This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Trushin, S. A.
Right arrow Articles by Paya, C. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Trushin, S. A.
Right arrow Articles by Paya, C. V.

 Previous Article

Molecular and Cellular Biology, October 2003, p. 7068-7081, Vol. 23, No. 19
0270-7306/03/$08.00+0     DOI: 10.1128/MCB.23.19.7068-7081.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Protein Kinase C{alpha} (PKC{alpha}) Acts Upstream of PKC{theta} To Activate I{kappa}B Kinase and NF-{kappa}B in T Lymphocytes

Sergey A. Trushin,1 Kevin N. Pennington,1 Eva M. Carmona,1 Susana Asin,1 Doris N. Savoy,2 Daniel D. Billadeau,1,2 and Carlos V. Paya1,3*

Department of Immunology,1 Division of Infectious Diseases,3 Division of Developmental Oncology Research, Mayo Clinic, Rochester, Minnesota 559052

Received 11 October 2002/ Returned for modification 21 November 2002/ Accepted 20 June 2003


arrow
ABSTRACT
 
NF-{kappa}B is an ubiquitous transcription factor that is a key in the regulation of the immune response and inflammation. T-cell receptor (TCR) cross-linking leads to NF-{kappa}B activation, an I{kappa}B kinase (IKK)-dependent process. However, the upstream kinases that regulate IKK activity following TCR activation remain to be fully characterized. Herein, we demonstrate using genetic analysis, pharmacological inhibition, and RNA interference (RNAi) that the conventional protein kinase C (PKC) isoform PKC{alpha}, but not PKCß1, is required for the activation of the IKK complex following T-cell activation triggered by CD3/CD28 cross-linking. We find that in the presence of Ca2+ influx, the catalytically active PKC{alpha}A25E induces IKK activity and NF-{kappa}B-dependent transcription; which is abrogated following the mutations of two aspartates at positions 246 and 248, which are required for Ca2+ binding to PKC{alpha} and cell membrane recruitment. Kinetic studies reveal that an early phase (1 to 5 min) of IKK activation following TCR/CD28 cross-linking is PKC{alpha} dependent and that a later phase (5 to 25 min) of IKK activation is PKC{theta} dependent. Activation of IKK- and NF-{kappa}B-dependent transcription by PKC{alpha}A25E is abrogated by the PKC{theta} inhibitor rottlerin or the expression of the kinase-inactive form of PKC{theta}. Taken together, our results suggest that PKC{alpha} acts upstream of PKC{theta} to activate the IKK complex and NF-{kappa}B in T lymphocytes following TCR activation.


arrow
INTRODUCTION
 
Identification of the molecular events regulating T-cell activation is paramount to understanding the regulation of the immune response. The signal transduction pathways triggered by antigen presentation lead to the immediate activation of multiple transcription factors that further amplify the process of lymphocyte activation, ultimately leading to cellular proliferation and division. T-cell receptor (TCR) engagement, together with the second costimulatory signal derived from engagement of the CD28 receptor, results in NF-{kappa}B activation (13, 31, 36). When occurring together with NF-AT, AP-1, and octomer, NF-{kappa}B activation leads to interleukin-2 (IL-2) expression (17, 27, 30).

NF-{kappa}B is a heterodimer of transcription factors that belong to the Rel family of proteins. The canonical NF-{kappa}B is a heterodimer of p65 (RelA) with p50 or p52 (35, 50, 54). This heterodimer is anchored by a group of proteins named I{kappa}B, which function to retain NF-{kappa}B in the cytosol by masking its nuclear localization signal (1, 4, 45, 60). I{kappa}B{alpha} is the prototype I{kappa}B molecule known to control the subcellular localization of NF-{kappa}B (p50/p65). Following activation of certain signal transduction pathways, a site-specific hyperphosphorylation of I{kappa}B{alpha} at S32 and S36 renders the inhibitor molecule susceptible to site-specific ubiquitination and subsequent degradation by the proteasome complex (8, 9, 18, 62, 68). This releases NF-{kappa}B, allowing it to undergo nuclear translocation. Two I{kappa}B{alpha} kinases, IKK{alpha} (19, 52, 70) and IKKß (46), which are contained within a high-molecular-weight complex, target the phosphorylation of S32 and S36 of I{kappa}B{alpha} following stimulation by various stimuli. While engagement of TCR/CD3 and CD28 activates the IKK complex (27), the molecular mechanisms and second messengers mediating it are poorly understood when compared to what is currently known about tumor necrosis factor (TNF)- and IL-1 receptor-initiated signaling (46, 52, 69). TCR/CD3- and CD28-generated signals converge on the mitogen-activated protein 3 (MAP3) type kinase, Cot, which in turn has been suggested to lead to the activation of the IKK complex via induction of the NF-{kappa}B-inducible kinase (NIK) (39). The relevance of NIK in this process, however, remains controversial, because NIK preferentially activates IKK{alpha} but not IKKß (40, 52), and both IKK{alpha} and IKKß are activated following CD3/CD28 ligation (34). Moreover, the activation of IKKß, but not of IKK{alpha}, is essential for IL-2 expression (34). Other second messengers downstream of the TCR/CD3 and CD28 activation leading to activation of the IKK complex remain to be characterized. Engagement of TCR/CD3 by the complex formed between its cognate peptide and the major histocompatibility complex induces phospholipase C (PLC) activation, which hydrolyzes phosphatidylinositol 4,5-bisphosphate (PIP2) (28) to inositol 1,4,5-triphosphate (IP3), which ultimately releases Ca2+ from intracellular stores and diacylglycerol (DAG) (6, 14). While free intracellular Ca2+ targets the Ca2+/calmodulin-activated phosphatase calcineurin, both Ca2+ and DAG activate protein kinase C (PKC) isoforms that mediate a critical positive signal necessary for IL-2 induction through their synergy with calcineurin (22). The specific PKC isoform that critically mediates TCR-initiated signaling is unclear, and this is an area of intense investigation (3, 25, 64).

To date, 11 closely related PKC isoenzymes have been described and classified into three subfamilies based on their domain structure and their ability to respond to Ca2+ and DAG (48, 49). The "conventional" PKC isoforms ({alpha}, ß1, ßII, and {gamma}) are regulated by DAG, which binds the C1 domain, and by Ca2+, which binds the C2 domain. In contrast, the "novel" PKC isoforms ({delta}, {varepsilon}, {eta}, and {theta}) are not regulated by Ca2+ but respond to DAG. The molecular structure of the novel PKC isoforms is similar to that of the classical isoforms except for differences in the Ca2+ binding domain. The third group of PKC isoforms includes the "atypical" PKC isoforms ({zeta}, {lambda}/{iota}, and µ), which are regulated neither by DAG nor Ca2+. Elevated concentrations of intracellular Ca2+ and DAG following TCR stimulation can potentially activate either conventional or novel PKC isoforms. Among the PKC isoforms in T cells, PKC{alpha} and PKC{theta} are recruited to the inner leaflet of the plasma membrane within minutes following TCR ligation (59), an event that temporally correlates with IKK and NF-{kappa}B activation (26, 34). This suggests that these two PKC isoforms may be involved in mediating the TCR-induced IKK and NF-{kappa}B activation in T lymphocytes. In fact, PKC{theta} has been recently shown to mediate CD3/CD28-induced NF-{kappa}B activation (16, 40, 58) by specifically activating the IKK complex (40). As for PKC{alpha}, it has been shown in nonlymphoid cells to potently activate IKKß (37) and NF-{kappa}B (16).

Our group has previously demonstrated that the activation of IKK, and hence NF-{kappa}B by phorbol esters and ionomycin in primary T cells and transformed T-cell lines is dependent on conventional PKC isoforms (63). Because these two stimuli mimic the effects of DAG and increased intracellular Ca2+ that ensue following TCR/CD3 and CD28 activation, we have sought to investigate the role PKC{alpha} plays in mediating the activation of IKK and NF-{kappa}B following TCR/CD3 and CD28 cross-linking in T lymphocytes, as well as its relationship to PKC{theta}. Using a combination of pharmacological, genetic, and RNA interference approaches, we demonstrate that PKC{alpha} mediates activation of the IKK complex and NF-{kappa}B following CD3/CD28 cross-linking. Moreover, we show that PKC{alpha} lies upstream of PKC{theta} in this relevant signaling cascade in T lymphocytes.


arrow
MATERIALS AND METHODS
 
Plasmids. The NF-{kappa}B-dependent firefly luciferase reporter expression vector ({kappa}B-luc) has been previously described (63). The IL-2, RE/AP, and NF-AT/AP-1 promoter-luciferase reporter plasmids were gifts from D. McKean (Mayo Clinic, Rochester, Minn.), and the AP-1 reporter plasmid was described previously (22). The pRL-TK expression vector, which provides constitutive expression of Renilla luciferase, is commercially available (Promega, Madison, Wis.). Both wild-type and kinase-dead (KD) cDNAs of IKKß were obtained from M. Roth (Tularik, Inc., South San Francisco, Calif.). Wild-type IKKß with an N-terminal three-hemagglutinin (HA) tag was provided by E. Zandi (University of California—San Diego). IKK{alpha} KD was a kind gift from A. Israel (Institute Pasteur, Paris, France). The expression vector pEF-BOS was a gift from L. Karnitz (Mayo Clinic). The mammalian expression vectors (pEF1/Myc-His) were purchased from Invitrogen (Carlsbad, Calif.), and pCI was purchased from Promega. The expression vector pSR{alpha}4{Delta}CaM-AI has been described previously (63). Wild-type and KD PKC{alpha} and PKC{theta}cDNAs were kindly provided by A. Altman (La Jolla Institute, La Jolla, Calif.). Constitutively active PKC{alpha}A25E was generated by site-directed mutagenesis with mutagenic primers sense A25E (CGCAAAGGGGACCTGAGGCAGAAG); mutated codon in boldface) and antisense A25E (CTTCTGCCTCAGCTCCCCTTTGCG), along with wild-type primers (5'-gcggccgctATGGCTGACGTC and 3'-tctagatcaTACGCGGCTCTGCAG; appended enzyme site in lowercase), and cloned into pGEM-T Easy (Promega). PKC{alpha}A25E was then excised by NotI digestion and subcloned into HA-pCDNA3 at the NotI site. The insert coding HA-tagged PKC{alpha} was subcloned into pEF-BOS by using XbaI sites. Constitutively active PKC{alpha} with mutations D246N and D248N was generated by PCR with a sense mutagenic primer (5'-GAAATCTGGAACTGGAACCGAACCAC) and an antisense primer (5'-GTGGTTCGGTTCCAGTTCCAGATTTC) and with HA-PKC{alpha}A25E as a template. HA-PKC{alpha}A25E/D246, 248N was subcloned into pEF-BOS by using XbaI sites. Constitutively active PKC{theta}A148E was generated by site-directed mutagenesis with mutagenic primers (sense, 5'-CGCCGGGGTGAAATCAAGCAG; antisense, 5'-CTGCTTGATTTCACCCCGGCG; sense PKC{theta} with BamHI site, cgggatccATGTCGCCATTTCTT; and antisense PKC{theta} with XbaI site, cgtctagaTCAGGATATCAGCCG) and cloned into pGEM-T Easy. The insert coding PKC{theta}A148E was excised and subcloned into pCI at NotI sites or cloned into pEF1/Myc-His at BamHI and NotI sites. The sequences of all generated constructs were verified by sequencing.

Generation of pFRT-H1P and the PKC suppression vectors. A 210-bp fragment containing the RNA polymerase III-dependent H1 RNA promoter was amplified from Jurkat T-cell DNA as previously described (10). The H1 promoter fragment was subcloned into a modified mammalian expression vector as an EcoRI-HindIII fragment in order to generate the pFRT-H1P parental vector (FRT = for RNA targeting). In order to produce PKC-specific targeting short hairpinned RNA (shRNA) molecules, complementary oligonucleotides were synthesized as previously described (10). In brief, each oligonucleotide pair contains a 5' BglII and 3' HindIII overhang, an RNA polymerase III start and termination sequence, and 19 to 21 nucleotides (N19) of PKC specific sequence separated by a 9-nucleotide loop. The invariant nucleotide sequences of both the upper and lower oligonucleotide strands are 5'-GATCCCC(N19)ttcaagaga(61N)TTTTTGGAAA-3' and 3'-GGG(N19)aagttctct(61N)AAAAACCTTTTCGA-5'. The specific targeting sequence (N19/21) for each PKC isoform was designed to be specific for the desired isoform and was subsequently subjected to BLAST search algorithm against the human expressed sequence tag (EST) database to confirm targeting specificity. The sequences for the three PKC isoforms targeted in this paper are as follows: PKC{alpha}, 5'-GAACAACAAGGAATGACTT-3'; PKCß1, 5'-GGAAGCTGTGGCCATCTGC-3'; and PKC{theta}, 5'-TTGGATGAGGTGGATAAAA-3'.

Cell culture and reagents. Jurkat T cells were obtained from the American Type Culture Collection, Rockville, Md., and maintained in RPMI 1640 (Bio-Whittaker, Walkersville, Md.) supplemented with 5% heat-inactivated fetal bovine serum, 100 U of penicillin-streptomycin per ml, and 2 mM L-glutamine. Cells were grown to a density of 3 x 105 to 5 x 105 per ml at the time of the different experiments. HEK 293T cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% heat-inactivated fetal bovine serum, 50 U of penicillin-streptomycin per ml, and 2 mM L-glutamine. Sodium orthovanadate and p-nitrophenyl phosphate (PNPP) were purchased from Sigma Chemical Co. (St. Louis, Mo.). Ionomycin, Gö6976, ß-glycerophosphate, Gö6850, and rottlerin were purchased from CalBiochem, and TNF-{alpha} was purchased from R&D Systems (Minneapolis, Minn.). Leupeptin, aprotinin, and pepstatin A were obtained from Boehringer-Mannheim (Indianapolis, Ind.). Anti-HA high-affinity antibodies were purchased from Boehringer Mannheim. Anti-IKK{alpha} (H-744, M-280), anti-IKKß (H-470), anti-PKC{alpha} (C-20), anti-p65 (C-20), and anti-I{kappa}B{alpha} (C-21) antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, Calif.). Anti-human CD3 (UCHT1) and OKT3 antibodies were obtained from Ancell (Bayport, Minn.) and Ortho Biotech (Raritan, N.J.), and anti-CD28 was purchased from BD Biosciences (San Jose, Calif.). Anti-PKCß1 and anti-PKC{theta} were purchased from BD Transduction Laboratories (San Diego, Calif.). Protein A agarose beads were obtained from Life Technologies (Gaithersburg, Md.). Dimeric human TNF receptor p80/immunoglobulin G1 (IgG1) Fc fusion protein was a kind gift from D. Lynch (Immunex, Seattle, Wash.). The preparation of substrate GST-I{kappa}B{alpha}(1-53) for the in vitro IKK kinase assay has been previously described (63).

To isolate CD3+ T cells, peripheral blood mononuclear cells (PBMCs) from healthy volunteer blood donors were obtained from buffy coats by density gradient centrifugation (Ficoll-Hypaque; Pharmacia LKB Biotechnology, Inc., Piscataway, N.J.). PBMCs were then depleted of monocytes by two cycles of plastic adherence, and CD3+ T cells were purified by neuraminidase-treated sheep erythrocyte (SRBC) rosetting. The remaining cell population was repeatedly found to be 98% CD3+ T cells, as determined by flow cytometry. CD3+ T cells used in the various experiments were maintained in RPMI 1640 supplemented with 10% fetal bovine serum (Invitrogen), 2 mM L-glutamine, and antibiotics (penicillin, 100 U/ml; streptomycin, 100 µg/ml) at 0.5 x 106 cells per ml. CD3+ T cells were stimulated and harvested on the second day after isolation.

Where indicated, cells were pretreated with 2 µM Gö6976 for 15 min. FK506 was used at 20 ng/ml. For Jurkat T cells, ionomycin was used at 3.5 µg/ml, and TNF-{alpha} was used at 10 ng/ml. Jurkat and CD3+ T cells were cross-linked with 3 µg of anti-CD3 and anti-CD28 antibodies or isotype control antibodies per ml (63).

Cell extract preparation, immunoblotting, and kinase assay. To obtain total cellular proteins, cells were washed with cold phosphate-buffered saline (PBS), resuspended in a modified whole-cell extract (WCE) PD buffer (63) (40 mM Tris-HCl [pH 8], 0.3 M NaCl, 0.1% Nonidet P-40, 6 mM EDTA, 6 mM EGTA, 10 mM NaF, 10 mM PNPP, 10 mM b-glycerophosphate, 300 µM sodium orthovanadate, 1 mM dithiothreitol, 2 µM phenylmethylsylfonyl fluoride [PMSF], 10-µg/ml aprotinin, 1-µg/ml leupeptin, 1-µg/ml pepstatin) and centrifuged at 12,000 x g for 15 min at 4°C. The resultant supernatant contained total cellular protein. The amount of cellular protein present in the clarified supernatant was calculated by using the Bio-Rad (Hercules, Calif.) protein assay.

For Western immunoblots, equal amounts of WCE were loaded and separated by sodium dodecyl sulfate-polyacrylamide (10%) gel electrophoresis (SDS-PAGE) and transferred to Immobilon-P membranes (Millipore, Bedford, Mass.). Immunoblotting was performed with specific antibodies and visualized by using the ECL enhanced chemiluminescence Western blotting detection kit (Amersham, Buckinghamshire, England).

The isolation of membrane-bound PKC{alpha} and PKC{theta} were performed as previously described (11). The immunocomplex kinase assay from WCE Jurkat and CD3+ T cells using I{kappa}B{alpha} as a substrate has been described previously (63).

Gene transfection and reporter assays. FuGENE6 (Roche Molecular Biochemicals, Indianapolis, Ind.) was used to transfect DNA plasmids into Jurkat T cells. In brief, 8 µl of FuGENE6 was mixed with 92 µl of RPMI 1640 medium and incubated for 5 min. FuGENE6/RPMI-1640 solution was added to a sterile tube containing 0.19 µg of {kappa}B-luc reporter plasmid, 0.01 µg of Tk-Renilla and 0 to 1.8 µg of a plasmid of interest up to a total of 2 µg of DNA and incubated for 15 min. The DNA/FuGENE6 solution was added to 106 log-phase Jurkat T cells. Lipofectamine Plus (Invitrogen) was used to transfect 293T cells according to the manufacturer's protocol.

Where indicated, Jurkat T cells were electroporated with a BTX Electro Square Porator T820 (BTX Corporation, San Diego, Calif.) at 325 V for 10 ms. Primary CD3+ T cells were electroporated at 360 V for 10 ms as previously described (5).

Jurkat T cells were transfected with the indicated plasmids and grown for 18 to 24 h. Cells were stimulated for 4 h with ionomycin (3.5 µg/ml) or TNF-{alpha} (10 ng/ml) or cross-linked with anti-CD3 and anti-CD28 antibodies as previously described (63). Thereafter, cells were washed twice in cold PBS and lysed with 100 µl of lysis buffer (Promega dual-luciferase reporter assay system). Firefly and Renilla luciferase activities from 20 µl of extract were assayed with the Promega dual-luciferase reporter assay system reagents and a Berthold Lumat following the manufacturer's recommendation. {kappa}B-luc activity was normalized to Renilla expression. All transfection experiments were performed in duplicate.

For in vitro kinase assays (IVK), Jurkat T cells were electroporated with 20 µg of the plasmid of interest or vector control.


arrow
RESULTS
 
Conventional PKC isoforms participate in the activation of the IKK complex following CD3/CD28 cross-linking in T lymphocytes.

Our group has previously shown that phorbol myristate acetate (PMA) and ionomycin, two drugs that mimic events triggered by TCR ligation, can activate the IKK complex and induce NF-{kappa}B translocation to the nucleus, effects that were partially inhibited with pharmacological inhibition of conventional PKC isoforms (63). To initially address the involvement of conventional PKC isoforms in the TCR/CD3- and CD28-initiated signaling under more physiological conditions, the kinase activity of the IKK complex immunoprecipitated from Jurkat T cells and primary CD3+ T cells following the cross-linking of CD3 and CD28 and their pretreatment (or not) with the conventional PKC inhibitor Gö6976 was first analyzed. It has previously been shown that 2 µM Gö6976 does not inhibit either IKK activation by the PKC-independent stimulus TNF-{alpha} (63) or the kinase activity of PKC{theta} (16). Cross-linking of Jurkat T cells with isotype control IgG or CD28 alone did not induce IKK activity (Fig. 1A, lanes 1 and 2), whereas ligation of CD3 led to moderate IKK activation (Fig. 1A, lane 3). Cross-linking of both CD3 and CD28 resulted in a strong induction of the IKK complex activity (Fig. 1A, lane 4), which was inhibited by Gö6976 (Fig. 1A, lane 6).



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 1. Conventional PKC isoforms participate in the activation of the IKK complex following CD3/CD28 cross-linking. (A) Jurkat T cells (5 x 106 per sample) were incubated with 6-µg/ml isotype control IgG (lane 1), 3-µg/ml (each) anti-CD3 and IgG (lanes3 and 5), 3-µg/ml (each) anti-CD28 and IgG (lane 2), or 3 µg (each) of anti-CD3 and anti-CD28 antibodies (lanes 4 and 6) and then plated onto wells precoated with goat anti-mouse IgG. Jurkat T cells were pretreated (+) or not (-) with 2 µM Gö6976 for 15 min before cross-linking with antibodies. IKK activity was measured in an IVK assay as described in Materials and Methods, using glutathione S-transferase (GST)-I{kappa}B{alpha}(1-53) as a substrate (GST-I{kappa}B{alpha}32P). Coomassie staining of the polyvinylidene difluoride membrane containing the IVK to detect the amount of I{kappa}B{alpha} substrate (GST-I{kappa}B{alpha}) and immunoblotting (IB) for IKK{alpha} were performed. Panel B is the same as panel A, except that primary human purified CD3+ T cells (10 x 106 cells per sample) were used.

In contrast to Jurkat T cells, primary resting purified CD3+ T cells demonstrated less of a requirement for CD3 and CD28 costimulation, since CD3 stimulation alone was sufficient to induce a strong IKK activity (Fig. 1B, lane3) which was not further increased following CD28 coligation (Fig. 1B, lane 4). Once again, pretreatment of primary CD3+ T cells with Gö6976 abolished IKK activation following either CD3 or CD3/CD28 cross-linking (Fig. 1B, lanes 5 and 6).

These data suggest that conventional PKC isoforms participate in the TCR/CD3-initiated signal transduction pathway that leads to IKK activation in transformed and primary T lymphocytes.

PKC{alpha} is required for both IKK and NF-{kappa}B activation following T-cell stimulation by CD3 and CD28. T lymphocytes express two conventional PKC isoforms, PKC{alpha} and PKCß1, both of which are activated with different kinetics following TCR cross-linking (59). PKC{alpha} translocates within a few minutes, whereas PKCß1 is recruited to the cell membrane 90 min after TCR cross-linking (59). To test whether PKC{alpha} mediates CD3/CD28-induced IKK activation, we first measured the activity of the IKK complex from TNF-{alpha}- or CD3/CD28-stimulated Jurkat T cells that had been transiently transfected with a catalytically inactive form of PKC{alpha} (PKC{alpha}K368R). Expression of the catalytically inactive PKC{alpha} specifically abrogated the CD3/CD28-, but not the TNF-{alpha}-induced IKK activation (Fig. 2A, compare lanes 2 and 5 with 3 and 6).



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 2. PKC{alpha} is required for CD3/CD28-induced activation of IKK complex and NF-{kappa}B-dependent transcriptional activity. (A) Jurkat T cells (10 x 106 per sample) were electroporated with 20 µg of catalytically inactive HA-PKC{alpha}K368R (lanes 4 to 6) or control vector pEF-BOS (lanes 1to 3). Eighteen hours later, transfected Jurkat T cells were cross-linked with anti-CD3 and anti-CD-28 antibodies (lanes 2 and 5) or were stimulated with TNF-{alpha} as a control (lanes 3 and 6). IKK activity was measured in an IVK assay using glutathione S-transferase (GST)-I{kappa}B{alpha}(1-53) as a substrate (GST-I{kappa}B{alpha} 32P). Coomassie staining of the polyvinylidene difluoride membrane containing the IVK indicates equal amounts of I{kappa}B{alpha} substrate (GST-I{kappa}B{alpha}), and immunoblotting (IB) for IKK{alpha} and ß indicates equal amounts of complex immunoprecipitation per lane. Expression of HA-PKC{alpha}K368R was confirmed by immunoblotting with anti-HA antibodies (anti-HA IB). (B) Jurkat T cells (2 x 106 per sample) were transfected in duplicate with 2.4 µg of catalytically inactive HA-PKC{alpha}K368R or 2.4 µg of control vector pEF-BOS together with reporter {kappa}B-luc (0.38 µg) and Tk-Renilla (0.02 µg) plasmids by the FuGENE6 method. Twenty hours later, transfected Jurkat T cells were cross-linked with anti-CD3 and anti-CD28 antibodies or were stimulated with TNF-{alpha}. TNFR Fc fusion protein was added at the moment of TNF-{alpha} stimulation at 1 µg/ml. Four hours later, cells were harvested and luciferase activities were measured. The {kappa}[/beta]-luc activity was normalized to Renilla luciferase activity (relative luciferase activity). (C) Jurkat T cells (10 x 106 per sample) were electroporated with 40 µg of pFRT-PKC{alpha} (lane 2), pFRT-PKCß1 (lane 3), or pFRT control vector (lane 1). Forty-eight hours later, the transfected cells were treated with anti-CD3 (10 µg/ml) and anti-CD28 (10 µg/ml) antibodies for 45 min on ice and cross-linked with goat anti-mouse antibodies in solution at 37°C for the indicated periods of time. IKK activity was measured in IVK assay as described above. Protein levels following the suppression of endogenous PKC{alpha} or PKCß1 expression were confirmed by immunoblotting. Equal amounts of protein per lane were demonstrated by immunoblotting with anti-PKC{theta} antibodies.

The ability of the catalytically inactive PKC{alpha} to inhibit the IKK complex activity following CD3/CD28 cross-linking was further confirmed by measuring its effect on NF-{kappa}B-dependent transcriptional activity. Jurkat T cells were transfected with the PKC{alpha}K368R expression vector and an NF-{kappa}B-dependent reporter plasmid and left unstimulated or were stimulated by CD3/CD28 cross-linking or TNF-{alpha}. Expression of the catalytically inactive PKC{alpha} reduced the NF-{kappa}B-dependent transcriptional activity following CD3/CD28 cross-linking, but it had no effect on TNF-{alpha}-induced transcription (Fig. 2B).

Since T-cell activation by CD3/CD28 cross-linking may induce autocrine secretion of TNF-{alpha}, which may further contribute to NF-{kappa}B-dependent transcriptional activity, we evaluated the effect of the catalytically inactive PKC{alpha} in the presence of recombinant TNF receptor (TNFR) fusion protein (TNFR Fc). As shown in Fig. 2B, addition of TNFR Fc to the cell culture media did not result in a significant decrease in NF-{kappa}B-dependent transcriptional activity in Jurkat T cells transfected with catalytically inactive PKC{alpha}, while totally abrogating the TNF-induced NF-{kappa}B-dependent transcriptional activity.

Altogether, these data indicate that PKC{alpha} can mediate CD3/CD28-induced activation of IKK and NF-{kappa}B in Jurkat T cells. However, these results do not rule out a possible role for PKCß1 in mediating CD3/CD28-induced IKK activation, since the broad specificity of dominant-negative PKC mutants has been described (24).

To identify which of the two conventional PKC isoforms mediates CD3/CD28-induced IKK activation, we generated isoform-specific PKC suppression vectors (10), which direct synthesis of shRNA molecules specific for targeting of either human PKC{alpha} or human PKCß1. As shown in Fig. 2C, transfection of Jurkat T cells with either pFRT-PKC{alpha} or pFRT-PKCß1 resulted in selective and significant reduction of PKC{alpha} and PKCß1 expression. Neither of the shRNA targeting vectors affected the levels of PKC{theta}. The kinetic analysis of the IKK activation demonstrated that suppression of PKC{alpha}, but not PKCß1, resulted in the severe defect of IKK activation following CD3/CD28 cross-linking. Taken together, these results indicate that PKC{alpha}, but not PKCß1, mediates activation of the IKK complex triggered by CD3/CD28 cross-linking in Jurkat T cells.

Constitutively active PKC{alpha} activates the IKK complex and NF-{kappa}B-dependent transcriptional activity in T cells. To further confirm the specific role of PKC{alpha} in the activation of the IKK complex and NF-{kappa}B-dependent transcriptional activity following CD3/CD28 stimulation in T cells, we evaluated the ability of a constitutively active PKC{alpha} isoform containing a substitution of Ala for Glu in the pseudosubstrate sequence (PKC{alpha}A25E) (3) in regulating the activity of IKK and of the NF-{kappa}B-dependent transcriptional activity. When PKC{alpha}A25E or control vector was expressed in Jurkat T cells, no detectable activation of the endogenous IKK complex was observed (Fig. 3A, lane 4). However, the addition of ionomycin to the PKC{alpha}A25E-transfected cells induced the activation of the IKK complex, while ionomycin treatment in the vector-transfected cells had no effect on IKK activity (Fig. 3A, lanes 2 and 5). These data indicate that the previously described constitutively active PKC{alpha} isoform can only activate the endogenous IKK complex in the presence of Ca2+ influx. How ionomycin and hence Ca2+ influx regulates PKC{alpha}A5E function is addressed below.



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 3. Catalytically active PKC{alpha} (PKC{alpha}A25E) activates the IKK complex and NF-{kappa}B-dependent transcriptional activity. (A) Jurkat T cells (10 x 106 per sample) were electroporated with 20 µg of catalytically active PKC{alpha} (pEF-BOS/HA-PKC{alpha}A25E) (lanes 4 to 6) or control vector pEF-BOS (lanes 1 to 3). Twenty hours later, transfected Jurkat T cells were treated with 3.5-µg/ml ionomycin (lanes 2 and 5) or were stimulated with TNF (lanes 3 and 6). IKK activity was measured in an IVK assay as described above. Expression of HA-PKC{alpha}A25E was analyzed by immunoblotting with anti-HA antibodies (anti-HA IB). (B) Jurkat T cells (10 x 106 per sample) were electroporated with 20 µg of catalytically active PKC{alpha} (pEF-BOS/HA-PKC{alpha}A25E) (lane 2) or control vector pEF-BOS (lane1) together with the reporter {kappa}B-luc (3.8 µg) and Tk-Renilla (0.2 µg) plasmids. Twenty hours later, transfected Jurkat T cells were treated with 3.5-µg/ml ionomycin or were stimulated with OKT3 monoclonal antibody (5 µg/ml). Four hours later, luciferase activity was measured and normalized as described in the legend to Fig. 2B. Expression of HA-PKC{alpha}A25E was analyzed by immunoblotting with anti-HA antibodies (anti-HA IB). All experiments were performed in duplicate.

The functional relevance of PKC{alpha} activation of the IKK complex was further studied by measuring NF-{kappa}B-dependent transcriptional activity. Transfection of PKC{alpha}A25E resulted in a two- to threefold increase in NF-{kappa}B-dependent transcriptional activity in unstimulated Jurkat T cells (Fig. 3B). Again, ionomycin treatment induced NF-{kappa}B-dependent transcriptional activity only in PKC{alpha}A25E-transfected cells but not in vector-transfected cells (Fig. 3B). Moreover, ligation of CD3, a receptor shown previously to trigger increases in intracellular Ca2+ (28), induced NF-{kappa}B activation in PKC{alpha}A25E- but not in vector-transfected cells (Fig. 3B). Therefore, we conclude that Ca2+ influx is required for NF-{kappa}B activation via a constitutively active PKC{alpha}.

Ca2+ influx is required for NF-{kappa}B activation by PKC{alpha}A25E. PKC{alpha} binds two Ca2+ ions when recruited to the cell membrane (44, 55, 65) where it becomes activated and undergoes autophosphorylation to achieve full catalytic competency (48). Ca2+ ions bind to five aspartic acid residues in the C2 Ca2+ binding domain of PKC{alpha} (15, 44, 55, 65). Based on the observation that PKC{alpha}A25E requires increases in intracellular Ca2+ to activate IKK and NF-{kappa}B, we investigated whether the effects of Ca2+ influx were secondary to its direct binding to PKC{alpha}A25E. To test this, the major Ca2+ binding sites, D246 and D248, were mutated to asparagine (44, 65), and the ability of this mutant (PKC{alpha}A25E/D246N-D248N) to activate NF-{kappa}B downstream of CD3/CD28 cross-linking was assessed. As shown in Fig. 4A, expression of this PKC{alpha} mutant failed to induce NF-{kappa}B-dependent transcriptional activity following ionomycin treatment, while not effecting TNF-{alpha} induced NF-{kappa}B activation (data not shown). Furthermore, EGTA depletion of extracellular Ca2+ in the culture media of Jurkat T cells transfected with PKC{alpha}A25E abrogated the ionomycin-induced NF-{kappa}B activity (Fig. 4A). Therefore, these observations suggest that PKC{alpha}A25E can efficiently induce NF-{kappa}B transcription only in the presence of Ca2+ influx.



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 4. Ca2+ binding to PKC{alpha}A25E is required to activate IKKß and NF-{kappa}B. (A) Jurkat T cells (10 x 106 per sample) were electroporated with 20 µg of catalytically active PKC{alpha} (pEF-BOS/HA-PKC{alpha}A25E) (lane 2), 20 µg of mutant construct HA-PKC{alpha}25E/D246N, D248N (lane 3), or 20 µg of control vector pEF-BOS (lane 1) together with reporter {kappa}B-luc (3.6 µg) and Tk-Renilla (0.4 µg) plasmids. One group of cells transfected with HA-PKC{alpha}25E was pretreated with 1.5 mM EGTA before the addition of ionomycin to all samples. Expression of PKC{alpha}A25E (lane 2) or HA-PKC{alpha}25E/D246N, D248N (lane 3) was demonstrated by immunoblotting with anti-HA antibodies. (B) Jurkat T cells (10 x 106) were electroporated with 5 µg of FLAG-tagged IKKß wild type with or without 20 µg of HA-PKC{alpha}A25E or HA-PKC{alpha}A25E/D246N, D248N or 20 µg of pEF-BOS. IKKß was immunoprecipitated with anti-FLAG antibodies, and the kinase activity of IKKß was measured as described above. The expression of FLAG-IKKß was confirmed by immunoblotting with anti-FLAG antibodies (FLAG-IB).

We further confirmed this by comparing the ability of PKC{alpha}A25E and its mutant form, PKC{alpha}A25E/D246N-D248N, to activate exogenously expressed IKKß. As shown in Fig. 4B, only PKC{alpha}A25E increased the kinase activity of IKKß in the presence of Ca2+ influx, in contrast to its mutant form. Since the mutations D246N and D248N of PKC{alpha} strongly impair its interaction with the plasma membrane (15), we infer that the lack of PKC{alpha}A25E/D246N-D248N binding to the plasma membrane may be responsible for the inability of the mutant form of PKC{alpha} to activate IKKß.

PKC{alpha} and PKC{theta} mediate IKK activation following CD3/CD28 stimulation with different kinetics. Having demonstrated a role for PKC{alpha} in the CD3/CD28 activation of NF-{kappa}B, we questioned its relationship to PKC{theta} in the CD3/CD28-initiated pathway leading to IKK and NF-{kappa}B activation.

To evaluate the relative contribution of each PKC isoform in the CD3/CD28 pathway, we analyzed the kinetics of the IKK complex activation following CD3/CD28 cross-linking in the presence of a variety of PKC inhibitors: the conventional PKC inhibitor Gö6976 (43), the PKC{theta} inhibitor rottlerin (66), and an inhibitor of both conventional and novel PKC isoforms, Gö6890 (61). We find that rottlerin did not inhibit the early (3 to 5 min) activation of the IKK complex, while Gö6976 did inhibit the early activation (Fig. 5). Interestingly, Gö6976 significantly impaired IKK activation at 10 min. Finally, both rottlerin and Gö6976 totally inhibited IKK activation 25 min after CD3/CD28 cross-linking. Moreover, we find that inhibition of both conventional and novel PKC isoforms by Gö6890 abrogates IKK activation at all times following CD3/CD28 stimulation. These observations suggest that at an early phase (up to 5 min) following CD3/CD28 stimulation, PKC{alpha} activates the IKK complex independently of PKC{theta}, while at later periods following CD3/CD28 stimulation, it is PKC{theta}-dependent signaling that leads to IKK activation.



View larger version (33K):
[in this window]
[in a new window]
 
FIG. 5. PKC{alpha} and PKC{theta} mediate IKK activation following CD3/CD28 stimulation with different kinetics. (A) Jurkat T cells were pretreated with different PKC inhibitors for 20 min prior to CD3 and CD28 cross-linking: Gö6976 and Gö6890 were each used at 2 µM, and rottlerin was used at 30 µM. Cells were treated with anti-CD3 (10 µg/ml) and anti-CD28 (10 µg/ml) antibodies for 45 min on ice and cross-linked with goat anti-mouse antibodies in solution at 37°C for the indicated periods of time. Cells were harvested, and the IKK complex kinase activity was measured in an IVK assay, as described in the legends to Fig. 1 to 4. (B) Membrane (M) and cytoplasmic (C) fractions from CD3/CD28-stimulated Jurkat T cells were isolated and resolved by SDS-PAGE. The purity of the digitonin-extractable fraction (C) and NP-40-soluble fraction (M) was tested with antibodies specific for the raft-associated protein, LAT, and the cytoplasmic NF-{kappa} B protein, p65. The quantity of PKC{alpha} and PKC{theta} was analyzed by immunoblotting. (C) Jurkat T cells were transfected with the reporter plasmids {kappa}B-luc (0.19 µg) and Tk-Renilla (0.01 µg) by the FuGENE6 method. Eighteen hours later, transfected Jurkat T cells were pretreated with Gö6976 at 2 µM and rottlerin at 30 µM for 20 min andwere then cross-linked with anti-CD3 (10 µg/ml) and anti-CD28 (10 µg/ml) antibodies. Four hours later, luciferase activity was measured, normalized as described above, and expressed as relative luciferase units (RLU). (D) Jurkat T cells (10 x 106 per sample) were electroporated with 40 µg of pFRT-PKC{theta} or control vector pFRT-H1. Forty-eight hours later, transfected Jurkat T cells were treated with anti-CD3 (10 µg/ml) and anti-CD28 (10 µg/ml) antibodies for 45 min on ice and cross-linked with goat anti-mouse antibodies in solution at 37°C for the indicated periods of time. IKK activity was measured in an IVK assay as described above. Suppression of endogenous PKC{theta} expression, but not PKC{alpha}, was confirmed by immunoblotting. (E) Jurkat T cells were electroporated with 40 µg of pFRT-PKC{theta} (lane 2), pFRT-PKC{alpha} (lane 3), or control vector pFRT-H1 (lane 1) together with reporter {kappa}B-luc (3.6 µg) and Tk-Renilla (0.4 µg) plasmids. Forty-eight hours later, transfected Jurkat T cells were treated with anti-CD3 (3 µg/ml) and anti-CD28 (3 µg/ml) antibodies for 45 min on ice and cross-linked on plated goat anti-mouse antibodies at 37°C. Four hours later, luciferase activity was measured, normalized as described above, and expressed as relative luciferase units (RLU). Suppression of endogenous PKC{theta} and PKC{alpha} protein levels was confirmed by immunoblotting.

To test whether the variation in the kinetics of IKK activation results from differences in the translocation rate of the PKCs to the cell membrane, we isolated membrane and cytoplasmic fractions from Jurkat T cells stimulated with cross-linking anti-CD3/CD28 antibodies for various times (Fig. 5B). The purity of membrane and cytoplasmic fractions was established by blotting for the membrane-associated protein, LAT, and cytoplasmic NF-{kappa}B protein, p65. Consistent with the IKK activation observed above, we demonstrated a rapid accumulation of PKC{alpha} into the membrane fraction (1 to 5 min). However, the kinetics of PKC{theta} membrane recruitment was distinct, demonstrating a biphasic recruitment with an initial rapid translocation of PKC{theta} at 1 to 2 min with a subsequent decrease at 5 min, followed by a second, more prolonged PKC{theta} accumulation at 10 to 15 min. These results indicate that the rate of PKC{alpha} translocation to the membrane fraction correlated with the early phase of IKK activation, while later IKK activation may be ascribed to the second phase of PKC{theta} accumulation on the cell membrane.

Further analysis of NF-{kappa}B-dependent transcriptional activity in Jurkat T cells pretreated with either Gö6976 or rottlerin demonstrated that Gö6976 totally inhibited CD3/CD28-induced NF-{kappa}B-dependent transcription, while rottlerin incompletely diminished NF-{kappa}B-dependent transcription (Fig. 5C). Altogether, these results suggest that the early phase of IKK activation (Fig. 5A) mediated by PKC{alpha} can result in NF-{kappa}B-dependent transcription, albeit impaired in the absence of PKC{theta} signaling (Fig. 5C).

To confirm this conclusion, we analyzed the kinetics of IKK activation following CD3/CD28 stimulation in Jurkat T cells transfected with a PKC{theta} RNA suppression vector. Forty-eight hours after transfection, we observed a strong reduction in the PKC{theta} expression and a preferential inhibition of IKK activation at 10 and 15 min following CD3/CD28 stimulation (Fig. 5D). This is in stark contrast to the effects of PKC{alpha} suppression (Fig. 2C) and Gö6976 treatment (Fig. 5A), which resulted in a significant reduction of IKK activation at all times following CD3/CD28 stimulation.

Finally, we measured the effect of suppression of either PKC{alpha} or PKC{theta} on CD3/CD28-induced NF-{kappa}B dependent transcriptional activity. As shown in Fig. 5E, decreasing either PKC{alpha} or PKC{theta} protein levels results in a profound defect in NF-{kappa}B activation following CD3/CD28 stimulation. Therefore, these data suggest that while PKC{alpha} and PKC{theta} may mediate different phases in IKK activation, the action of both PKCs is required for a prolonged IKK activation and consequently, for efficient NF-{kappa}B-mediated gene transcription.

PKC{alpha} acts upstream of PKC{theta}. To further delineate the contribution of both PKC{alpha} and PKC{theta} in CD3/CD28-induced NF-{kappa}B regulation, we compared the effects of both Gö6976 and rottlerin on NF-{kappa}B-dependent transcription induced by expression of PKC{alpha}A25E or constitutively active PKC{theta}, PKC{theta}A148E (Fig. 6A and B). As expected, Gö6976 did not inhibit PKC{theta}A148E-induced NF-{kappa}B-dependent transcription (Fig. 6B), while it completely blocked the induction of NF-{kappa}B-dependent transcription by PKC{alpha}A25E (Fig. 6A).



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 6. PKC{alpha}A25E activates IKKß and NF-{kappa}B in a PKC{theta}-dependent manner in T lymphocytes, but not in 293T cells. (A) Jurkat T cells were transfected with HA-PKC{alpha}A25E and reporter plasmids by electroporation. Eighteen hours later, transfected Jurkat T cells were pretreated with either Gö6976 at 2 µM or rottlerin at 30 µM for 20 min and stimulated with either ionomycin or OKT3 antibodies (5 µg/ml). Four hours later, luciferase activity was measured and normalized as described above. Panel B is the same as panel A, except that PKC{theta}A148E was transfected. (C) 293T cells plated on 24-well plates were transfected with 200 ng of HA-PKC{alpha}A25E and reporter {kappa}B-luc (20 ng) and Tk-Renilla (1 ng) plasmids by using Lipofectamine Plus according to the manufacturer's protocol. Eighteen hours later, transfected 293T cells were pretreated with rottlerin at 30 µM for 20 min and stimulated or not with ionomycin. Four hours later, luciferase activity was measured and normalized as described above.(D) Jurkat T cells (10 x 106) were electroporated with 5 µg of HA-IKKß wild type with or without 15 µg of PKC{alpha}A25E, PKC{alpha}K368R, PKC{theta}A148E, or PKC{theta}K409R. IKKß was immunoprecipitated (IP) with anti-HA antibodies, and the kinase activity of IKKß was measured as described above. (E) Jurkat T cells (10 x 106) were electroporated with 15 µg of PKC{alpha}A25E (lanes 2 and 3) with or without 40 µg of pFRT-PKC{theta} (lane 3) or control vector (lane 1) together with reporter {kappa}B-luc (3.6 µg) and Tk-Renilla (0.4 µg) plasmids. Forty-eight hours later, transfected Jurkat T cells were cross-linked with OKT3 antibodies (5 µg/ml) or isotype control mouse IgG2a (5 µg/ml). Four hours later, luciferase activity was measured, normalized as described above, and expressed as relative luciferase units (RLU). Suppression of endogenous PKC{theta} and HA-PKC{alpha}A25E protein levels was confirmed by immunoblotting.

Rottlerin, previously characterized as a potent PKC{theta} inhibitor (66), efficiently inhibited NF-{kappa}B-dependent transcription induced by PKC{alpha}A25E in the presence of Ca2+ influx (Fig. 6A), whereas it did not inhibit in vitro PKC{alpha} kinase activity (14, 66). It has been recently reported that rottlerin has a broader inhibitory activity (16) and can affect PKC{delta} activation through an indirect mechanism (56). To further explore this, we observed that 30 µM rottlerin efficiently inhibited PKC{theta}A148E-induced NF-{kappa}B-dependent transcriptional activity (Fig. 6B), while it did not affect in vitro PKC{alpha} kinase activity, IKK activity, or NF-{kappa}B-mediated transcription induced by TNF-{alpha} (data not shown). More importantly, the effect of rottlerin on PKC{alpha}A25E-induced NF-{kappa}B-dependent transcription was only observed in T lymphocytes, since in nonhematopoetic cells, such as 293T cells, that lack PKC{theta} (2), PKC{alpha}A25E induced NF-{kappa}B-dependent transcription in a rottlerin-insensitive manner (Fig. 6C). These findings suggest that in T lymphocytes, PKC{alpha} signals upstream of PKC{theta} to activate IKK and NF-{kappa}B.

To further correlate this conclusion, the activity of IKKß was measured in cells in which IKKß was coexpressed with constitutively active PKC{alpha} A25E with or without catalytically inactive PKC{theta} (PKC{theta}K409R) (Fig. 6D). Coexpression of PKC{theta}K409R (Fig. 6D) or rottlerin treatment (data not shown) inhibited the PKC{alpha}A25E-induced IKKß kinase activity.

To exclude possible competition or interference between PKC{alpha} and PKC{theta}, we studied the effect of the PKC{alpha}K409R on the PKC{theta}A148E-induced IKKß kinase activity. As shown in Fig. 6D, catalytically inactive PKC{alpha} had no effect on kinase activity of IKKß induced by expression of PKC{theta}A148E. Pretreatment of PKC{theta}A148E-transfected cells with Gö6976 also did not affect the IKKß kinase activity (data not shown). These data suggest that PKC{alpha} does not compete with PKC{theta} to activate IKKß but rather acts upstream of this novel PKC isoform.

Finally, we analyzed PKC{alpha}A25E-induced NF-{kappa}B-dependent transcription in Jurkat T cells, cotransfected with a PKC{theta} RNA suppression vector, following T-cell activation with OKT3 antibody (Fig. 6E). Interestingly, we found that a reduction in PKC{theta} expression resulted in a greater accumulation of HA-PKC{alpha}A25E (Fig. 6E). Despite the severalfold increase in protein levels of HA-PKC{alpha}A25E in cells cotransfected with the PKC{theta} RNA suppression vector, PKC{alpha}A25E-induced NF-{kappa}B-dependent transcription was impaired.

Altogether, our data suggest that PKC{alpha} acts upstream of PKC{theta} in the TCR-initiated pathway that leads to NF-{kappa}B activation.

PKC{alpha} is required for IL-2 transcription. While previously published data demonstrated that PKC{theta} positively regulates IL-2 transcription (16, 40, 58, 67) by targeting NF-AT (67), AP-1 (3, 67), NF-{kappa}B (16, 40), and CD28RE/AP (16), the role of PKC{alpha} in regulating IL-2 gene expression remains controversial (3, 25, 67). To confirm whether PKC{alpha} can induce IL-2 transcription in T cells, Jurkat T cells were transfected with the full-length IL-2 promoter-luciferase reporter gene construct and increasing doses of either PKC{alpha}A25E or PKC{theta}A148E plasmid (Fig. 7A). As expected, expression of PKC{theta}A148E induced IL-2-dependent transcription in a dose-dependent manner that is strongly amplified by ionomycin. In contrast, expression of PKC{alpha}A25E induced significant IL-2-dependent transcriptional activity in a dose-dependent manner only in the presence of ionomycin. The ability of PKC{alpha}A25E to induce IL-2 transcription was not restricted only to Jurkat T cells, since PKC{alpha}A25E together with ionomycin efficiently activated IL-2-dependent transcription in primary human CD3+ cells (Fig. 7B).



View larger version (27K):
[in this window]
[in a new window]
 
FIG.7. PKC{alpha}A25E induces IL-2 transcription in Jurkat and primary CD3+ T cells in a PKC{theta}-dependent manner. (A) Jurkat T cells (10 x 106 per sample) were electroporated with increasing doses of either HA-PKC{alpha}A25E or PKC{theta}A148E or pEF-BOS together with reporter IL-2-luciferase (3.8 µg) and Tk-Renilla (0.2 µg) plasmids. Eighteen hours later, Jurkat T cells were stimulated or not with ionomycin. Luciferase activity was measured as described in the legend to Fig. 2B. (B) Primary CD3+ T cells from healthy donors were electroporated (BTX, 360 V, 10 ms) with 60 µg of HA-PKC{alpha}A25E, PKC{theta}A148E, or pEF-1 together with IL-2-luciferase (34 µg) and Tk-Renilla (6 µg) plasmids. Eighteen hours later, CD3+ T cells were stimulated or not with ionomycin, and luciferase activity was measured. (C) Jurkat T cells were electroporated with 40 µg of pFRT-PKC{theta} (lane 3), pFRT-PKC{alpha} (lane 2), or control vector (lane 1) together with reporter IL-2-luciferase (3.6 µg) and Tk-Renilla (0.4 µg) plasmids. Forty-eight hours later, transfected Jurkat T cells were stimulated with anti-CD3 and anti-CD28 antibodies as described in the legend to Fig. 6D. Suppression of endogenous PKC{theta} and PKC{alpha} protein expression was confirmed by immunoblotting. (D) Jurkat T cells (106 per sample) were transfected with 0.19 µg of IL-2- or RE/AP-, NF-AT/AP-1- or AP-1-luciferase reporter plasmids with 1.8 µg of HA-PKC{alpha}A25E or pEF-BOS. Eighteen hours later, transfected Jurkat T cells were pretreated with rottlerin and stimulated with ionomycin. Four hours later, luciferase activity was measured and normalized to Tk-Renilla expression.

To confirm these observations, we compared the CD3/CD28-induced IL-2 transcription in Jurkat T cells transfected with RNA suppression vectors for either PKC{alpha} or PKC{theta}. As shown in Fig. 7C, suppression of either PKC{theta} or PKC{alpha} results in a reduction of IL-2 transcription following CD3/CD28 cross-linking. This indicates that PKC{alpha} and PKC{theta} are each required for efficient IL-2 transcription in T cells.

Having demonstrated that PKC{alpha}A25E, in the presence of Ca2+ influx, can activate NF-{kappa}B-dependent transcription in a PKC{theta}-dependent manner, we asked whether PKC{alpha}A25E induced the activity of the IL-2 promoter in a similar fashion. Jurkat T cells transfected with PKC{alpha}A25E and IL-2 promoter-luciferase reporter genes were pretreated with rottlerin before ionomycin stimulation. As shown in Fig. 7D, PKC{alpha}A25E induced IL-2-dependent transcriptional activity exclusively in a rottlerin-sensitive manner. To further characterize which of the transcription factors that regulate the IL-2 promoter are targeted by PKC{alpha}A25E, Jurkat T cells were transfected with PKC{alpha}A25E and CD28RE/AP, NF-AT, and AP-1 reporter genes accordingly. Similar to NF-{kappa}B- and IL-2-dependent transcription, PKC{alpha}A25E induced RE/AP- and NF-AT-dependent transcription following ionomycin treatment in a rottlerin-dependent manner (Fig. 7D). However, PKC{alpha}A25E strongly activated AP-1-dependent transcription in the absence of ionomycin and was not inhibited by rottlerin treatment (Fig. 7D). Interestingly, PKC{alpha}A25E-mediated AP-1-dependent transcription was further enhanced by the addition of ionomycin, and this increase was only partially sensitive to rottlerin inhibition. Therefore, these results suggest that PKC{alpha}A25E, in the presence of Ca2+ influx, can efficiently induce IL-2 transcription in both Jurkat and primary CD3+ T cells. While IL-2, NF-{kappa}B, RE/AP, and NF-AT reporter genes were induced by PKC{alpha}A25E in a PKC{theta}-dependent manner, AP-1 induction by PKC{alpha}A25E was PKC{theta} independent, pointing to a potential divergence in PKC{alpha}-initiated pathways in T lymphocytes.


arrow
DISCUSSION
 
In this study, we have demonstrated a novel role for PKC{alpha} in T lymphocytes downstream of the CD3/CD28 engagement leading to the activation of the IKK complex and NF-{kappa}B. We conclude this based on observations that pharmacological inhibition of PKC{alpha}, expression of catalytically inactive PKC{alpha} or suppression of PKC{alpha}, but not PKCß1, expression, results in specific abrogation of the CD3/CD28-induced activity of the endogenous heterodimeric IKK complex without any effect on basal or TNF-{alpha}-induced IKK activity. This conclusion is further supported by a recent report that inhibition of PKC{alpha} expression, but not PKCß1, resulted in a profound decrease in IL-2R, IL-2, and TNF-{alpha} induction in Jurkat T cells (42). In addition, while the absence of PKCß abolished B-cell receptor-mediated IKK and NF-{kappa}B activation (53, 57), it did not affect the TCR-mediated signal transduction (38). Altogether these data indicate that PKC{alpha} mediates TCR-induced IKK and NF-{kappa}B activation, in contrast to PKCß, which plays a unique role in NF-{kappa}B regulation in B cells. Moreover, although PKC{theta} has been recently shown to be a critical molecule involved in the activation of NF-{kappa}B downstream of the TCR (16, 40, 58), our data place PKC{alpha} upstream of PKC{theta} in this process.

Another group of evidence that establishes the role of PKC{alpha} in NF-{kappa}B activation triggered by TCR/CD28 ligation was provided by using a constitutively active form of PKC{alpha}. Previous studies utilizing the constitutively active form of PKC{alpha} demonstrated that it had no significant effect on NF-{kappa}B activation in T cells (3, 16, 25, 40). However, we observed that the ability of such constitutively active form of PKC{alpha} to induce IKK and NF-{kappa}B in T cells depends on Ca2+ binding to its C2 regulatory domain. This contrasts with the Ca2+ independence of PKC{theta}, a kinase lacking the C2 regulatory domain, and explains the ability of a constitutively active PKC{theta} to activate NF-{kappa}B in the absence of Ca2+ influx. An increase in Ca2+ influx is known to promote PKC{alpha} translocation to the plasma cell membrane and subsequent binding to negatively charged phospholipids, steps that are required for PKC{alpha} autophosphorylation (12, 15, 44, 55, 65). Substitution of a key alanine for a charged residue within the PKC{alpha} pseudosubstrate (A25E) yields pseudosubstrate release and catalytic activity in vitro (3). However, this constitutively active PKC{alpha} fails to activate NF-{kappa}B until a secondary Ca2+ signal is given. We interpret the inability of PKC{alpha}A25E to induce NF-{kappa}B in the absence of Ca2+ as likely due to the lack of catalytic competency of PKC{alpha}A25E and/or the lack of required interaction with downstream targets on the cell membrane. It has been previously shown that mutations in the Ca2+ acceptor sites in the C2 domain block PKC{alpha} translocation to the plasma cell membrane (15). This would explain why the PKC{alpha}A25E/D246N-D248N mutant, which retains the A25E mutation that provides pseudosubstrate sequence release and catalytic activity (3), is unable to induce NF-{kappa}B activity compared to PKC{alpha}A25E, even when both are in the presence of ionomycin. From these observations, it is inferred that only the plasma membrane-bound PKC{alpha} can activate the IKK complex and hence, NF-{kappa}B. This conclusion is also supported by a previous report (29) indicating that expression of a PKC{alpha} transgene results in an accumulation of overexpressed PKC{alpha} on the cell membrane of T cells and subsequent hyperresponsiveness of these T cells to such weak stimuli as soluble antibodies to TCR. Therefore, it seems that targeting PKC{alpha} to the membrane significantly reduces the threshold of TCR signaling. It also appears that membrane localization is an absolute requirement for PKCs to activate NF-{kappa}B, since PKC{theta} can activate NF-{kappa}B only in the membrane-bound form (7). Deletion of the regulatory domain of PKC{theta}, similar to the mutation of calcium binding ligands in the regulatory domain of PKC{alpha}, abolishes binding to the cell membrane. This results in the complete incapability of either the constitutively active form of PKC{alpha} or catalytic domain of PKC{theta} to activate NF-{kappa}B in T cells. Taking into consideration that the IKK complex is recruited to the cell membrane following CD3/CD28 stimulation (34), it is possible that membrane-bound PKC{alpha} interacts in a similar way to PKC{theta} with the recruited IKK complex and subsequently activates it.

While the precise mechanism of IKK and NF-{kappa}B activation by PKC{alpha} remains to be defined, two important steps in PKC{alpha} signaling may be distinguished based on our kinetic data of the CD3/CD28-induced IKK complex activation in the presence of PKC inhibitors. First, there is an early phase (up to 5 min) of IKK complex activation that is rottlerin insensitive and is inhibited by either Gö6976 or by suppression of the PKC{alpha} gene. This represents the step at which PKC{alpha} acts independently of PKC{theta}. This possibility is supported by the previously published observation (37) that PKC{alpha} physically interacts with and activates IKKß. However, this transient PKC{alpha}-mediated IKK activation is not sufficient to provide adequate NF-{kappa}B transcription (Fig. 5C).

The question of interest is the mechanism of PKC{alpha} signaling in the second or late phase of IKK activation following CD3/CD28 stimulation. Our data demonstrate that this step is inhibited by both rottlerin and Gö6976. Moreover, selective suppression of either PKC{alpha} or PKC{theta} expression also abrogated this phase of IKK activation. Taken together with the observation that PKC{alpha}A25E-mediated activation of IKKß and NF-{kappa}B transcription is inhibited by rottlerin, suppression of PKC{theta} or expression of PKC{theta}K409R, our results suggest that in the late phase of the IKK complex activation, PKC{alpha} activates through the PKC{theta}-dependent pathway. Whereas the detailed mechanism of PKC{theta} upregulation by PKC{alpha} falls short in this study, two possible scenarios are under investigation. One is direct phosphorylation of PKC{theta} by PKC{alpha}, which takes place on the plasma membrane following CD3/CD28 stimulation. Another scenario can include PKC{alpha}-mediated Lck release from the intracytoplasmic domain of CD4 (51). Since activation of PKC{theta} requires recruitment by Lck to rafts (7) and the subsequent phosphorylation by Lck (41), it is likely that PKC{alpha} sustains Lck activation and therefore provides the prolonged stimulus required for optimal PKC{theta} activation. This possibility is supported by the observation that inhibition of either Lck or Src kinases results in a partial or complete inhibition of PKC{alpha}A25E-mediated NF-{kappa}B activation (data not shown). Therefore, PKC{alpha} may augment or extend PKC{theta} activity through an Src kinase-dependent pathway (unpublished data).

The identification of PKC{alpha} as another PKC isoform that mediates TCR-induced NF-{kappa}B activation is, in part, supported by the few facts previously known about PKC{alpha} regulation. PKC{alpha} translocates to the plasma cell membrane with similar kinetics to PKC{theta} following CD3/CD28 cross-linking (59), and specific inhibition of either PKC{alpha} or PKC{theta} abrogates the expression of IL-2R{alpha} following TCR ligation (59). Our data demonstrate that inhibition of either PKC{alpha} or PKC{theta} abrogates NF-{kappa}B activation in T lymphocytes. Our results indicate that participation of both PKC isoforms can provide prolonged IKK activation and subsequently efficient NF-{kappa}B transcription. Indeed, PKC{alpha} alone cannot activate NF-{kappa}B in PKC{theta}-deficient peripheral blood lymphocytes following CD3/CD28 ligation unless the lack of contribution of PKC{theta} is bypassed by phorbol ester and Ca2+ ionophore treatment (58). This observation suggests that PKC{alpha}-mediated activation of the IKK complex in mature T lymphocytes is too brief to provide adequate NF-{kappa}B transcription. However, stimulation with phorbol ester and ionomycin provides prolonged activation of PKC{alpha} that results in efficient IKK activation and NF-{kappa}B transcription in PKC{theta}-deficient lymphocytes. This is in contrast to immature PKC{theta}-deficient T cells, which demonstrate normal NF-{kappa}B activation following CD3/CD28 stimulation. Since the Ca2+ levels are more transient in immature T cells than in mature T cells (23), it remains possible that the time period of the direct activation of the IKK complex by PKC{alpha} can depend on the amplitude and duration of the Ca2+ influx in these two distinct cell populations.

Our data suggest that PKC{alpha} can interpret the amplitude and duration of Ca2+ levels in T cells. Indeed, the fact that only membrane-bound PKC{alpha} can activate the IKK complex and induce NF-{kappa}B transcription suggests that the time of PKC{alpha} interaction with the cell membrane may define the kinetics of IKK activation and the subsequent proficiency of NF-{kappa}B transcription. PKC{alpha} translocation to the plasma cell membrane requires a Ca2+ concentration higher than 600 nM (33, 47). Therefore, Ca2+ concentrations that are lower than 600 nM should fail to translocate PKC{alpha} to the plasma membrane and hence to activate NF-{kappa}B. In fact, Ca2+ concentrations higher than 600 nM are required to induce NF-{kappa}B (20, 21). Moreover, only Ca2+ influx, but not the release of Ca2+ from intracellular stores, results in NF-{kappa}B activation in T cells (32). Finally, we observed that inhibition of Ca2+ influx by EGTA resulted in a defect in the kinetics of IKK activation similar to that seen with PKC{alpha} RNA suppression or pretreatment with Gö6976. This defect in the kinetics of IKK activation abrogated the NF-{kappa}B-dependent transcription following CD3/CD28 stimulation (Fig. 5C and E) (data not shown).

The fact that PKC{alpha} activates IL-2, RE/AP, NF-{kappa}B, and NF-AT, but not AP-1, transcription in a rottlerin-sensitive manner, suggests the divergence of PKC{alpha}-mediated pathways in T lymphocytes. Normal MAP kinase (MAPK) activation in PKC{theta}-/- deficient cells also suggests this possibility of PKC{alpha}-dependent pathways in the activation of MAPK (58). We observed that suppression of PKC{alpha} not only abrogates NF-{kappa}B and IL-2 transcription (Fig. 5E and 7C), but also inhibits RE/AP, NF-AT, and AP-1 activation (unpublished observations). Therefore, PKC{alpha} may initiate two different signaling pathways: one that leads to NF-{kappa}B activation in a PKC{theta}-dependent manner and another that activates AP-1-mediated gene transcription independently of PKC{theta}. However, our kinetic data indicate that the first pathway, which is characterized by IKK activation in a PKC{theta}-dependent manner, occurs during the late phase of TCR activation (>5 min). Thus, we hypothesize that this pathway, which leads to the prolonged IKK activation and subsequent efficient NF-{kappa}B transcription, can represent a novel mechanism of TCR amplification that is mediated by PKC{alpha}. Therefore, the level of PKC{alpha}-mediated TCR amplification will depend on the amplitude and duration of the rise in Ca2+ following TCR engagement. This hypothesis is currently being investigated.

In summary, this study characterizes a novel role for PKC{alpha} in mediating the CD3/CD28 signaling pathways that lead to the activation of both the IKK complex and NF-{kappa}B in T lymphocytes. Our data suggest that PKC{alpha} represents a Ca2+-dependent component of the TCR/CD28 pathways, which can act upstream of PKC{theta} in the activation of NF-{kappa}B.


arrow
ACKNOWLEDGMENTS
 
This work was supported by the National Institutes of Health grant R01 AI36076 to C.V.P. and the Mayo Foundation. D.D.B. is supported by a Leukemia and Lymphoma Society Special Fellows Award and an Investigator Award from the Cancer Research Institute.

We thank Gary Bren for outstanding technical assistance and all the members of C. V. Paya's laboratory for thoughtful discussions. We also thank Teresa Hoff for excellent manuscript preparation.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Mayo Clinic, 200 First St. SW, Guggenheim 501, Rochester, MN 55905. Phone: (507) 284-3747. Fax: (507) 284-3757. E-mail: paya{at}mayo.edu. Back


arrow
REFERENCES
 
    1
  1. Baeuerle, P. A., and D. Baltimore. 1989. A 65-kD subunit of active NF-{kappa}B is required for inhibition of NF-{kappa}B by I{kappa}B. Genes Dev. 3:1689-1698.[Abstract/Free Full Text]
  2. 2
  3. Baier, G., D. Telford, L. Giampa, K. M. Coggeshall, G. Baier-Bitterlich, N. Isakov, and A. Altman. 1993. Molecular cloning and characterization of PKC{theta}, a novel member of the protein kinase C (PKC) gene family expressed predominantly in hematopoietic cells. J. Biol. Chem. 268:4997-5004.[Abstract/Free Full Text]
  4. 3
  5. Baier-Bitterlich, G., F. Überall, B. Bauer, F. Fresser, H. Wachter, H. Grunicke, G. Utermann, A. Altman, and G. Baier. 1996. Protein kinase C-{theta} isoenzyme selective stimulation of the transcription factor complex AP-1 in T lymphocytes. Mol. Cell. Biol. 16:1842-1850.[Abstract]
  6. 4
  7. Beg, A. A., S. M. Ruben, R. I. Scheinman, S. Haskill, C. A. Rosen, and A. S. Baldwin, Jr. 1992. I{kappa}B interacts with the nuclear localization sequences of the subunits of NF-{kappa}B: a mechanism for cytoplasmic retention. Genes Dev. 6:1899-1913.[Abstract/Free Full Text]
  8. 5
  9. Bell, M. P., C. J. Huntoon, D. Graham, and D. J. McKean. 2001. The analysis of costimulatory receptor signaling cascades in normal T lymphocytes using in vitro gene transfer and reporter gene analysis. Nat. Med. 7:1155-1158.[CrossRef][Medline]
  10. 6
  11. Berridge, M. J. 1993. Inositol trisphosphate and calcium signalling. Nature 361:315-325.[CrossRef][Medline]
  12. 7
  13. Bi, K., Y. Tanaka, N. Coudronniere, K. Sugie, S. Hong, M. J. van Stipdonk, and A. Altman. 2001. Antigen-induced translocation of PKC-{theta} to membrane rafts is required for T cell activation. Nat. Immunol. 2:556-563.[CrossRef][Medline]
  14. 8
  15. Brockman, J. A., D. C. Scherer, T. A. McKinsey, S. M. Hall, X. Qi, W. Y. Lee, and D. W. Ballard. 1995. Coupling of a signal response domain in I{kappa}B{alpha} to multiple pathways for NF-{kappa}B activation. Mol. Cell. Biol. 15:2809-2818.[Abstract]
  16. 9
  17. Brown, K., S. Gerstberger, L. Carlson, G. Franzoso, and U. Siebenlist. 1995. Control of I{kappa}B-{alpha} proteolysis by site-specific, signal-induced phosphorylation. Science 267:1485-1488.[Abstract/Free Full Text]
  18. 10
  19. Brummelkamp, T. R., R. Bernards, and R. Agami. 2002. A system for stable expression of short interfering RNAs in mammalian cells. Science 296:550-553.[Abstract/Free Full Text]
  20. 11
  21. Cao, Y., E. M. Janssen, A. W. Duncan, A. Altman, D. D. Billadeau, and R. T. Abraham. 2002. Pleiotropic defects in TCR signaling in a Vav-1-null Jurkat T-cell line. EMBO J. 21:4809-4819.[CrossRef][Medline]
  22. 12
  23. Cazaubon, S., F. Bornancin, and P. J. Parker. 1994. Threonine-497 is a critical site for permissive activation of protein kinase C {alpha}. Biochem. J. 301:443-448.
  24. 13
  25. Chen, D., and E. V. Rothenberg. 1993. Molecular basis for developmental changes in interleukin-2 gene inducibility. Mol. Cell. Biol. 13:228-237.[Abstract/Free Full Text]
  26. 14
  27. Clapham, D. E. 1995. Calcium signaling. Cell. 80:259-268.
  28. 15
  29. Corbalan-Garcia, S., J. A. Rodriguez-Alfaro, and J. C. Gomez-Fernandez. 1999. Determination of the calcium-binding sites of the C2 domain of protein kinase C {alpha} that are critical for its translocation to the plasma membrane. Biochem. J. 337:513-521.
  30. 16
  31. Coudronniere, N., M. Villalba, N. Englund, and A. Altman. 2000. NF-{kappa}B activation induced by T cell receptor/CD28 costimulation is mediated by protein kinase C-{theta}. Proc. Natl. Acad. Sci. USA 97:3394-3399.[Abstract/Free Full Text]
  32. 17
  33. Crabtree, G. R., and N. A. Clipstone. 1994. Signal transmission between the plasma membrane and nucleus of T lymphocytes. Annu. Rev. Biochem. 63:1045-1083.[CrossRef][Medline]
  34. 18
  35. DiDonato, J., F. Mercurio, C. Rosette, J. Wu-Li, H. Suyang, S. Ghosh, and M. Karin. 1996. Mapping of the inducible I{kappa}B phosphorylation sites that signal its ubiquitination and degradation. Mol. Cell. Biol. 16:1295-1304.[Abstract]
  36. 19
  37. DiDonato, J. A., M. Hayakawa, D. M. Rothwarf, E. Zandi, and M. Karin. 1997. A cytokine-responsive I{kappa}B kinase that activates the transcription factor NF-{kappa}B. Nature 388:548-554.[CrossRef][Medline]
  38. 20
  39. Dolmetsch, R. E., R. S. Lewis, C. C. Goodnow, and J. I. Healy. 1997. Differential activation of transcription factors induced by Ca2+ response amplitude and duration. Nature 386:855-858.[CrossRef][Medline]
  40. 21
  41. Dolmetsch, R. E., K. Xu, and R. S. Lewis. 1998. Calcium oscillations increase the efficiency and specificity of gene expression. Nature 392:933-936.[CrossRef][Medline]
  42. 22
  43. Frantz, B., E. C. Nordby, G. Bren, N. Steffan, C. V. Paya, R. L. Kincaid, M. J. Tocci, S. J. O'Keefe, and E. A. O'Neill. 1994. Calcineurin acts in synergy with PMA to inactivate I{kappa}B/MAD3, an inhibitor of NF-{kappa}B. EMBO J. 13:861-870.[Medline]
  44. 23
  45. Freedman, B. D., Q. H. Liu, S. Somersan, M. I. Kotlikoff, and J. A. Punt. 1999. Receptor avidity and costimulation specify the intracellular Ca2+ signaling pattern in CD4+CD8+ thymocytes. J. Exp. Med. 190:943-952.[Abstract/Free Full Text]
  46. 24
  47. Garcia-Paramio, P., Y. Cabrerizo, F. Bornancin, and P. J. Parker. 1998. The broad specificity of dominant inhibitory protein kinase C mutants infers a common step in phosphorylation. Biochem. J. 333:631-636.
  48. 25
  49. Genot, E. M., P. J. Parker, and D. A. Cantrell. 1995. Analysis of the role of protein kinase C-{alpha}, -{varepsilon}, and -{zeta} in T cell activation. J. Biol. Chem. 270:9833-9839.[Abstract/Free Full Text]
  50. 26
  51. Harhaj, E. W., and S. C. Sun. 1998. I{kappa}B kinases serve as a target of CD28 signaling. J. Biol. Chem. 273:25185-25190.[Abstract/Free Full Text]
  52. 27
  53. Hoyos, B., D. W. Ballard, E. Bohnlein, M. Siekevitz, and W. C. Greene. 1989. {kappa}B-specific DNA binding proteins: role in the regulation of human interleukin-2 gene expression. Science 244:457-460.[Abstract/Free Full Text]
  54. 28
  55. Imboden, J. B., and J. D. Stobo. 1985. Transmembrane signalling by the T cell antigen receptor. Perturbation of the T3-antigen receptor complex generates inositol phosphates and releases calcium ions from intracellular stores. J. Exp. Med. 161:446-456.[Abstract/Free Full Text]
  56. 29
  57. Iwamoto, T., M. Hagiwara, H. Hidaka, T. Isomura, D. Kioussis, and I. Nakashima. 1992. Accelerated proliferation and interleukin-2 production of thymocytes by stimulation of soluble anti-CD3 monoclonal antibody in transgenic mice carrying a rabbit protein kinase C {alpha}. J. Biol. Chem. 267:18644-18648.[Abstract/Free Full Text]
  58. 30
  59. Jain, J., C. Loh, and A. Rao. 1995. Transcriptional regulation of the IL-2 gene. Curr. Opin. Immunol. 7:333-342.[CrossRef][Medline]
  60. 31
  61. Jamieson, C., P. G. McCaffrey, A. Rao, and R. Sen. 1991. Physiologic activation of T cells via the T cell receptor induces NF-{kappa}B. J. Immunol. 147:416-420.[Abstract]
  62. 32
  63. Kanno, T., and U. Siebenlist. 1996. Activation of nuclear factor-{kappa}B via T cell receptor requires a Raf kinase and Ca2+ influx. Functional synergy between Raf and calcineurin. J. Immunol. 157:5277-5283.[Abstract]
  64. 33
  65. Keranen, L. M., and A. C. Newton. 1997. Ca2+ differentially regulates conventional protein kinase Cs' membrane interaction and activation. J. Biol. Chem. 272:25959-25967.[Abstract/Free Full Text]
  66. 34
  67. Khoshnan, A., S. J. Kempiak, B. L. Bennett, D. Bae, W. Xu, A. M. Manning, C. H. June, and A. E. Nel. 1999. Primary human CD4+ T cells contain heterogeneous I{kappa}B kinase complexes: role in activation of the IL-2 promoter. J. Immunol. 163:5444-5452.[Abstract/Free Full Text]
  68. 35
  69. Kieran, M., V. Blank, F. Logeat, J. Vandekerckhove, F. Lottspeich, O. Le Bail, M. B. Urban, P. Kourilsky, P. A. Baeuerle, and A. Israel. 1990. The DNA binding subunit of NF-{kappa}B is identical to factor KBF1 and homologous to the rel oncogene product. Cell 62:1007-1018.[CrossRef][Medline]
  70. 36
  71. Lai, J.-H., G. Horvath, J. Subleski, J. Bruder, P. Ghosh, and T.-H. Tan. 1995. RelA is a potent transcriptional activator of the CD28 response element within the interleukin 2 promoter. Mol. Cell. Biol. 15:4260-4271.[Abstract]
  72. 37
  73. Lallena, M. J., M. T. Diaz-Meco, G. Bren, C. V. Payá, and J. Moscat. 1999. Activation of I{kappa}B kinase ß by protein kinase C isoforms. Mol. Cell. Biol. 19:2180-2188.[Abstract/Free Full Text]
  74. 38
  75. Leitges, M., C. Schmedt, R. Guinamard, J. Davoust, S. Schaal, S. Stabel, and A. Tarakhovsky. 1996. Immunodeficiency in protein kinase cß-deficient mice. Science 273:788-791.[Abstract]
  76. 39
  77. Lin, X., E. T. Cunningham, Jr., Y. Mu, R. Geleziunas, and W. C. Greene. 1999. The proto-oncogene Cot kinase participates in CD3/CD28 induction of NF-{kappa}B acting through the NF-{kappa}B-inducing kinase and I{kappa}B kinases. Immunity 10:271-280.[CrossRef][Medline]
  78. 40
  79. Lin, X., A. O'Mahony, Y. Mu, R. Geleziunas, and W. C. Greene. 2000. Protein kinase C-{theta} participates in NF-{kappa}B activation induced by CD3-CD28 costimulation through selective activation of I{kappa}B kinase ß. Mol. Cell. Biol. 20:2933-2940.[Abstract/Free Full Text]
  80. 41
  81. Liu, Y., S. Witte, Y. C. Liu, M. Doyle, C. Elly, and A. Altman. 2000. Regulation of protein kinase C{theta} function during T cell activation by Lck-mediated tyrosine phosphorylation. J. Biol. Chem. 275:3603-3609.[Abstract/Free Full Text]
  82. 42
  83. Lopez-Lago, M. A., J. Freire-Moar, and P. Barja. 1999. Inhibition of protein kinase C {alpha} expression by antisense RNA in transfected Jurkat cells. Eur. J. Immunol. 29:466-476.[CrossRef][Medline]
  84. 43
  85. Martiny-Baron, G., M. G. Kazanietz, H. Mischak, P. M. Blumberg, G. Kochs, H. Hug, D. Marme, and C. Schachtele. 1993. Selective inhibition of protein kinase C isozymes by the indolocarbazole Go 6976. J. Biol. Chem. 268:9194-9197.[Abstract/Free Full Text]
  86. 44
  87. Medkova, M., and W. Cho. 1998. Mutagenesis of the C2 domain of protein kinase C-{alpha}. Differential roles of Ca2+ ligands and membrane binding residues. J. Biol. Chem. 273:17544-17552.[Abstract/Free Full Text]
  88. 45
  89. Mercurio, F., J. A. DiDonato, C. Rosette, and M. Karin. 1993. p105 and p98 precursor proteins play an active role in NF-{kappa}B-mediated signal transduction. Genes Dev. 7:705-718.[Abstract/Free Full Text]
  90. 46
  91. Mercurio, F., H. Zhu, B. W. Murray, A. Shevchenko, B. L. Bennett, J. Li, D. B. Young, M. Barbosa, M. Mann, A. Manning, and A. Rao. 1997. IKK-1 and IKK-2: cytokine-activated I{kappa}B kinases essential for NF-{kappa}B activation. Science 278:860-866.[Abstract/Free Full Text]
  92. 47
  93. Mosior, M., and R. M. Epand. 1994. Characterization of the calcium-binding site that regulates association of protein kinase C with phospholipid bilayers. J. Biol. Chem. 269:13798-13805.[Abstract/Free Full Text]
  94. 48
  95. Newton, A. C. 1995. Protein kinase C: structure, function, and regulation. J. Biol. Chem. 270:28495-28498.[Free Full Text]
  96. 49
  97. Newton, A. C., and J. E. Johnson. 1998. Protein kinase C: a paradigm for regulation of protein function by two membrane-targeting modules. Biochim. Biophys. Acta 1376:155-172.[Medline]
  98. 50
  99. Nolan, G. P., S. Ghosh, H. C. Liou, P. Tempst, and D. Baltimore. 1991. DNA binding and I{kappa}B inhibition of the cloned p65 subunit of NF-{kappa}B, a rel-related polypeptide. Cell 64:961-969.[CrossRef][Medline]
  100. 51
  101. Parolini, I., S. Topa, M. Sorice, A. Pace, P. Ceddia, E. Montesoro, A. Pavan, M. P. Lisanti, C. Peschle, and M. Sargiacomo. 1999. Phorbol ester-induced disruption of the CD4-Lck complex occurs within a detergent-resistant microdomain of the plasma membrane. Involvement of the translocation of activated protein kinase C isoforms. J. Biol. Chem. 274:14176-14187.[Abstract/Free Full Text]
  102. 52
  103. Regnier, C. H., H. Y. Song, X. Gao, D. V. Goeddel, Z. Cao, and M. Rothe. 1997. Identification and characterization of an I{kappa}B kinase. Cell 90:373-383.[CrossRef][Medline]
  104. 53
  105. Saijo, K., I. Mecklenbrauker, A. Santana, M. Leitger, C. Schmedt, and A. Tarakhovsky. 2002. Protein kinase C ß controls nuclear factor {kappa}B activation in B cells through selective regulation of the I{kappa}B kinase {alpha}. J. Exp. Med. 195:1647-1652.[Abstract/Free Full Text]
  106. 54
  107. Sen, J., L. Venkataraman, Y. Shinkai, J. W. Pierce, F. W. Alt, S. J. Burakoff, and R. Sen. 1995. Expression and induction of nuclear factor-{kappa}B-related proteins in thymocytes. J. Immunol. 154:3213-3221.[Abstract]
  108. 55
  109. Shao, X., B. A. Davletov, R. B. Sutton, T. C. Sudhof, and J. Rizo. 1996. Bipartite Ca2+-binding motif in C2 domains of synaptotagmin and protein kinase C. Science 273:248-251.[Abstract]
  110. 56
  111. Soltoff, S. P. 2001. Rottlerin is a mitochondrial uncoupler that decreases cellular ATP levels and indirectly blocks protein kinase Cdelta tyrosine phosphorylation. J. Biol. Chem. 276:37986-37992.[Abstract/Free Full Text]
  112. 57
  113. Su, T. T., B. Guo, Y. Kawakami, K. Sommer, K. Chae, L. A. Humphries, R. M. Kato, S. Kang, L. Patrone, R. Wall, M. Teitell, M. Leitges, T. Kawakami, and D. J. Rawlings. 2002. PKC-ß controls I{kappa}B kinase lipid raft recruitment and activation in response to BCR signaling. Nat. Immunol. 3:780-786.[Medline]
  114. 58
  115. Sun, Z., C. W. Arendt, W. Ellmeier, E. M. Schaeffer, M. J. Sunshine, L. Gandhi, J. Annes, D. Petrzilka, A. Kupfer, P. L. Schwartzberg, and D. R. Littman. 2000. PKC-{theta} is required for TCR-induced NF-{kappa}B activation in mature but not immature T lymphocytes. Nature 404:402-407.[CrossRef][Medline]
  116. 59
  117. Szamel, M., A. Appel, R. Schwinzer, and K. Resch. 1998. Different protein kinase C isoenzymes regulate IL-2 receptor expression or IL-2 synthesis in human lymphocytes stimulated via the TCR. J. Immunol. 160:2207-2214.[Abstract/Free Full Text]
  118. 60
  119. Thompson, J. E., R. J. Phillips, H. Erdjument-Bromage, P. Tempst, and S. Ghosh. 1995. I{kappa}B{alpha} regulates the persistent response in a biphasic activation of NF-{kappa}B. Cell 80:573-582.[CrossRef][Medline]
  120. 61
  121. Toullec, D., P. Pianetti, H. Coste, P. Bellevergue, T. Grand-Perret, M. Ajakane, V. Baudet, P. Boissin, E. Boursier, F. Loriolle et al. 1991. The bisindolylmaleimide GF 109203X is a potent and selective inhibitor of protein kinase C. J. Biol. Chem. 266:15771-15781.[Abstract/Free Full Text]
  122. 62
  123. Traenckner, E. B., H. L. Pahl, T. Henkel, K. N. Schmidt, S. Wilk, and P. A. Baeuerle. 1995. Phosphorylation of human I{kappa}B{alpha} on serines 32 and 36 controls I{kappa}B-{alpha} proteolysis and NF-{kappa}B activation in response to diverse stimuli. EMBO J. 14:2876-2883.[Medline]
  124. 63
  125. Trushin, S. A., K. N. Pennington, A. Algeciras-Schimnich, and C. V. Paya. 1999. Protein kinase C and calcineurin synergize to activate I{kappa}aB kinase and NF-{kappa}B in T lymphocytes. J. Biol. Chem. 274:22923-22931.[Abstract/Free Full Text]
  126. 64
  127. Valge, V. E., J. G. Wong, B. M. Datlof, A. J. Sinskey, and A. Rao. 1988. Protein kinase C is required for responses to T cell receptor ligands but not to interleukin-2 in T cells. Cell 55:101-112.[CrossRef][Medline]
  128. 65
  129. Verdaguer, N., S. Corbalan-Garcia, W. F. Ochoa, I. Fita, and J. C. Gomez-Fernandez. 1999. Ca2+ bridges the C2 membrane-binding domain of protein kinase C{alpha} directly to phosphatidylserine. EMBO J. 18:6329-6338.[CrossRef][Medline]
  130. 66
  131. Villalba, M., S. Kasibhatla, L. Genestier, A. Mahboubi, D. R. Green, and A. Altman. 1999. Protein kinase C{theta} cooperates with calcineurin to induce Fas ligand expression during activation-induced T cell death. J. Immunol. 163:5813-5819.[Abstract/Free Full Text]
  132. 67
  133. Werlen, G., E. Jacinto, Y. Xia, and M. Karin. 1998. Calcineurin preferentially synergizes with PKC-{theta} to activate JNK and IL-2 promoter in T lymphocytes. EMBO J. 17:3101-3111.[CrossRef][Medline]
  134. 68
  135. Whiteside, S. T., M. K. Ernst, O. LeBail, C. Laurent-Winter, N. Rice, and A. Israël. 1995. N- and C-terminal sequences control degradation of MAD3/I{kappa}B{alpha} in response to inducers of NF-{kappa}B activity. Mol. Cell. Biol. 15:5339-5345.[Abstract]
  136. 69
  137. Woronicz, J. D., X. Gao, Z. Cao, M. Rothe, and D. V. Goeddel. 1997. I{kappa}B kinase-ß: NF-{kappa}B activation and complex formation with I{kappa}B kinase-{alpha} and NIK. Science 278:866-869.[Abstract/Free Full Text]
  138. 70
  139. Zandi, E., D. M. Rothwarf, M. Delhase, M. Hayakawa, and M. Karin. 1997. The I{kappa}B kinase complex (IKK) contains two kinase subunits, IKK{alpha} and IKKß, necessary for I{kappa}B phosphorylation and NF-{kappa}B activation. Cell 91:243-252.[CrossRef][Medline]


Molecular and Cellular Biology, October 2003, p. 7068-7081, Vol. 23, No. 19
0270-7306/03/$08.00+0     DOI: 10.1128/MCB.23.19.7068-7081.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Deb, D. K., Chen, Y., Zhang, Z., Zhang, Y., Szeto, F. L., Wong, K. E., Kong, J., Li, Y. C. (2009). 1,25-Dihydroxyvitamin D3 suppresses high glucose-induced angiotensinogen expression in kidney cells by blocking the NF-{kappa}B pathway. Am. J. Physiol. Renal Physiol. 296: F1212-F1218 [Abstract] [Full Text]  
  • Sun, J., Ramnath, R. D., Tamizhselvi, R., Bhatia, M. (2009). Role of protein kinase C and phosphoinositide 3-kinase-Akt in substance P-induced proinflammatory pathways in mouse macrophages. FASEB J. 23: 997-1010 [Abstract] [Full Text]  
  • Bair, A. M., Thippegowda, P. B., Freichel, M., Cheng, N., Ye, R. D., Vogel, S. M., Yu, Y., Flockerzi, V., Malik, A. B., Tiruppathi, C. (2009). Ca2+ Entry via TRPC Channels Is Necessary for Thrombin-induced NF-{kappa}B Activation in Endothelial Cells through AMP-activated Protein Kinase and Protein Kinase C{delta}. J. Biol. Chem. 284: 563-574 [Abstract] [Full Text]  
  • Mellstrom, B., Savignac, M., Gomez-Villafuertes, R., Naranjo, J. R. (2008). Ca2+-Operated Transcriptional Networks: Molecular Mechanisms and In Vivo Models. Physiol. Rev. 88: 421-449 [Abstract] [Full Text]  
  • Sun, C. C., Thorley-Lawson, D. A. (2007). Plasma Cell-Specific Transcription Factor XBP-1s Binds to and Transactivates the Epstein-Barr Virus BZLF1 Promoter. J. Virol. 81: 13566-13577 [Abstract] [Full Text]  
  • Yu, X., Sun, J.-P., He, Y., Guo, X., Liu, S., Zhou, B., Hudmon, A., Zhang, Z.-Y. (2007). Structure, inhibitor, and regulatory mechanism of Lyp, a lymphoid-specific tyrosine phosphatase implicated in autoimmune diseases. Proc. Natl. Acad. Sci. USA 104: 19767-19772 [Abstract] [Full Text]  
  • Nolz, J. C., Fernandez-Zapico, M. E., Billadeau, D. D. (2007). TCR/CD28-Stimulated Actin Dynamics Are Required for NFAT1-Mediated Transcription of c-rel Leading to CD28 Response Element Activation. J. Immunol. 179: 1104-1112 [Abstract] [Full Text]  
  • Pfeifhofer, C., Gruber, T., Letschka, T., Thuille, N., Lutz-Nicoladoni, C., Hermann-Kleiter, N., Braun, U., Leitges, M., Baier, G. (2006). Defective IgG2a/2b Class Switching in PKC{alpha}-/- Mice. J. Immunol. 176: 6004-6011 [Abstract] [Full Text]  
  • Liu, A. M. F., Wong, Y. H. (2005). Activation of Nuclear Factor {kappa}B by Somatostatin Type 2 Receptor in Pancreatic Acinar AR42J Cells Involves G{alpha}14 and Multiple Signaling Components: A MECHANISM REQUIRING PROTEIN KINASE C, CALMODULIN-DEPENDENT KINASE II, ERK, AND c-Src. J. Biol. Chem. 280: 34617-34625 [Abstract] [Full Text]  
  • Trushin, S. A., Bren, G. D., Asin, S., Pennington, K. N., Paya, C. V., Badley, A. D. (2005). Human Immunodeficiency Virus Reactivation by Phorbol Esters or T-Cell Receptor Ligation Requires both PKC{alpha} and PKC{theta}. J. Virol. 79: 9821-9830 [Abstract] [Full Text]  
  • Huang, Y., Norton, D. D., Precht, P., Martindale, J. L., Burkhardt, J. K., Wange, R. L. (2005). Deficiency of ADAP/Fyb/SLAP-130 Destabilizes SKAP55 in Jurkat T Cells. J. Biol. Chem. 280: 23576-23583 [Abstract] [Full Text]  
  • Zhao, D., Zhan, Y., Zeng, H., Koon, H.-W., Moyer, M. P., Pothoulakis, C. (2005). Neurotensin Stimulates Interleukin-8 Expression through Modulation of I{kappa}B{alpha} Phosphorylation and p65 Transcriptional Activity: Involvement of Protein Kinase C{alpha}. Mol. Pharmacol. 67: 2025-2031 [Abstract] [Full Text]  
  • Cataisson, C., Pearson, A. J., Torgerson, S., Nedospasov, S. A., Yuspa, S. H. (2005). Protein Kinase C{alpha}-Mediated Chemotaxis of Neutrophils Requires NF-{kappa}B Activity but Is Independent of TNF{alpha} Signaling in Mouse Skin In Vivo. J. Immunol. 174: 1686-1692 [Abstract] [Full Text]  
  • Liu, A. M. F., Wong, Y. H. (2004). G16-mediated Activation of Nuclear Factor {kappa}B by the Adenosine A1 Receptor Involves c-Src, Protein Kinase C, and ERK Signaling. J. Biol. Chem. 279: 53196-53204 [Abstract] [Full Text]  
  • Thallas-Bonke, V., Lindschau, C., Rizkalla, B., Bach, L. A., Boner, G., Meier, M., Haller, H., Cooper, M. E., Forbes, J. M. (2004). Attenuation of Extracellular Matrix Accumulation in Diabetic Nephropathy by the Advanced Glycation End Product Cross-Link Breaker ALT-711 via a Protein Kinase C-{alpha}-Dependent Pathway. Diabetes 53: 2921-2930 [Abstract] [Full Text]  
  • Huang, Y., Wange, R. L. (2004). T Cell Receptor Signaling: Beyond Complex Complexes. J. Biol. Chem. 279: 28827-28830 [Full Text]  
  • Mattioli, I., Sebald, A., Bucher, C., Charles, R.-P., Nakano, H., Doi, T., Kracht, M., Schmitz, M. L. (2004). Transient and Selective NF-{kappa}B p65 Serine 536 Phosphorylation Induced by T Cell Costimulation Is Mediated by I{kappa}B Kinase {beta} and Controls the Kinetics of p65 Nuclear Import. J. Immunol. 172: 6336-6344 [Abstract] [Full Text]  
  • Chen, X.-M., Huang, B. Q., Splinter, P. L., Orth, J. D., Billadeau, D. D., McNiven, M. A., LaRusso, N. F. (2004). Cdc42 and the Actin-Related Protein/Neural Wiskott-Aldrich Syndrome Protein Network Mediate Cellular Invasion by Cryptosporidium parvum. Infect. Immun. 72: 3011-3021 [Abstract] [Full Text]  
  • Liu, A., Hoffman, P. W., Lu, W., Bai, G. (2004). NF-{kappa}B Site Interacts with Sp Factors and Up-regulates the NR1 Promoter during Neuronal Differentiation. J. Biol. Chem. 279: 17449-17458 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Trushin, S. A.
Right arrow Articles by Paya, C. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Trushin, S. A.
Right arrow Articles by Paya, C. V.