAP49). The templates for PCR were human I.M.A.G.E. clones 2446364 (Trx2) and 38675 (SAP49) from Research Genetics. The PCRs consisted of the following: 0.2 mM dNTPs, 1.5 mM MgCl2, 0.05 µg of each primer, 1x PCR Buffer II (Roche), 0.04 µg of template, and 1.25 U of AmpliTaq (Roche). The conditions were 95°C for 3 min; 20 cycles of 94°C for 1 min, 56°C (SAP 49) or 64°C (Trx2) for 1 min, and 72°C for 1 min; and 72°C for 10 min. Fragments were gel isolated using Qiaex II (Qiagen) and ligated into pGemT (Promega), and clones were verified by sequencing. Plasmids were digested with HindIII and SacI, and the fragments were purified and ligated into the same sites in pSP64polyA (Promega). The constructs contained an SP6 promoter linked to the cDNAs encoding Trx2 or SAP49 3' UTRs and a (dT-dA)30 cassette followed by an EcoRI site. These plasmids are named pSP6-(Trx2 or SAP49)3'UTRpolyA. The pSP6-{alpha}-Globin 3'UTRpolyA has the same structure described above, except that it contains the 3'UTR of {alpha}2-globin mRNA.

RNA binding studies. RNA EMSAs were carried out as described previously (6). UV cross-linking reactions were performed as described previously (50) with modifications. Thirty-five micrograms of the K562 extract was incubated in cross-linking buffer (8.5 mM HEPES [pH 7.4], 3.0 mM MgCl2, 27.0 mM KCl, and 1.0 mM DTT) with RNA (6 x 106 cpm; 90 nM) in the presence or absence of unlabeled competitor RNA. After irradiation and RNase digestion, the samples were immunoprecipitated with FF3 or control antibodies using the conditions described above for the RNP IP. The products were resolved by SDS-10% PAGE. Competition experiments were analyzed by the PhosphorImager and quantitated using ImageQuant (Molecular Dynamics).


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Verification of {alpha}CP-RNP IP: {alpha}-Globin mRNA interacts with {alpha}CP in vivo. An {alpha}CP2-RNP IP strategy was established to isolate and identify a set of mRNAs that interact in vivo with {alpha}CP2 and its major splice variant form, {alpha}CP2-KL. The K562 cell line was chosen for this analysis. This human erythroid cell line contains high levels of human {alpha}-globin and {gamma}-globin mRNAs which can serve as positive and negative controls, respectively, for the IP reaction; interaction of {alpha}-globin mRNA with {alpha}CP2 has been previously characterized in detail and has a defined biologic function (23), while {gamma}-globin mRNA lacks {alpha}CP binding sites (49). Native {alpha}CP2-RNP complexes were immunoprecipitated from K562 cytoplasmic extracts using an affinity-purified rabbit antiserum specific to the two predominant human {alpha}CP isoforms, {alpha}CP2 and {alpha}CP2-KL (anti-{alpha}CP2) (6). As a specificity control, a parallel set of IPs (control IP) was carried out using an unrelated rabbit antiserum. Rabbit anti-human c-myc was used for this purpose. Parameters were established to maximize the yield and the specificity of {alpha}CP2-RNP complex IP (see Materials and Methods). To assess this approach, the relative contents of {alpha}-globin or {gamma}-globin mRNAs were compared in the RNA isolated from the anti-{alpha}CP2 IP and the control IP by targeted RT-PCR (Fig. 1A). {alpha}-Globin mRNA was enriched by 100-fold in the {alpha}CP2-RNP IP (lane 1) compared to the control IP (lane 2). In contrast, the contents of {gamma}-globin mRNA in the two preparations were within twofold of each other (lane 3 versus lane 4). As {gamma}-globin mRNA does not interact with {alpha}CP, this ratio of {gamma}-globin in the two preparations establishes the background ratio for comparisons of enrichment in each study (see below). These data demonstrate robust enrichment of {alpha}-globin mRNA in the {alpha}CP2-RNP complexes and establish in vivo association of {alpha}-globin mRNA with {alpha}CP2 in K562 cells.



View larger version (40K):
[in this window]
[in a new window]
 
FIG. 1. Isolation of {alpha}CP2-RNP complexes. (A) {alpha}-Globin mRNA copurifies with {alpha}CP2-RNPs isolated from human erythroid (K562) cells. Targeted RT-PCR was carried out on RNA isolated from RNP complexes immunoprecipitated with antiserum specific to the major {alpha}CP2 isoforms, {alpha}CP2 and {alpha}CP2KL (anti-{alpha}CP2) (lanes 1 and 3). Analysis of mRNAs isolated from a control IP reaction was carried out in parallel (control) (lanes 2 and 4). Lanes 1 and 2 are targeted amplifications of {alpha}-globin mRNA, while lanes 3 and 4 are amplifications of {gamma}-globin mRNA. The autoradiograph was intentionally overexposed to reveal trace levels of {alpha}-globin mRNA present in the control lane (lane 2). The numbers on the left represent marker DNA fragments in base pairs. (B) Enriched representation of {alpha}-globin mRNA in immunoprecipitated {alpha}CP2-RNPs is maintained during probe amplification. cDNAs encoding actin, {alpha}-globin, or pUC19 vector sequences were applied to a nylon membrane (8, 80, and 800 ng/slot; see Materials and Methods). The membranes were hybridized with 32P antisense probes generated from unamplified total cellular RNA (Total K562) and from amplified mRNA isolated from control or anti-{alpha}CP2 IP reactions.

 
{alpha}-Globin mRNA enrichment in the {alpha}CP2-RNP preparation is maintained during antisense probe amplification. The optimized IP approach was applied to the identification of mRNAs present in {alpha}CP2-RNP complexes in K562 cells. To generate sufficient probe for a full set of microarray hybridizations, mRNAs copurified from each RNP preparation were cycled through an amplification protocol (see Materials and Methods). This protocol generates ds cDNAs that carry a T7 promoter. Subsequent in vitro transcription from this T7 promoter generates antisense probes complementary to the initial mRNA pools. To determine whether the representation of mRNAs in the {alpha}CP2-RNP complexes is maintained during the amplification procedure, radiolabeled antisense mRNA pools (see Materials and Methods) were used to probe a slot blot containing cDNAs encoding a set of control sequences: {alpha}-globin, ß-actin, or pUC19. ß-Actin represents an mRNA unassociated with {alpha}CP2, and pUC19 serves as a control for nonspecific hybridization. The results are shown in Fig. 1B. There was equivalent low-level hybridization to pUC19 sequences and to the ß-actin cDNA using probes derived from the anti-{alpha}CP2 and control IPs. In contrast, {alpha}-globin mRNA was enriched approximately 200-fold relative to the control IP and 55-fold relative to the unfractionated (total) K562 RNA pool. These data demonstrate that the amplification procedure maintains the enrichment of {alpha}-globin mRNA and support the validity of carrying out amplification of the RNAs prior to probe generation and microarray hybridization.

Microarray analysis of mRNA content in {alpha}CP2-RNPs isolated from K562 cells. Amplified ds cDNAs from the IP reactions were used as templates to generate biotinylated antisense probes for interrogation of Affymetrix human genome U95A microarrays (12,600 open reading frames). A comparison analysis using Microarray Suite software, version 5.0, was performed for each experiment; the {alpha}CP2 IP microarray hybridization was designated the experimental microarray, and the control IP microarray hybridization was designated the baseline microarray (see Materials and Methods). Three independent studies were carried out, beginning each time with fresh extract and IP and proceeding through microarray hybridizations (Fig. 2). The total number of mRNAs detected on the microarrays varied by 1.6- to 2-fold among the three independent hybridizations, as did the number of mRNAs that were scored as enriched in {alpha}CP2-RNP complexes. Comparison among the data sets revealed a cohort of 160 mRNAs that copurified (i.e., were twofold or more enriched) with {alpha}CP2-RNP complexes in all three experiments. These mRNAs were considered a maximally reliable set of in vivo {alpha}CP2-binding targets.



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 2. Summary of three independent microarray analyses of {alpha}CP2-associated mRNAs. Three independent studies were carried out to identify mRNAs associated with cytosolic {alpha}CP2-RNPs isolated from K562 cells. The total number of mRNAs detected in the {alpha}CP2-RNP IPs and the number of mRNAs enriched in each of the {alpha}CP2-RNP IPs (relative to the control IP) are shown. The percentages represent the quotient of identified mRNAs to total mRNAs represented on the microarray. The number of mRNAs that were enriched in all three microarray surveys is indicated in the lower box. These consistently detected mRNAs are individually listed in Table 2.

 
Identification and classification of the 160 mRNAs enriched in {alpha}CP2-RNPs. The 160 mRNAs that copurified with {alpha}CP2 in all three IP studies are displayed in Table 2. Each mRNA is identified by its Affymetrix identification number (Probeset I.D.), GenBank accession number, Avg NFC, and its rank in the enrichment profile (see Materials and Methods for determination of the Avg NFC and rank values). The Avg NFC ranged from 5 to 80. The INFC is also shown. Each mRNA was individually annotated by a database search, and the entire cohort of mRNAs was then organized into a series of subsets according to documented or putative functions. The functional assignments should be considered dynamic because several proteins have multiple functions and could have been assigned to alternative groups. Groups with more than three mRNAs are summarized in Fig. 3. These grouped mRNAs represent 50% of the full list of 160 mRNAs (see Table 2).



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 3. Major groupings of mRNAs enriched in the {alpha}CP2-RNP complexes. The number in parentheses below each category represents the number of mRNAs identified in the group. Note that {alpha}CP2 and NF{kappa}B are both represented twice on the microarray (see Table 2) but are counted only once in the grouping shown here.

 
The listing of 160 mRNAs represents a nonrandom set of mRNAs. This conclusion is based on the observation that there is no significant correlation between this list and the compilation of unfractionated mRNAs in the cell; of the 160 most abundant mRNAs in total unamplified K562 mRNA, only 7 were present in the {alpha}CP2-RNP enriched mRNA population, and of the 160 most abundant mRNAs observed in amplified total K562 RNA, only 6 were present on the list of {alpha}CP2-interacting mRNAs. Furthermore, inspection of the sequences of many of the 160 mRNAs revealed several potential {alpha}CP binding sites, defined as C- or CU-rich sequences (see above). The presence of {alpha}-globin mRNA in the {alpha}CP2-RNP mRNA cohort (rank no. 3) supports the validity of the IP-microarray screen. The mRNA with the greatest enrichment (80-fold) in the {alpha}CP2-RNP complexes encoded spliceosomal-associated protein 62 kDa (SAP62). Interestingly, another mRNA encoding a spliceosome-associated protein, SAP49, also ranked high on the list, at no. 20. Of note, {alpha}CP2 mRNA was present in this list as well; two distinct probe sets on the microarray represent {alpha}CP2, and both were enriched in the {alpha}CP2-RNP complexes, ranking at nos. 69 and 83. The mRNA encoding mitochondrial thioredoxin (Trx2) ranked at no. 60, and along with 5 other mRNAs, formed a group of mitochondrial enzymes. Of note, we specifically screened the list of 160 {alpha}CP2-RNP-associated mRNAs for mRNAs that have been previously proposed as {alpha}CP binding targets; only {alpha}-globin was found to be in common (see Discussion).

Confirmation of in vivo {alpha}CP2-RNP associations by targeted mRNA analysis. Ten mRNAs identified as enriched in the {alpha}CP2-RNP complexes by the microarray analysis were chosen for confirmatory studies. Anti-{alpha}CP2 or control IP reactions were carried out using fresh K562 extracts, and the copurified mRNAs were directly assayed without prior amplification (Fig. 4). The candidate mRNAs included {alpha}-globin, SAP62, SAP49, Trx2, {alpha}CP2, c-src, junD, a-raf-1, Cln2, and PPT2. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and {gamma}-globin mRNAs were assayed in parallel as negative controls. In each assay, the {alpha}-globin mRNA demonstrated robust enrichment in the {alpha}CP2-RNP population relative to the control IP (Fig. 4A to E, lanes 1 and 2, respectively). Each of the 10 mRNAs identified as enriched in {alpha}CP2-RNPs when assayed by microarray hybridization was confirmed to be enriched when independently assayed by targeted RT-PCR analysis of {alpha}CP2-RNP preparations. These 10 mRNAs encode SAP49 and Trx2 (Fig. 4A); {alpha}CP2, {alpha}CP2-KL, and SAP62 (Fig. 4B); the proto-oncoproteins c-src, junD, and a-raf-1 (Fig. 4C); and 2 mRNAs which encode factors linked to infantile neuronal ceroid lipofuscinosis, namely, Cln2 and PPT2 (15, 42) (Fig. 4D). CoxII was also tested for interaction with {alpha}CP2 by targeted RT-PCR (Fig. 4E). Even though it is not present on the microarray used in these studies, we wanted to assess whether this mRNA interacts with {alpha}CP2 because it has been shown previously to be a binding partner of {alpha}CP1 (49). Figure 4E shows that coxII mRNA is robustly associated with {alpha}CP2-RNPs. eIF3b mRNA was included in one of the studies as an example of an additional sequence on the microarray that was not enriched for in the {alpha}CP2-RNPs. Consistent with the microarray screen, the targeted analysis failed to demonstrate enrichment of this mRNA (data not shown). Taken together, the studies confirm the accuracy of the microarray screen for {alpha}CP2-associated mRNAs.



View larger version (65K):
[in this window]
[in a new window]
 
FIG. 4. Confirmation of microarray detection of mRNA enrichment in {alpha}CP2-RNP complexes by targeted analysis. Each of the mRNAs noted above the lanes was semiquantitatively assessed by RT-PCR of RNPs isolated with anti-{alpha}CP2 or control antisera. In each of the four studies, analysis of {alpha}-globin mRNA and {gamma}-globin mRNAs were included as positive and negative controls, respectively. Numbers on the left represent the migration of marker DNA fragments. (A) Analysis of SAP49, Trx2, and GAPDH mRNAs. In this study, GAPDH was included as an additional negative control. (B) Analysis of {alpha}CP2 and SAP62 mRNAs. The amplification of the {alpha}CP2 mRNA reveals two major bands representing mRNAs encoding {alpha}CP2 and {alpha}CP2-KL. (C) Analysis of three proto-oncoprotein-encoding mRNAs, c-src, junD, and a-raf-1. (D) Analysis of two mRNAs associated with infantile neuronal ceroid lipofuscinosis, Cln2 and PPT2. (E) Analysis of coxII mRNA.

 
The 3' UTRs of SAP49 and Trx2 mRNAs contain {alpha}CP2 binding sites. SAP49 and Trx2 mRNAs were chosen as representatives for further analysis of {alpha}CP2 interactions. The specific question was whether the noted in vivo association of these mRNAs with {alpha}CP2-RNPs reflected direct binding by {alpha}CP2. The focus on 3' UTR interactions was based on the precedent of documented functional interactions between {alpha}CPs and 3' UTRs of other cellular mRNAs (see above). In cases where {alpha}CP binding sites have been defined, they contain short patches of C- or CU-rich sequences (2, 12, 35, 36, 38, 45, 52, 53) that are sometimes repeated multiple times (35). Examination of the 3' UTR of SAP49 reveals 12 potential {alpha}CP binding sites defined as a stretch of C's or U's of more than five nucleotides. The Trx2 3' UTR also contains several CU-rich regions, including four CCCUUCC and three CCUCC repeats that are potential {alpha}CP binding sites. The ability of the 3' UTRs of SAP49 and Trx2 to bind cytoplasmic proteins derived from K562 cells was tested in vitro by EMSA. The 3' UTR of {alpha}-globin mRNA and an actin ß-antisense transcript were included as positive and negative controls, respectively (Fig. 5A). The 3' UTR of SAP49 formed three complexes (designated A, B, and C) with the K562 extract. The Trx2 and {alpha}-globin 3' UTRs each formed two complexes (designated A and C) with the K562 extract. Complexes A and C were of similar sizes for the three probes (compare lanes 4, 6, and 8) and were specifically absent in the actin antisense RNA incubation (lane 2). Homoribopolymer competition was performed to further test for the presence of {alpha}CP in the SAP49 3' UTR complexes (Fig. 5B). Unlabeled poly(C) competed efficiently and selectively for the fastest complex (complex A) (compare lane 2 with lanes 3 to 5), completely competing even at the lowest concentration of poly(C) tested (10-fold molar excess over the UTR probe [lane 3]). Of note, the migration position of complex A is identical to the previously characterized {alpha}-complex formed between {alpha}CP and {alpha}-globin mRNA (6). In contrast, the other three homoribopolymers had less pronounced effects (lanes 6 to 14). The selective and marked sensitivity of complex A to poly(C) supports the conclusion that the SAP49 3' UTR can directly bind {alpha}CP (for further evidence, see below).



View larger version (43K):
[in this window]
[in a new window]
 
FIG. 5. The 3' UTRs of SAP49 and Trx2 mRNAs bind directly and specifically to {alpha}CP2. (A) RNA EMSA analysis. 32P-labeled RNAs corresponding to the four RNAs indicated at the top of the figure were incubated with K562 extract (Probe + Extract) or without K562 extract ([32P]UTR Probes) as indicated. Three observed RNP complexes are referred to as A, B, or C. ß-Actin antisense (ActAS) and {alpha}-globin RNAs served as negative and positive controls, respectively. (B) EMSA analysis of the SAP49 3' UTR in the presence of unlabeled homoribopolymer competitors. Triangles represent increasing amounts of competitor RNA used in the EMSA (10-, 100-, and 500-fold molar excess over the labeled probe). The competitor utilized is indicated above the triangles. (C) UV cross-linking of cytoplasmic proteins to RNA sequences. The same four RNA sequences analyzed by EMSA in Fig. 5A were UV cross-linked to K562 extract and immunoprecipitated with anti-{alpha}CP2 or control sera. Numbers on the left represent the migration of marker proteins. The arrows to the right of the autoradiograph indicate the cross-linked products representing {alpha}CP2 and {alpha}CP2-KL.

 
The 3' UTRs of SAP49 and Trx2 are directly bound by {alpha}CP2. UV cross-linking studies were carried out to substantiate a direct interaction of {alpha}CP2 with the 3' UTRs of {alpha}CP2-RNP-enriched mRNAs. Radiolabeled and thiolated 3' UTRs corresponding to the SAP49 or Trx2 3' UTRs were UV cross-linked to K562 extract. The 3' UTR of {alpha}-globin mRNA and a ß-actin antisense transcript were labeled and analyzed in parallel as positive and negative controls, respectively. When the cross-linked products were analyzed by SDS-PAGE, four prominently labeled bands were generated (data not shown). These products appeared to represent nonspecific interactions based on the uniform patterns with the four transcripts and their sensitivity to competition by 18S rRNA. To visualize less abundant complexes that might represent {alpha}CP2 binding, the cross-linked products were immunoprecipitated with anti-{alpha}CP2 or control antisera (Fig. 5C). Two immunoprecipitated cross-linked products were observed with anti-{alpha}CP2 antisera, a 38-kDa band and a less intense 36-kDa band that is seen more clearly on longer exposures (data not shown). These two products (double arrow to the right of the gel) correspond to the sizes of the two major {alpha}CP2 isoforms, {alpha}CP2 and {alpha}CP2-KL. These complexes were detected only when the {alpha}-globin, SAP49, and Trx2 3' UTRs were used as probes in the cross-linking (lanes 4, 6, and 8); no immunoprecipitated cross-linked products were observed using the ß-actin antisense RNA (lanes 1 and 2). A series of cross-competition experiments using the 3' UTRs of Trx2 or SAP49 and human 18S rRNA confirmed that {alpha}CP2 specifically interacted with the Trx2 and SAP49 3' UTRs (data not shown). These studies support the conclusion that {alpha}CP2 can directly and specifically bind to the 3' UTRs of SAP49 and Trx2 mRNAs.


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have carried out a microarray analysis of human mRNAs present in a specific subset of cytosolic RNP complexes. These complexes are defined by the presence of {alpha}CP2 and {alpha}CP2-KL proteins (referred to collectively as {alpha}CP2) encoded at the PCBP-2 locus. Three independent analyses of the {alpha}CP2-RNPs reveal a consistent cohort of 160 mRNAs (Table 2). With the exception of {alpha}-globin mRNA, these mRNAs represent novel targets of {alpha}CP2 interaction. How {alpha}CP2-containing complexes factor into posttranscriptional controls and to what extent such controls might coordinate the expression of subgroups of these mRNAs are questions now open to study.

Several technical aspects and limitations of this approach need to be emphasized. First, the isolation of the {alpha}CP2-RNPs depends on IP. It is possible that additional {alpha}CP2-RNP complexes are present in the cell but are not recognized in this procedure due to constraints on protein accessibility and/or subsequent precipitation. Thus, the set of mRNAs identified in this study, while extensive, may not encompass all {alpha}CP2-mRNPs. Second, the U95A microarray used in this study contains 12,600 probe sets representing approximately 10,500 unique mRNAs. As current estimates of the number of structural genes in the human genome is in the range of 25,000 or more (28), it is possible that additional targets might be found on subsequent studies using more extensive arrays. Third, the present analysis was limited to cytosolic complexes. The possibility that {alpha}CP2 binds to additional transcripts in the nucleus is not presently addressed. Fourth, mRNA sequences from the immunoprecipitated RNPs were amplified in order to generate sufficient probe to interrogate a full microarray. While such a step might alter the representation or abundance of sequences in the population, the validity of utilizing amplified RNA probes is supported by prior reports (40) and was confirmed by a series of control experiments (Fig. 1). Finally, only mRNAs that were enriched (twofold or more) in all three studies were included in the compilation (Table 2). This represents a conservative cutoff. Thus, the 160 mRNAs identified in this report should be considered a reliable but not comprehensive representation of K562 mRNAs present in {alpha}CP2-RNP complexes.

It is recognized that the protein contents of the {alpha}CP2-RNP complexes are unlikely to be homogeneous in composition. Instead, some of these complexes may contain full-length {alpha}CP2, while others may contain the alternative-splice isoform, {alpha}CP2-KL. These differences in {alpha}CP isoform content may mediate distinct sets of protein-protein interactions, generating diverse macromolecular complexes with distinct functions. {alpha}CP2 may also be subject to posttranslational modifications that may regulate the function and/or composition of the complexes (24). Finally, the particular mRNA content of the complexes may dictate the protein composition of the RNP complex via allosteric effects on the binding protein, as has been established for certain protein-DNA interactions (42, 47).

Individual mRNAs identified in the {alpha}CP2-RNP complexes may be directly bound by {alpha}CP2, or alternatively, their association with {alpha}CP2 may be indirect. In the case of human {alpha}-globin mRNA, {alpha}CP is known to bind directly and uniquely to the C-rich motifs within the 3' UTR (19). However, it is possible that mRNAs identified in the present survey may be bound by distinct subsets of proteins that are coprecipitated with {alpha}CP2 as part of macromolecular {alpha}CP2-RNP complexes (22). In the limited sampling of the novel mRNAs associated with the {alpha}CP2-RNPs, direct interaction of the mRNA with {alpha}CP2 does, in fact, appear to be occurring (Fig. 5). Thus, for at least two of the novel {alpha}CP2 mRNPs identified in this study, the specific mRNA inclusion (Trx2 and SAP49) in the complex appears to reflect direct binding by {alpha}CP2 as determined for {alpha}-globin mRNA.

It is significant that {alpha}-globin mRNA was identified in the present screen of {alpha}CP2-RNPs and that it constituted the third-most enriched mRNA (Table 2). In contrast, {gamma}-globin mRNA, which is as abundant as {alpha}-globin mRNA in K562 cells, was not present in the enriched pool of mRNAs. This selective detection of {alpha}-globin mRNA supports the validity of the approach and confirms the association of {alpha}-globin mRNA with these complexes in the cell.

Prior to this study, 14 cellular mRNAs had been reported as targets for {alpha}CP interaction (see above). Only two of these mRNAs, {alpha}-globin and coxII, were identified in the present study. There are multiple reasons for the absence of the remaining mRNAs. mRNAs encoding {alpha}I(I) collagen, tyrosine hydroxylase, androgen receptor, 15-lipoxygenase mRNA, PP 2A {alpha}, folate receptor {alpha}, and erythropoietin are represented on the microarray but were not detected by analysis of total K562 mRNA and thus are probably not present in these cells. Likewise, c/EBP{alpha} mRNA, which is not represented on the microarray, could not be detected by targeted RT-PCR of total K562 mRNA (data not shown), consistent with a previous study which showed that this mRNA is not present in K562 cells (41). In contrast, TAPA-1 mRNA (see above) is detected in microarray analysis of total K562 RNA but is not enriched in the immunopurified {alpha}CP2-RNPs. This may reflect the fact that TAPA-1 was identified as a target of {alpha}CP1 by prior studies and may be specific to this isoform (49).

Coordination of posttranscriptional controls by particular RNA-binding proteins may occur at a number of steps. We have previously suggested that the {alpha}-complex may constitute a common determinant of high-level stability (18). The identification in the present survey of 160 mRNA targets of {alpha}CP2 can now be used to further test this premise. Fourteen of these mRNAs encode structural cytoskeletal components or proteins involved with cell motility. It is likely that these are long-lived mRNAs based on the premise that proteins that do not need to be acutely controlled are usually encoded by highly stable mRNAs (45). A second well-defined function of {alpha}CP is in translation control. Identifying whether any of the 160 cellular mRNAs are subject to this level of control would establish another provisional basis for potential coordination of gene expression by {alpha}CP2-RNP complexes.

mRNAs encoding 11 enzymes were present in the {alpha}CP2-RNP population. Two of these enzymes are linked to the pathogenesis of the neurodegenerative disorder infantile neuronal ceroid lipofuscinosis (15, 43). The identification of these two enzymes, lysosomal pepstatin-insensitive protease (Cln2) (rank no. 54) and palmitoyl-protein thioesterase 2 (PPT2) (rank no. 103), suggests that {alpha}CP2 might act as a modifier of phenotype in this disease by regulating the available levels of these two enzymes in a coordinate manner. It is also of note that 6 of the 20 total enzyme-encoding mRNAs in the {alpha}CP2-RNP population direct the synthesis of enzymes specific to the mitochondria. Two of the six mRNAs identified in an independent screen for {alpha}CP1-associated mRNAs also encoded mitochondrial localized proteins (49). These data suggest that {alpha}CPs may coordinate aspects of mitochondrial function or mRNA localization via posttranscriptional mechanisms.

Thirteen {alpha}CP2-associated mRNAs encode transcription factors. The potential involvement of {alpha}CP2 in transcription factor expression is consistent with a report showing that {alpha}CP2 regulates translation of the mRNA encoding the transcription factor, c/EBP{alpha} (39). It is also of interest that JunD mRNA is enriched in the {alpha}CP2-RNPs. Expression of JunD is regulated at the posttranscriptional level (27) by alterations in mRNA stability in response to cellular levels of polyamines. The association of {alpha}CP2 with JunD mRNA in the present study establishes a testable model in which {alpha}CP2 may play a role in this process. Thus, both translation and stability controls may be in play via {alpha}CP2 association with transcription factor mRNAs.

The presence of four mRNAs encoding interferon-inducible factors in the {alpha}CP2 RNPs is intriguing, as five different viruses have been reported to utilize {alpha}CP to regulate viral gene expression (see above). Since interferon is an antiviral agent, it is possible that these viruses have evolved structures that allow them to sequester {alpha}CP2 from these cellular mRNAs. For example, if {alpha}CP2 enhances the expression of specific interferon-inducible genes, sequestration of {alpha}CP2 by viral RNAs would inhibit the antiviral response while at the same time possibly enhancing their own expression (3, 4, 11, 12, 33, 51). The demonstration that expression of RNA decoys can block the functional interaction of {alpha}CPs with target RNAs in vivo supports several assumptions underlying this model (30).

A final note concerns {alpha}CP2 mRNA. The enrichment of {alpha}CP2 mRNA in {alpha}CP2-RNP complexes was confirmed by two separate probe sets on the microarray (Table 2) and substantiated by directed RT-PCR analysis (Fig. 4B). This association suggests that {alpha}CP2 expression may be subject to posttranscriptional autoregulation. A negative autoregulatory loop might mediate tight control over synthesis of the final {alpha}CP2 product, while a positive loop might amplify the expression of {alpha}CP2 in certain situations. Further mapping of this interaction and the corresponding mechanistic pathway(s) involved in the proposed autoregulation of {alpha}CP2 expression are of interest for further study.


    ACKNOWLEDGMENTS
 
This work was supported by NIH grants RO1 HL 65449 and PO1-CA72765 to S.A.L. The support of the Doris Duke Foundation is gratefully acknowledged. S.A.W is a recipient of an NRSA fellowship 5 F32 GM063396-02 from the National Institutes of Health.

We thank Gregg Johannes for critical reading of the manuscript and experimental advice.


    FOOTNOTES
 
* Corresponding author. Mailing address: Department of Genetics, University of Pennsylvania School of Medicine, Room 428, Clinical Research Building, 415 Curie Blvd., Philadelphia, PA 19104. Phone: (215) 898-7834. Fax: (215) 573-5157. E-mail: liebhabe{at}mail.med.upenn.edu. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Aasheim, H. C., T. Loukianova, A. Deggerdal, and E. B. Smeland. 1994. Tissue specific expression and cDNA structure of a human transcript encoding a nucleic acid binding [oligo(dC)] protein related to the pre-mRNA binding protein K. Nucleic Acids Res. 22:959-964.[Abstract/Free Full Text]

2. Andino, R., G. Rieckhof, P. L. Achacose, and D. Baltimore. 1993. Poliovirus RNA synthesis utilizes an RNP complex formed around the 5' end of viral RNA. EMBO J. 12:3587-3598.[Medline]

3. Blyn, L. B., K. M. Swiderek, O. Richards, D. C. Stahl, B. L. Semler, and E. Ehrenfeld. 1996. Poly(rC) binding protein 2 binds to stem-loop IV of the poliovirus RNA 5' noncoding region: identification by automated liquid chromatography-tandem mass spectrometry. Proc. Natl. Acad. Sci. USA 93:11115-11120.[Abstract/Free Full Text]

4. Blyn, L. B., J. S. Towner, B. L. Semler, and E. Ehrenfeld. 1997. Requirement of poly(rC) binding protein 2 for translation of poliovirus RNA. J. Virol. 8:6243-6246.

5. Brown, V., P. Jin, S. Ceman, J. C. Darnell, W. T. O'Donnell, S. A. Tenenbaum, X. Jin, Y. Feng, K. D. Wilkinson, J. D. Keene, R. B. Darnell, and S. T. Warren. 2001. Microarray identification of FMRP-associated brain mRNAs and altered mRNA translational profiles in fragile X syndrome. Cell 107:477-487.[CrossRef][Medline]

6. Chkheidze, A. N., D. L. Lyakhov, A. V. Makeyev, J. Morales, J. Kong, and S. A. Liebhaber. 1999. Assembly of the {alpha}-globin mRNA stability complex reflects binary interaction between the pyrimidine-rich 3' untranslated region determinant and poly(C) binding protein {alpha}CP. Mol. Cell. Biol. 19:4572-4581.[Abstract/Free Full Text]

7. Collier, B., L. Goobar-Larsson, M. Sokolowski, and S. Schwartz. 1998. Translational inhibition in vitro of human papillomavirus type 16 L2 mRNA mediated through interaction with heterogenous ribonucleoprotein K and poly(rC)-binding proteins 1 and 2. J. Biol. Chem. 273:22648-22656.[Abstract/Free Full Text]

8. Crichton, R. R., S. Wilmet, R. Legssyer, and R. J. Ward. 2002. Molecular and cellular mechanisms of iron homeostasis and toxicity in mammalian cells. J. Inorg. Biochem. 91:9-18.[CrossRef][Medline]

9. Czyzyk-Krzeska, M. F., and A. C. Bendixen. 1999. Identification of the poly(C) binding protein in the complex associated with the 3' untranslated region of erythropoietin messenger RNA. Blood 6:2111-2120.

10. Funke, B., R. Zuleger, R. Benavente, T. Schuster, M. Goller, J. Stevenin, and I. Horak. 1996. The mouse poly(C)-binding protein exists in multiple isoforms and interacts with several RNA-binding proteins. Nucleic Acids Res. 24:3821-3828.[Abstract/Free Full Text]

11. Gamarnik, A. V., and R. Andino. 1997. Two functional complexes formed by KH domain containing proteins with the 5' noncoding region of poliovirus RNA. RNA 3:882-892.[Abstract]

12. Gamarnik, A. V., and R. Andino. 2000. Interactions of viral protein 3CD and poly(rC) binding protein with the 5' untranslated region of the poliovirus genome. J. Virol. 74:2219-2226.[Abstract/Free Full Text]

13. Gibson, T. J., J. T. Thompson, and J. Heringa. 1993. The KH domain occurs in a diverse set of RNA-binding proteins that include the antiterminator NusA and is probably involved in binding to nucleic acid. FEBS Lett. 324:361-366.[CrossRef][Medline]

14. Graff, J., J. Cha, L. B. Blyn, and E. Ehrenfeld. 1998. Interaction of poly(rC) binding protein 2 with the 5' noncoding region of hepatitis A virus RNA and its effects on translation. J. Virol. 1998. 72:9668-9675.[Abstract/Free Full Text]

15. Gupta, P., A. A. Soyombo, A. Atashband, K. E. Wisniewski, J. M. Shelton, J. A. Richardson, R. E. Hammer, and S. L. Hofmann. 2001. Disruption of PPT1 or PPT2 causes neuronal ceroid lipofuscinosis in knockout mice. Proc. Natl. Acad. Sci. USA 98:13566-13571.[Abstract/Free Full Text]

16. Gutierrez-Escolano, A. L., Z. U. Brito, R. M. delAngel, and X. Jiang. 2000. Interaction of cellular proteins with the 5' end of Norwalk virus genomic RNA. J. Virol. 74:8558-8562.[Abstract/Free Full Text]

17. Hieronymus, H., and P. A. Silver. 2003. Genome-wide analysis of RNA-protein interactions illustrates specificity of the mRNA export machinery. Nat. Genet. 33:155-161.[CrossRef][Medline]

18. Holcik, M., and S. A. Liebhaber. 1997. Four highly stable eukaryotic mRNAs assemble 3' untranslated region RNA-protein complexes sharing cis and trans components. Proc. Natl. Acad. Sci. USA 94:2410-2414.[Abstract/Free Full Text]

19. Ji, X., J. Kong, and S. A. Liebhaber. 2003. In vivo association of the stability control protein {alpha}CP with actively translating mRNAs. Mol. Cell. Biol. 23:899-907.[Abstract/Free Full Text]

20. Johannes, G., and P. Sarnow. 1998. Cap-independent polysomal association of natural mRNAs encoding c-myc, BiP, and eIF4G conferred by internal ribosome entry sites. RNA 4:1500-1513.[Abstract]

21. Keene, J. D., and S. A. Tenenbaum. 2002. Eukaryotic mRNPs may represent posttranscriptional operons. Mol. Cell 9:1161-1167.[CrossRef][Medline]

22. Kiledjian, M., C. T. DeMaria, G. Brewer, and K. Novick. 1997. Identification of AUF1 (heterogeneous nuclear ribonucleoprotein D) as a component of the {alpha}-globin mRNA stability complex. Mol. Cell. Biol. 17:4870-4876.[Abstract]

23. Kiledjian, M., X. Wang, and S. A. Liebhaber. 1995. Identification of two KH domain proteins in the {alpha}-globin mRNP stability complex. EMBO J. 14:4357-4364.[Medline]

24. Leffers, H., K. Dejgaard, and J. E. Celis. 1995. Characterization of two major cellular poly(rC)-binding human proteins, each containing three K-homologous (KH) domains. Eur. J. Biochem. 230:447-453.[Medline]

25. Lewis, H. A., H. Chen, C. Edo, R. J. Buckanovich, Y. Y. L. Yang, K. Musunuru, R. Zhong, R. B. Darnell, and S. K. Burley. 1999. Crystal structures of Nova-1 and Nova-2-homology RNA-binding domains. Structure 7:191-203.[Medline]

26. Lewis, H. A., K. Musunuru, K. B. Jensen, C. Edo, H. Chen, R. B. Darnell, and S. K. Burley. 2000. Sequence-specific RNA binding by a Nova KH-domain: implications for paraneoplastic disease and the fragile X syndrome. Cell 100:323-332.[CrossRef][Medline]

27. Li, L., L. Liu, J. N. Rao, A. Esmaili, E. D. Strauch, B. L. Bass, and J. Y. Wang. 2002. JunD stabilization results in inhibition of normal intestinal epithelial cell growth through P21 after polyamine depletion. Gastroenterology 123:764-769.[CrossRef][Medline]

28. Makalowski, W. 2001. The human genome structure and organization. Acta Biochim. Pol. 48:587-598.[Medline]

29. Makeyev, A. V., A. N. Chkheidze, and S. A. Liebhaber. 1999. A set of highly conserved RNA-binding proteins, alphaCP-1 and alphaCP-2, implicated in mRNA stabilization, are coexpressed from an intronless gene and its intron-containing paralog. J. Biol. Chem. 35:24849-24857.

30. Makeyev, A. V., D. Eastmond, and S. A. Liebhaber. 2002. Targeting a KH-domain protein with RNA decoys. RNA 8:1160-1173.[Abstract]

31. Makeyev, A. V., and S. A. Liebhaber. 2000. Identification of two novel mammalian genes establishes a subfamily of KH-domain RNA-binding proteins. Genomics 67:301-316.[CrossRef][Medline]

32. Makeyev, A. V., and S. A. Liebhaber. 2002. The poly(C)-binding proteins: a multiplicity of functions and a search for mechanisms. RNA 8:265-278.[Abstract]

33. Murray, K. E., A. W. Roberts, and D. J. Barton. 2001. Poly(rC) binding proteins mediate poliovirus mRNA stability. RNA 7:1126-1141.[Abstract]

34. Ostareck-Lederer, A., D. H. Ostareck, and M. W. Hentze. 1998. Cytoplasmic regulatory functions of the KH-domain proteins hnRNPs K and E1/E2. Trends Biochem. Sci. 23:409-411.[CrossRef][Medline]

35. Ostareck, D. H., A. Ostareck-Lederer, M. Wilm, B. J. Thiele, M. Mann, and M. W. Hentze. 1997. mRNA silencing in erythroid differentiation: hnRNP K and hnRNP E1 regulate 15-Lipoxygenase translation from the 3' end. Cell 89:597-606.[CrossRef][Medline]

36. Paillard, L., D. Maniey, P. Lachaume, V. H. Legagneux, and B. Osborne. 2000. Identification of a C-rich element as a novel cytoplasmic polyadenylation element in Xenopus embryos. Mech. Dev. 93:117-125.[CrossRef][Medline]

37. Parsley, T. B., J. S. Towner, L. B. Blyn, E. Ehrenfeld, and B. L. Semler. 1997. Poly (rC) binding protein 2 forms a ternary complex with the 5'-terminal sequences of poliovirus RNA and the viral 3CD proteinase. RNA 3:1124-1134.[Abstract]

38. Paulding, W. R., and M. F. Czyzyk-Krzeska. 1999. Regulation of tyrosine hydroxylase mRNA stability by protein-binding, pyrimidine-rich sequence in the 3'-untranslated region. J. Biol. Chem. 274:2532-2538.[Abstract/Free Full Text]

39. Perrotti, D., V. Cesi, R. Trotta, C. Guerzoni, G. Santilli, K. Campbell, A. Iervolino, F. Condorelli, C. Gambacorti-Passerini, M. A. Caligiuri, and B. Calabretta. 2002. BCR-ABL suppresses C/EBPalpha expression through inhibitory action of hnRNP E2. Nat. Genet. 30:48-58.[CrossRef][Medline]

40. Phillips, J., and J. H. Eberwine. 1996. Antisense RNA amplification: a linear amplification method for analyzing the mRNA population from single living cells. Methods 10:283-288.[CrossRef][Medline]

41. Radomska, H. S., C. S. Huettner, P. Zhang, T. Cheng, D. T. Scadden, and D. G. Tenen. 1998. CCAAT/enhancer binding protein {alpha} is a regulatory switch sufficient for induction of granulocytic development from bipotential myeloid progenitors. Mol. Cell. Biol. 18:4301-4314.[Abstract/Free Full Text]

42. Scully, K. M., E. M. Jacobson, K. Jepsen, V. Lunyak, H. Viadiu, C. Carriere, D. W. Rose, F. Hooshmand, A. K. Aggarwal, and M. G. Rosenfeld. 2000. Allosteric effects of Pit-1 DNA sites on long-term repression in cell type specification. Science 290:1127-1131.[Abstract/Free Full Text]

43. Sleat, D. E., R. J. Donnelly, H. Lackland, C. G. Liu, I. Sohar, R. K. Pullarkat, and P. Lobel. 1997. Association of mutations in a lysosomal protein with classical late-infantile neuronal ceroid lipofuscinosis. Science 277:1802-1805.[Abstract/Free Full Text]

44. Spangberg, K., and S. Schwartz. 1999. Poly(C)-binding protein interacts with the hepatitis C virus 5' untranslated region. J. Gen. Virol. 80:1371-1376.[Abstract]

45. Stefanovic, B., C. Hellerbrand, M. Holcik, M. Briendl, S. A. Liebhaber, and D. A. Brenner. 1997. Posttranscriptional regulation of collagen {alpha}1(I) mRNA in hepatic stellate cells. Mol. Cell. Biol. 17:5201-5209.[Abstract]

46. Tenenbaum, S. A., P. J. Lager, C. C. Carson, and J. D. Keene. 2002. Ribonomics: identifying mRNA subsets in mRNP complexes using antibodies to RNA-binding proteins and genomic arrays. Methods 26:191-198.[CrossRef][Medline]

47. Tomilin, A., A. Remenyi, K. Lins, H. Bak, S. Leidel, G. Vriend, M. Wilmanns, and H. R. Scholer. 2000. Synergism with the coactivator OBF-1 (OCA-B, BOB-1) is mediated by a specific POU dimer configuration. Cell 103:853-864.[CrossRef][Medline]

48. Tommerup, N., and H. Leffers. 1996. Assignment of human KH-box-containing genes by in situ hybridization: HNRNPK maps to 9q21.32-q21.33, PCBP1 to 2p12-p13, and PCBP2 to 12q13.12-q13.13, distal to FRA12A. Genomics 32:297-298.[CrossRef][Medline]

49. Trifillis, P., N. Day, and M. Kiledjian. 1999. Finding the right RNA: identification of cellular mRNA substrates for RNA-binding proteins. RNA 5:1071-1082.[Abstract]

50. Waggoner, S., and P. Sarnow. 1998. Viral ribonucleoprotein complex formation and nucleolar-cytoplasmic relocalization of nucleolin in poliovirus-infected cells. J. Virol. 72:6699-6709.[Abstract/Free Full Text]

51. Walter, B. L., J. H. C. Nguyen, E. Ehrenfeld, and B. Semler. 1999. Differential utilization of poly(rC) binding protein 2 in translation directed by picornavirus IRES elements. RNA 5:1570-1585.[Abstract]

52. Wang, X., M. Kiledjian, I. M. Weiss, and S. A. Liebhaber. 1995. Detection and characterization of a 3' untranslated region ribonucleoprotein complex associated with human {alpha}-globin mRNA stability. Mol