Previous Article | Next Article ![]()
Molecular and Cellular Biology, January 2003, p. 733-743, Vol. 23, No. 2
0270-7306/03/$08.00+0 DOI: 10.1128/MCB.23.2.733-743.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Cell Biology Program, Memorial Sloan-Kettering Cancer Center and Cornell University Graduate School of Medical Sciences, New York, New York 10021
Received 4 September 2002/ Returned for modification 14 October 2002/ Accepted 24 October 2002
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Potential mechanisms of LOH can be inferred from combined analyses of tumor karyotypes and markers that are polymorphic between parental chromosomes. Researchers analyzing human cancers have inferred that LOH arises from several pathways, including chromosomal deletion, mitotic nondisjunction, and recombination between homologous chromosomes (18, 25). In retinoblastoma, recombination and nondisjunction appear to be common pathways (42 and 51% of LOH events, respectively, in one large study) (15); however, a recent study of colorectal cancers found that deletions associated with chromosome structural aberrations are more common (52). Each of these pathways has also been implicated in generating LOH in mouse models, with mitotic recombination predominating in many of these cases (18, 46). Despite the implication of several pathways in the generation of LOH, little is understood about the molecular events that lead to LOH, including those involving mitotic recombination pathways.
Chromosomal double-strand breaks (DSBs) are extremely potent inducers of homologous recombination in mammalian cells (17), raising the issue of whether they are the causative lesions for LOH by allelic recombination. During meiosis, DSBs generated by the Spo11 protein induce a high frequency of recombination between homologous chromosomes (20). Although Spo11 is expressed primarily during meiosis (21, 44), DSBs can be generated in nonmeiotic cells in several ways, for example, by oxygen free radicals, topoisomerase failure, radiation treatment, and DNA replication. Repair of these mitotic DSBs by homologous recombination involves strand invasion of a broken end into a homologous sequence which templates repair by gene conversion (17, 38) and thus can be termed homology-directed repair (HDR).
In mitotically dividing mammalian cells, the identical-sister chromatid is the most frequently used template for HDR (19). HDR involving the sister restores the intact chromatid without loss of sequence information, making this a very precise type of repair. High-fidelity repair is not guaranteed, however, when the template for HDR is the allele on the homologous chromosome, since maternal and paternal chromosomes are not identical in individuals. Such events can lead to LOH of large chromosome segments or even whole chromosome arms when recombination between the homologs is associated with either crossing over or extensive gene conversion without crossing over. DSBs have previously been shown to induce HDR between homologous chromosomes in mammalian cells at a recombination reporter, resulting in LOH at the reporter (35). However, in that study the full extent of LOH could not be determined because the two chromosomes were isogenic outside of the reporter substrate.
In this report, we sought to test whether HDR in mammalian cells leads to extensive LOH by using a reporter for DSB-induced allelic recombination. The reporter was introduced into a mouse embryonic stem (ES) cell line derived from an F1 hybrid of two different inbred mouse strains, BALB/c and 129/Sv, such that the maternal and paternal chromosomes contain polymorphic markers. Overall, the heterology between the two strains is estimated at approximately one single-nucleotide polymorphism per 1,050 bp (27), which is within the range of diversity in the human population (estimated at one single-nucleotide polymorphism per 1,000 to 2,000 bp) (45). We find that although spontaneous recombination at the allelic positions is not detectable, DSBs are potent inducers of allelic recombination. Examination of a number of markers indicates that the majority of recombinant clones have LOH restricted to the site of the DSB, although 2% of recombinants exhibit LOH extending to a marker 6 kb from the DSB. Importantly, we find no evidence of LOH extending to polymorphic markers 1 centimorgan (cM) or more from the DSB nor do we find evidence for crossing over between alleles. These results indicate that extensive LOH is suppressed during HDR of a DSB in mammalian cells. Thus, either DSBs are not the causative lesions for extensive LOH events arising from recombination between homologous chromosomes or the suppression of extensive LOH can be relieved under some circumstances.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The S/P cell line was generated with four steps of genome manipulation. First, the SH targeting vector (70 µg; linearized with HpaI) was electroporated into the v17.2 cell line (54) (5 x 106 ES cells suspended in 700 µl of phosphate-buffered saline [PBS] in a 0.4-cm-path-length cuvette) by pulsing the cells at 800 V and 3 µF. Hygromycin selection was applied 24 h later at 150 µg/ml. After 10 days, surviving colonies were isolated and analyzed for targeting to Rb as previously described (51). Subsequently, the hyg gene was deleted by recombination between the loxP sites, as initiated by electroporation of 50 µg of a Cre expression vector (pCAGGS-Cre) (1) into 5 x 106 SH cells suspended in 700 µl of PBS in a 0.4-cm-path-length cuvette, followed by pulsing the cells at 250 V and 950 µF. The transfected cells were plated at low density, and after 10 days, colonies were isolated and screened for sensitivity to 150 µg of hygromycin/ml. Loss of the hyg gene to form the S cell line was confirmed by Southern blotting of HindIII/StuI-digested genomic DNA with an EcoRI/NcoI fragment of the neo gene as a probe. Using the PH targeting vector and the same steps described above for the generation of the S allele, the P allele was then created by targeting the S cell line.
DSB induction of allelic recombination and I-SceI site loss. To measure the repair of an I-SceI-generated DSB, 50 µg of the I-SceI expression vector pCBASce (43) was mixed with 5 x 106 ES cells suspended in 650 µl of PBS in a 0.4-cm-path-length cuvette, followed by pulsing the cells at 200 V and 950 µF. Transfected cells were split to four or five 10-cm-diameter plates. At 24 h, one plate was trypsinized and counted to determine the number of cells that had survived electroporation. For the rest of the plates, G418 was applied at 200 µg/ml 24 h after transfection. After 8 to 10 days, surviving colonies were either stained and counted or expanded for further analysis. Allelic recombination frequencies were determined by dividing the number of G418-resistant colonies by the number of cells that survived electroporation.
To determine the percentage of I-SceI site loss for each electroporation, the neo gene of the S allele was amplified from genomic DNA from cells that had been electroporated with the I-SceI expression vector and grown without G418 for 5 days. Genomic DNA (1 µg) was used as the template for PCR with 40 ng of each primer in a reaction volume of 25 µl. The primers for amplification were rb1 (5' AGGAATGCAGAGTTCTGCTTTAGC) and p6+ (5' GAGAAGGGATTGGTTTTTGTTTTCG). Amplifications were performed using PCR beads (Amersham Pharmacia) in the Mastercycler PCR system (Eppendorf). Amplification was for a total of 35 cycles, using a 1-min elongation time and a 58.1°C annealing temperature. Following amplification, PCR products were digested with I-SceI for 20 h with 10 U of I-SceI (Roche) and separated on a 1% agarose gel. The gel was stained with ethidium bromide, and the ethidium signals for the I-SceI-resistant and I-SceI-cleaved bands were quantified with a Bio-Rad Chemidoc 2000 system with rolling disk background subtraction.
Genotypic analysis of polymorphic markers. The genotype of a number of markers was determined through analysis of genomic DNA isolated from individual G418-resistant clones and also from the parental S/P cell line. The genotypes of a number of these markers involved amplification and resolution of PCR products, which was performed as described above for I-SceI site loss but using different sets of primers. The genotype of the NcoI/I-SceI site was determined using the primers rb1 and p6- (5' ATACTTGAGAAGGGATTGGTTTTTG), followed by cleavage of the PCR product with NcoI or I-SceI. The genotype of the H3 marker was determined using the primers rb1 and p6-, followed by cleavage of the PCR product with HindIII. The genotype of the P6 marker was determined using the rb1 and p6+ primers. The genotypes of the Rbtg-repeat marker were determined using the primers rbtg1 (5' GAATTCACCAATGAGGTCCCATAG) and rbtg2 (5' CAGATGCCAATATCGACTGAAAAG). The genotypes of the D14Mit160, D14Mit224, and D14Mit95 markers were determined using primer sets whose sequences were published previously (4). The amplification products of the TG-repeat markers were separated on 3% Metaphor agarose gels (BioWhittaker Molecular Applications). The genotype of the St marker was determined by Southern blotting of genomic DNA cleaved with StuI by using an EcoRI/NcoI fragment of the neo gene as a probe.
Crossing-over analysis. To test for crossing over in the crossover 1 (co1) interval, the neo genes of individual G418-resistant clones were amplified with the rb1 and p6+ primers followed by cleavage of the PCR product with EagI or PacI. To test for a crossing-over event in the interval co2, 8 µg of genomic DNA from individual G418-resistant clones was cleaved with StuI and separated on a 1% agarose gel. For each sample, genomic DNA of approximately 4 to 5 kb was isolated followed by purification of the DNA from the gel slice by using the High Pure PCR product purification kit (Roche). The neo genes were amplified from this size-enriched genomic DNA by using primers ep1 (5' CCAATGTCGAGCAAACCCCGCC) and ep2 (5' GCGTATGCAGCCGCCGCATTGC), followed by cleavage of the PCR product with EagI or PacI.
| RESULTS |
|---|
|
|
|---|
To study recombination events between alleles on homologous chromosomes, the S2neo and Pneo genes were gene targeted to allelic positions at the Rb locus on chromosome 14 in a cell line in which the homologous chromosomes contain polymorphic markers (Fig. 1A). Specifically, we used an ES cell line isolated from F1 hybrid mouse embryos, cell line v17.2, in which one set of chromosomes is derived from the 129/Sv strain and the other set is from the BALB/c strain (54). Strain differences between the chromosomes include restriction fragment polymorphisms at the Rb locus (51) as well as a number of short-sequence-length-polymorphism (SSLP) markers throughout chromosome 14 (4, 54).
|
Allelic recombination is strongly induced by a DSB but is 1,000-fold less efficient than nonhomologous end joining (NHEJ). We tested the efficiency of DSB-induced recombination at the neo genes in the S/P cell line by transfecting an I-SceI expression vector and selecting for allelic recombinants with G418. G418-resistant colonies arose at a frequency of 4.6 x 10-5 ± 1.5 x 10-5 relative to the number of cells surviving transfection. This frequency of allelic recombination is similar to that of a previous measure of allelic recombination in an isogenic ES cell line (43), although it is significantly lower than that of intrachromosomal recombination (36, 39). In contrast, no G418-resistant clones arose from untransfected cells (<3.7 x 10-7), indicating that spontaneous recombination at allelic positions is extremely rare.
To verify that the G418-resistant clones were the result of allelic recombination, we tested whether the I-SceI site in the S allele was converted to an NcoI site, which is the wild-type neo sequence at this position in the P allele (Fig. 2A). The neo genes from both alleles were amplified from genomic DNA of 29 individual G418-resistant colonies by using non-allele-specific primers (rb1 and p6-), and the amplified product was cleaved with either I-SceI or NcoI (Fig. 2B). We found that the amplified products of all 29 G418-resistant clones were completely cleaved by NcoI but not at all by I-SceI. This contrasts with the amplified product of the parental S/P cell line, which was approximately half cleaved by each of I-SceI and I-NcoI. Thus, the G418-resistant clones are derived from DSB repair of the S allele by allelic recombination using the P allele as the template, resulting in homozygosity at the DSB site.
|
LOH is generally limited to the vicinity of the DSB. To determine whether LOH extends beyond the immediate vicinity of the break site, we analyzed recombinants for markers that are heterozygous between the P and S alleles in the parental cell line. We began by assaying the genotypes of four heterozygous markers located downstream of the I-SceI site which are at the end of the neo gene and within the Rb locus itself (Fig. 3A). H3, the heterozygous marker closest to the DSB, is a HindIII restriction site polymorphism 0.3 kb from the DSB which is present on the P allele (H3+) but absent from the S allele (H3-). To test the genotype of the H3 marker in individual recombinants, we used non-allele-specific primers (rb1 and p6-) to amplify the neo genes of the S and P alleles and cleaved the amplified product with HindIII (Fig. 3B). From 162 individual recombinants, we found that 145 gave an amplified product that, like the parental S/P cells, was approximately half cleaved by HindIII, indicating that these recombinants contain both the H3+ and H3- polymorphisms (e.g., recombinant R1) (Fig. 3B). Thus, the majority of recombinants maintained heterozygosity 0.3 kb from the DSB site. In 17 of the 162 recombinants (10.5%), however, the amplified product was completely cleaved by HindIII (e.g., recombinant R2), indicating that these recombinants contain only the H3+ polymorphism. Thus, these recombinants exhibit LOH extending at least 0.3 kb from the DSB site (Fig. 4).
|
|
We also examined LOH of two additional markers in the Rb locus. We analyzed these markers in all 17 recombinants that exhibited LOH at the H3 marker as well as in 15 of the 145 recombinants that did not. The first of these two markers, St, is located 4 kb from the DSB and is a StuI restriction site polymorphism which is present on the S allele (St+) but is absent from the P allele (St-). The genotype of this marker was tested by Southern blot analysis using a neo gene fragment as probe for detection of genomic DNA cleaved with StuI (Fig. 3A and D). The other marker, Rbtg, located 6 kb from the DSB, is a TG-repeat polymorphism, with 20 TG repeats on the S allele (Rbtg20) and 13 TG repeats on the P allele (Rbtg13). The genotype of this marker was analyzed by PCR using primers that flank the repeats (rbtg1 and rbtg2), followed by separation of the amplified products on high-percentage agarose gels (Fig. 3A and E). We found that the StuI restriction site was lost in 4 of the 32 analyzed recombinants and that the Rbtg20 polymorphism was lost in 3 of the 32 recombinants (Fig. 4). All four recombinants with LOH at the St marker also have LOH at the H3 and P6 markers, and all three recombinants with LOH at the Rbtg marker also have LOH at the St, H3, and P6 markers. Thus, LOH of a distal marker in recombinants is accompanied by LOH of more-proximal markers in the interval to the DSB site such that the LOH tracts are continuous. The analysis indicates that a small percentage of the overall recombinants (1.9%) exhibit LOH of markers extending at least 6 kb from the DSB.
Heterozygosity is maintained in allelic recombinants at markers
1 cM from the DSB.
While we recovered recombinants in which LOH extended at least several kilobases, it was not clear whether LOH extended to loci significantly more distant from the DSB and thus whether these recombinants underwent a substantial loss of allele-specific information along the chromosome arm. To test this, we examined three SSLP markers consisting of TG-repeat-length polymorphisms between the 129/Sv and BALB/c strains. These markers are located 1 and 13 cM telomeric (D14Mit224 and D14Mit95, respectively) and 1 cM centromeric (D14Mit160) to the Rb locus, from a total chromosome 14 genetic length of 69.9 cM (Fig. 5) (4).
|
1 cM occurs in <0.6% of recombination events. Crossing over between homologous chromosomes was not detected during DSB-induced allelic recombination. Crossing over between homologous chromosomes is a frequent outcome of DSB-induced allelic recombination during meiosis (5, 50). Although we did not recover recombinants with LOH extending the length of a chromosome arm, which can be indicative of S/G2 exchange events (see Fig. 7), it was still possible that crossing over occurred without generating extensive LOH. To test for crossing over in our DSB-induced allelic recombinants, we assayed the linkage of a marker upstream of the DSB site to markers downstream of the DSB site. To establish an altered linkage relationship, this analysis requires that the tested markers are heterozygous in the recombinants. Upstream of the DSB is the Ea/P marker, which is an EagI restriction site in the S2neo gene of the S allele but a PacI site in the Pneo gene of the P allele. G418 selection requires an EagI site to be retained in the neo+ allele; however, the PacI site would also be expected to be retained in the Pneo gene, since it is on the P allele, the donor of genetic information which does not undergo a DSB. We tested for the retention of the PacI site in 80 recombinants by amplifying the neo genes using non-allele-specific primers (ep1 and ep2) and then cleaving the amplified product with PacI. As expected, the amplified product was approximately half cleaved by PacI in all 80 recombinants tested (data not shown), indicating a retention of heterozygosity at this site.
|
|
To test for this new linkage relationship in these five recombinants, we first enriched for the neo gene from the chromosome containing the St+ polymorphism by digesting genomic DNA with StuI and then isolating genomic DNA between 4 and 5 kb in size, in the size range of the allele containing the StuI restriction site (4.8 kb). Subsequently, the neo gene contained in this size-enriched fraction was amplified and then cleaved with either EagI or PacI (Fig. 6C). In each of these five recombinants, as well as the S/P cell line, the amplified product from this size-enriched genomic DNA was substantially cleaved by EagI but only slightly cleaved by PacI. The lack of complete EagI cleavage and the slight cleavage by PacI is likely due to a small amount of the larger StuI fragment from the other allele contaminating the size-enriched fragment. This contrasts with the amplified product generated from the non-size-selected genomic DNA, which was cleaved equally well by both EagI and PacI. Thus, none of these five recombinants exhibited a novel linkage of the St marker to the PacI site, implying that crossing over did not occur between the DSB site and St marker. As LOH terminated within the co2 interval in these recombinants, the generation of LOH does not appear to be associated with crossing over.
In summary, we found that 158 of 162 recombinants had not undergone crossing over during DSB-induced allelic recombination. We could not determine whether crossing over had occurred for the remaining four recombinants, because they had undergone LOH at the St marker, the marker furthest downstream of the DSB site that could be linked with the upstream PacI site. Thus, allelic recombination involving homologous chromosomes is associated with crossing over in
2.5% of recombinants.
| DISCUSSION |
|---|
|
|
|---|
2 x 10-2) (34, 39), which at least in part reflects repair from a sister chromatid (19).
Importantly, although recombination between homologous chromosomes was highly induced by a DSB, we determined that it does not result in extensive LOH, indicating that such repair is not inherently genome destabilizing. We found that the majority of recombinants had LOH limited to the immediate vicinity of the DSB, with a minor class of recombinants (1.9%) exhibiting LOH extending
6 kb. Furthermore, we found no evidence for LOH at markers 1 cM or further from the DSB site, and crossing over was not observed in any of the 158 informative recombinants.
Despite the large induction of recombination by a single DSB, the lack of extensive LOH formation raises the possibility that a different initiating event is required. For example, two DSBs, one on each homologous chromosome, might result in extensive LOH by leading to chromosomal exchange, through repair mechanisms other than HDR, by analogy to the repair of two DSBs on heterologous chromosomes that leads to translocation chromosomes (42). However, such an exchange event between homologous chromosomes would only produce LOH if it occurred after DNA replication followed by segregation of the exchanged chromatids to distinct daughter cells during mitosis. The presence of two simultaneous DSBs at the same or nearby positions on homologous chromosomes would be expected to be a rare event; however, fragile site usage may increase their frequency at certain genomic positions (41). Alternatively, the initiating lesion might have a different structure. For example, I-SceI-induced breaks might not have a structure representative of all spontaneous or damage-induced DSBs. Furthermore, one-ended DSBs, which differ from the two-ended I-SceI-generated DSBs, have been proposed to form during DNA replication as a result of replication fork impediments (10). Recent studies suggest that repair of one-ended DSBs and repair of two-ended DSBs have different genetic requirements and possibly different outcomes (39; see also reference 11), supporting a possible role for these lesions (although as yet this is speculative).
Given the strong induction of recombination, however, repair of a single two-ended DSB by HDR may nevertheless be an initiating event for extensive LOH under some circumstances. Possibly, extensive LOH occurs in wild-type cells at low frequency. Alternatively, extensive LOH might normally be suppressed but disruptions in the normal repair process might promote its formation.
Suppression of crossing over and break-induced replication during mitotic recombination. Evidence that mitotic recombination is a major pathway leading to LOH has primarily come from polymorphic marker analysis and karyotyping of tumor cells as well as the examination of LOH in model systems, including hybrids of inbred mouse strains (18, 25, 46). Two intact homologous chromosomes were observed, yet only a portion of the chromosomes maintained heterozygosity for polymorphic markers. While breakpoints have not been sequenced to verify that these events arose from homologous recombination, the recombinant chromosomes are best explained as having arisen from homologous recombination by either of two pathways. The recombinant chromosomes might be the product of crossover recombination involving replicated parental chromosomes, with the recombinant chromatids segregating away from each other into separate daughter cells (Fig. 7A). Alternatively, extensive gene conversion by a process known as break-induced replication also might result in LOH (Fig. 7B).
During meiosis, crossing over between replicated homologous chromosomes is strongly stimulated by DSBs such that in Saccharomyces cerevisiae, for which DSB repair has been well characterized at the molecular level, one-third or more of recombination events are associated with crossing over (5, 20, 38). In mammalian meioses, a substantial fraction of events are likely to be associated with crossing over as well (2, 3, 30, 33). While meiotic DSBs are normally introduced by the Spo11 transesterase, an exogenous DSB formed by the HO endonuclease which produces the same DNA end structure as I-SceI similarly promotes a high frequency of crossing over (32). Although crossing over between homologs during mitotic DSB repair in yeast is severalfold less frequent than during meiosis, it is still readily detected (i.e., fourfold in one study [32; see also reference 31]). Thus, the lack of observed crossing over in the recombinants characterized here suggests a strong suppression of crossing over that contrasts not only with recombination during meiosis but also with recombination during mitotic recombination in yeast.
A lack of an association of HDR with crossing over has previously been reported in mammalian cells in events involving sequence repeats on sister chromatids and heterologs (19, 43). In both of these previous studies, however, recombination was assayed between relatively short repeats, and in yeast, crossing over appears to depend on a minimal threshold length of homology (16). In the experiments presented here, homology extends along the entire length of the chromosome, ruling out limitations of homology length as a reason for suppressed crossing over. For a small fraction of recombinants with extensive gene conversion, we could not eliminate the possibility that crossing over had occurred. Nevertheless, crossover suppression appears to be a common feature of HDR events involving any type of homologous recombination partners in mammalian cells, possibly to prevent LOH and other types of genomic alterations. A recent study of spontaneously arising allelic recombinants (for which the initiating lesion is unknown) also found a lack of events associated with crossing over, indicating that suppression of crossing over may also occur during the repair of lesions other than DSBs or that a DSB may be the initiating lesion of these spontaneous events as well (40).
An alternative pathway to crossing over that might produce recombinant chromosomes of the sort found in tumor cells and in model systems is break-induced replication (Fig. 7B). In this pathway, which was identified in yeast, a broken chromosome invades the homolog at the allelic position, setting up a replication fork that proceeds to the end of the chromosome (31, 48). Since none of the recombinants presented here exhibit LOH extending to the end of the chromosome, break-induced replication appears to be inefficient in wild-type mammalian cells. However, this pathway was uncovered using yeast recombination mutants, raising the question as to whether such events would be detected in mammalian mutants.
While there is no evidence for break-induced replication during HDR in mammalian cells, the recombinants we recovered are nevertheless consistent with a replication-based recombination mechanism (17, 37, 38), with an allowance for variation in the gene conversion tract length. HDR by this mechanism, often termed synthesis-dependent strand annealing, begins with strand invasion of one end of the DSB into a homologous template to establish a D-loop. As in break-induced replication (Fig. 7B), the invading strand then primes DNA synthesis, which is associated with migration of the D-loop. However, in contrast to break-induced replication, repair synthesis is not extensive and thus does not continue to the end of the chromosome. Instead, the D-loop is disrupted and the nascent strand anneals to the other end of the DSB. Based on this model, LOH of markers distal to the DSB would be the result of DNA synthesis and gene conversion tracts would be continuous, as we have observed, yet heterozygosity would be maintained after the point of annealing to the end of the chromosome.
Therefore, regulation of each of these steps might be important for limiting the conversion of normal repair intermediates into break-induced replication products to produce extensive LOH (Fig. 7B). For example, the participation of the second end in an annealing reaction might be important in limiting the amount of repair synthesis, as might the progression of the replication fork itself. Regulation of certain of these steps may also be important to prevent crossing over, for example, by preventing conversion of intermediates into a Holliday junction which might be resolved in a crossover configuration (Fig. 7A).
Factors important for the suppression of LOH and allelic recombination. A number of factors, operating by either limiting the frequency of mitotic recombination events themselves or restricting the extent of LOH during mitotic recombination, may therefore be required to efficiently suppress LOH by mitotic recombination. The BLM helicase likely plays a major role in this suppression, as BLM mutation leads to an increased frequency of LOH in humans and mice (13, 14, 24, 29). Since BLM mutants also show a high frequency of sister chromatid exchange (13), it is possible that the biochemical activity of BLM in general prevents a crossover outcome to recombination events.
It is also conceivable that LOH is affected by the balance of factors in different cell types. Wild-type ES cells have been found to undergo spontaneous, extensive LOH (26). However, other studies provide somewhat conflicting data about cell type differences and the generation of LOH. In one study, LOH was shown to occur in ES cells at a 10-fold higher frequency than in a somatic cell type (i.e., T cells) (53), whereas in a second study which examined the same locus, LOH (including that induced by mitotic recombination) was substantially less frequent in ES cells compared with both T cells and embryonic fibroblasts (6, 47). It is not clear whether the cell type differences in mitotic recombination are accounted for by an overall difference in the frequency of recombination events between homologous chromosomes or whether the outcome of recombination events was altered.
Two other factors that have been shown to affect LOH are sequence heterology and DNA methylation. ES cells with hypomethylated DNA from Dnmt1 deficiency have elevated rates of LOH (7). Although much of the increase appears to be from a nondisjunction mechanism, LOH arising from mitotic recombination may also be somewhat elevated. As with the cell type differences, it is not clear whether the elevation is due to an overall increased frequency of recombination or an alteration in the outcome of recombination events. Interestingly, some solid tumors, which frequently exhibit a high degree of genomic instability, have been characterized by a global genome hypomethylation (23).
Not surprisingly, LOH arising from mitotic recombination appears to be strongly suppressed by substantial sequence heterology. Mitotic recombination events leading to LOH are readily detected in cells from F1 hybrid mice derived from inbred mouse strains (47). However, such LOH events do not occur in F1 hybrid mice derived from interspecific crosses (Mus musculus and Mus spretus). The degree of heterology apparently also affects meiotic progression, as the F1 hybrid males from the interspecific cross are sterile (9). That sequence heterology affects the frequency of recombination in both yeast and mammalian cells, including DSB-induced events, is well established (e.g., see references 8 and 12 and references therein). Thus, the reduction in LOH events recovered from the interspecific crosses may simply reflect a reduced level of recombination, although it is possible that there is also an effect on the extent of LOH.
The approach that we have developed to induce mitotic recombination between chromosome homologs and to examine the extent of LOH should allow an assessment of the specific roles of these and other factors in the suppression of extensive LOH during HDR.
| ACKNOWLEDGMENTS |
|---|
J.M.S. is supported by American Cancer Society postdoctoral fellowship PF-00-106-01-MGO. This work was supported in part by National Science Foundation grant MCB-9728333 (M.J.).
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
2. Barlow, A. L., F. E. Benson, S. C. West, and M. A. Hulten. 1997. Distribution of the Rad51 recombinase in human and mouse spermatocytes. EMBO J. 16:5207-5215.[CrossRef][Medline]
3. Barlow, A. L., and M. A. Hulten. 1998. Crossing over analysis at pachytene in man. Eur. J. Hum. Genet. 6:350-358.[CrossRef][Medline]
4. Blake, J. A., J. E. Richardson, C. J. Bult, J. A. Kadin, and J. T. Eppig. 2002. The Mouse Genome Database (MGD): the model organism database for the laboratory mouse. Nucleic Acids Res. 30:113-115.
5. Cao, L., E. Alani, and N. Kleckner. 1990. A pathway for generation and processing of double-strand breaks during meiotic recombination in S. cerevisiae. Cell 61:1089-1101.[CrossRef][Medline]
6. Cervantes, R. B., J. R. Stringer, C. Shao, J. A. Tischfield, and P. J. Stambrook. 2002. Embryonic stem cells and somatic cells differ in mutation frequency and type. Proc. Natl. Acad. Sci. USA 99:3586-3590.
7. Chen, R. Z., U. Pettersson, C. Beard, L. Jackson-Grusby, and R. Jaenisch. 1998. DNA hypomethylation leads to elevated mutation rates. Nature 395:89-93.[CrossRef][Medline]
8. Chen, W., and S. Jinks-Robertson. 1999. The role of the mismatch repair machinery in regulating mitotic and meiotic recombination between diverged sequences in yeast. Genetics 151:1299-1313.
9. Copeland, N. G., N. A. Jenkins, D. J. Gilbert, J. T. Eppig, L. J. Maltais, J. C. Miller, W. F. Dietrich, A. Weaver, S. E. Lincoln, R. G. Steen, et al. 1993. A genetic linkage map of the mouse: current applications and future prospects. Science 262:57-66.
10. Cox, M. M., M. F. Goodman, K. N. Kreuzer, D. J. Sherratt, S. J. Sandler, and K. J. Marians. 2000. The importance of repairing stalled replication forks. Nature 404:37-41.[CrossRef][Medline]
11. Cromie, G. A., J. C. Connelly, and D. R. Leach. 2001. Recombination at double-strand breaks and DNA ends: conserved mechanisms from phage to humans. Mol. Cell 8:1163-1174.[CrossRef][Medline]
12. Elliott, B., and M. Jasin. 2001. Repair of double-strand breaks by homologous recombination in mismatch repair-defective mammalian cells. Mol. Cell. Biol. 21:2671-2682.
13. Ellis, N. A., D. J. Lennon, M. Proytcheva, B. Alhadeff, E. E. Henderson, and J. German. 1995. Somatic intragenic recombination within the mutated locus BLM can correct the high sister-chromatid exchange phenotype of Bloom syndrome cells. Am. J. Hum. Genet. 57:1019-1027.[Medline]
14. Groden, J., Y. Nakamura, and J. German. 1990. Molecular evidence that homologous recombination occurs in proliferating human somatic cells. Proc. Natl. Acad. Sci. USA 87:4315-4319.
15. Hagstrom, S. A., and T. P. Dryja. 1999. Mitotic recombination map of 13cen-13q14 derived from an investigation of loss of heterozygosity in retinoblastomas. Proc. Natl. Acad. Sci. USA 96:2952-2957.
16. Inbar, O., B. Liefshitz, G. Bitan, and M. Kupiec. 2000. The relationship between homology length and crossing over during the repair of a broken chromosome. J. Biol. Chem. 275:30833-30838.
17. Jasin, M. 2001. Double-strand break repair and homologous recombination in mammalian cells, p. 207-235. In J. A. Nickoloff and M. F. Hoekstra (ed.), DNA damage and repair, vol. 3. Humana Press, Totowa, N.J.
18. Jasin, M. 2000. LOH and mitotic recombination, p. 191-209. In M. Ehrlich (ed.), DNA alterations in cancer. Eaton Publishing, Natick, Mass.
19. Johnson, R. D., and M. Jasin. 2000. Sister chromatid gene conversion is a prominent double-strand break repair pathway in mammalian cells. EMBO J. 19:3398-3407.[CrossRef][Medline]
20. Keeney, S. 2001. Mechanism and control of meiotic recombination initiation. Curr. Top. Dev. Biol. 52:1-53.[Medline]
21. Keeney, S., F. Baudat, M. Angeles, Z. H. Zhou, N. G. Copeland, N. A. Jenkins, K. Manova, and M. Jasin. 1999. A mouse homolog of the Saccharomyces cerevisiae meiotic recombination DNA transesterase Spo11p. Genomics 61:170-182.[CrossRef][Medline]
22. Kilby, N. J., M. R. Snaith, and J. A. Murray. 1993. Site-specific recombinases: tools for genome engineering. Trends Genet. 9:413-421.[CrossRef][Medline]
23. Laird, P. W., and R. Jaenisch. 1996. The role of DNA methylation in cancer genetic and epigenetics. Annu. Rev. Genet. 30:441-464.[CrossRef][Medline]
24. Langlois, R. G., W. L. Bigbee, R. H. Jensen, and J. German. 1989. Evidence for increased in vivo mutation and somatic recombination in Bloom's syndrome. Proc. Natl. Acad. Sci. USA 86:670-674.
25. Lasko, D., W. Cavenee, and M. Nordenskjold. 1991. Loss of constitutional heterozygosity in human cancer. Annu. Rev. Genet. 25:281-314.[CrossRef][Medline]
26. Lefebvre, L., N. Dionne, J. Karaskova, J. A. Squire, and A. Nagy. 2001. Selection for transgene homozygosity in embryonic stem cells results in extensive loss of heterozygosity. Nat. Genet. 27:257-258.[CrossRef][Medline]
27. Lindblad-Toh, K., E. Winchester, M. J. Daly, D. G. Wang, J. N. Hirschhorn, J. P. Laviolette, K. Ardlie, D. E. Reich, E. Robinson, P. Sklar, N. Shah, D. Thomas, J. B. Fan, T. Gingeras, J. Warrington, N. Patil, T. J. Hudson, and E. S. Lander. 2000. Large-scale discovery and genotyping of single-nucleotide polymorphisms in the mouse. Nat. Genet. 24:381-386.[CrossRef][Medline]
28. Liu, P., N. A. Jenkins, and N. G. Copeland. 2002. Efficient Cre-loxP-induced mitotic recombination in mouse embryonic stem cells. Nat. Genet. 30:66-72.[CrossRef][Medline]
29. Luo, G., I. M. Santoro, L. D. McDaniel, I. Nishijima, M. Mills, H. Youssoufian, H. Vogel, R. A. Schultz, and A. Bradley. 2000. Cancer predisposition caused by elevated mitotic recombination in Bloom mice. Nat. Genet. 26:424-429.[CrossRef][Medline]
30. Lynn, A., K. E. Koehler, L. Judis, E. R. Chan, J. P. Cherry, S. Schwartz, A. Seftel, P. A. Hunt, and T. J. Hassold. 2002. Covariation of synaptonemal complex length and mammalian meiotic exchange rates. Science 296:2222-2225.
31. Malkova, A., E. L. Ivanov, and J. E. Haber. 1996. Double-strand break repair in the absence of RAD51 in yeast: a possible role for break-induced DNA replication. Proc. Natl. Acad. Sci. USA 93:7131-7136.
32. Malkova, A., F. Klein, W. Y. Leung, and J. E. Haber. 2000. HO endonuclease-induced recombination in yeast meiosis resembles Spo11-induced events. Proc. Natl. Acad. Sci. USA 97:14500-14505.
33. Moens, P. B., N. K. Kolas, M. Tarsounas, E. Marcon, P. E. Cohen, and B. Spyropoulos. 2002. The time course and chromosomal localization of recombination-related proteins at meiosis in the mouse are compatible with models that can resolve the early DNA-DNA interactions without reciprocal recombination. J. Cell Sci. 115:1611-1622.
34. Moynahan, M. E., T. Y. Cui, and M. Jasin. 2001. Homology-directed DNA repair, mitomycin-c resistance, and chromosome stability is restored with correction of a Brca1 mutation. Cancer Res. 61:4842-4850.
35. Moynahan, M. E., and M. Jasin. 1997. Loss of heterozygosity induced by a chromosomal double-strand break. Proc. Natl. Acad. Sci. USA 94:8988-8993.
36. Moynahan, M. E., A. J. Pierce, and M. Jasin. 2001. BRCA2 is required for homology-directed repair of chromosomal breaks. Mol. Cell 7:263-272.[CrossRef][Medline]
37. Nassif, N., J. Penney, S. Pal, W. R. Engels, and G. B. Gloor. 1994. Efficient copying of nonhomologous sequences from ectopic sites via P-element-induced gap repair. Mol. Cell. Biol. 14:1613-1625.
38. PÂques, F., and J. E. Haber. 1999. Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 63:349-404.
39. Pierce, A. J., P. Hu, M. Han, N. Ellis, and M. Jasin. 2001. Ku DNA end-binding protein modulates homologous repair of double-strand breaks in mammalian cells. Genes Dev. 15:3237-3242.
40. Quintana, P. J., E. A. Neuwirth, and A. J. Grosovsky. 2001. Interchromosomal gene conversion at an endogenous human cell locus. Genetics 158:757-767.
41. Richards, R. I. 2001. Fragile and unstable chromosomes in cancer: causes and consequences. Trends Genet. 17:339-345.[CrossRef][Medline]
42. Richardson, C., and M. Jasin. 2000. Frequent chromosomal translocations induced by DNA double-strand breaks. Nature 405:697-700.[CrossRef][Medline]
43. Richardson, C., M. E. Moynahan, and M. Jasin. 1998. Double-strand break repair by interchromosomal recombination: suppression of chromosomal translocations. Genes Dev. 12:3831-3842.
44. Romanienko, P. J., and R. D. Camerini-Otero. 1999. Cloning, characterization, and localization of mouse and human SPO11. Genomics 61:156-169.[CrossRef][Medline]
45. Sachidanandam, R., D. Weissman, S. C. Schmidt, J. M. Kakol, L. D. Stein, G. Marth, S. Sherry, J. C. Mullikin, B. J. Mortimore, D. L. Willey, S. E. Hunt, C. G. Cole, P. C. Coggill, C. M. Rice, Z. Ning, J. Rogers, D. R. Bentley, P. Y. Kwok, E. R. Mardis, R. T. Yeh, B. Schultz, L. Cook, R. Davenport, M. Dante, L. Fulton, L. Hillier, R. H. Waterston, J. D. McPherson, B. Gilman, S. Schaffner, W. J. Van Etten, D. Reich, J. Higgins, M. J. Daly, B. Blumenstiel, J. Baldwin, N. Stange-Thomann, M. C. Zody, L. Linton, E. S. Lander, and D. Altshuler. 2001. A map of human genome sequence variation containing 1.42 million single nucleotide polymorphisms. Nature 409:928-933.[CrossRef][Medline]
46. Shao, C., L. Deng, O. Henegariu, L. Liang, N. Raikwar, A. Sahota, P. J. Stambrook, and J. A. Tischfield. 1999. Mitotic recombination produces the majority of recessive fibroblast variants in heterozygous mice. Proc. Natl. Acad. Sci. USA 96:9230-9235.
47. Shao, C., P. J. Stambrook, and J. A. Tischfield. 2001. Mitotic recombination is suppressed by chromosomal divergence in hybrids of distantly related mouse strains. Nat. Genet. 28:169-172.[CrossRef][Medline]
48. Signon, L., A. Malkova, M. L. Naylor, H. Klein, and J. E. Haber. 2001. Genetic requirements for RAD51- and RAD54-independent break-induced replication repair of a chromosomal double-strand break. Mol. Cell. Biol. 21:2048-2056.
49. Stark, J. M., P. Hu, A. J. Pierce, M. E. Moynahan, N. Ellis, and M. Jasin. 2002. ATP hydrolysis by mammalian RAD51 has a key role during homology-directed DNA repair. J. Biol. Chem. 277:20185-20194.
50. Szostak, J. W., T. L. Orr-Weaver, R. J. Rothstein, and F. W. Stahl. 1983. The double-strand-break repair model for recombination. Cell 33:25-35.[CrossRef][Medline]
51. te Riele, H., E. R. Maandag, and A. Berns. 1992. Highly efficient gene targeting in embryonic stem cells through homologous recombination with isogenic DNA constructs. Proc. Natl. Acad. Sci. USA 89:5128-5132.
52. Thiagalingam, S., S. Laken, J. K. Willson, S. D. Markowitz, K. W. Kinzler, B. Vogelstein, and C. Lengauer. 2001. Mechanisms underlying losses of heterozygosity in human colorectal cancers. Proc. Natl. Acad. Sci. USA 98:2698-2702.
53. Van Sloun, P. P., S. W. Wijnhoven, H. J. Kool, R. Slater, G. Weeda, A. A. van Zeeland, P. H. Lohman, and H. Vrieling. 1998. Determination of spontaneous loss of heterozygosity mutations in Aprt heterozygous mice. Nucleic Acids Res. 26:4888-4894.
54. You, Y., R. Bergstrom, M. Klemm, B. Lederman, H. Nelson, C. Ticknor, R. Jaenisch, and J. Schimenti. 1997. Chromosomal deletion complexes in mice by radiation of embryonic stem cells. Nat. Genet. 15:285-288.[CrossRef][Medline]
This article has been cited by other articles: