![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Yue Wei,2 Grzegorz Nalepa,3, and J. Wade Harper1,2,3*
Verna and Marrs McLean Department of Biochemistry and Molecular Biology,1 Department of Molecular Physiology and Biophysics,2 Program in Cell and Molecular Biology, Baylor College of Medicine, Houston, Texas 770303
Received 1 April 2003/ Returned for modification 22 May 2003/ Accepted 18 August 2003
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Precisely how cyclin E/Cdk2 catalyzes S-phase entry is not clear, but its ability to coordinate multiple S-phase events is likely to be critical for genome integrity. S phase requires that multiple events occur concurrently, including activation of the DNA replication process, activation of centrosome duplication, and production of DNA synthesis precursors. Cyclin E has been implicated in each of these functions. However, relevant substrates for these activities are only beginning to be understood. Through inactivation of Rb and derepression of E2F1-3, cyclin E promotes the production of enzymes required for DNA replication and nucleotide synthesis (14, 35, 45). The critical nature of the cyclin E program is indicated by the fact that cells that persistently overexpress cyclin E display genomic instability (44, 33).
Proper DNA replication also requires that the core components of nucleosome, histones H2A, H2B, H3, and H4, are produced concurrently with S phase. Recent studies (34) have reinforced the established concept that DNA replication and histone gene expression synthesis are both functionally and temporally linked (21, 29). Loss of histone production leads to inhibition of DNA synthesis, independently of Cdk2 activity. Likewise, inhibition of DNA synthesis leads to repression of histone synthesis. Thus, it is well established that, during S phase, histone mRNA levels dramatically increase relative to those in other cell cycle phases, through both transcriptional and posttranscriptional mechanisms (11, 19; reviewed in reference 29). During S phase, histone mRNA is stabilized (about sevenfold) and processed via the action of SLBP1, which binds the 3' stem-loop in histone mRNAs and facilitates processing via endonucleolytic cleavage, as well as histone translation (13, 40). SLBP1 accumulation is cell cycle regulated and increases during S phase through largely translational mechanisms (13, 51). Histone transcription is activated (about fivefold) concurrently with S phase, and this involves distinct transcriptional activators that function through subtype specific cis-acting elements in histone promoters (2, 3, 9, 10, 21, 28, 38, 47, 48, 49). Although activation of histone mRNA synthesis is clearly activated during S phase, it is not clear to what extent the expression of what are thought to be replication-dependent histone genes can occur outside S phase. However, previous studies have indicated detectable levels of histone mRNA in serum-deprived cell populations that contained 2 to 3% S-phase cells (11, 19). Whether this reflects incomplete cell cycle synchrony is an open issue.
Precisely how cell cycle positional information is relayed to the histone transcriptional apparatus is unknown. However, recent data implicate the cyclin E/Cdk2 substrate p220NPAT as being involved in this process. p220 was identified as a cyclin E/Cdk2 binding protein (25, 52), and initial studies implicated p220 in control of the G1/S transition and in histone gene transcription (26, 52, 53). p220 is localized in small nuclear organelles called Cajal bodies (CBs) (26, 53). CBs were first identified in 1903 (7), but their components and functions have only begun to emerge in the last decade (18, 31, 36). In normal diploid fibroblasts in G1, two p220-containing CBs are associated with replication-dependent histone gene clusters on chromosome 6p21. As these cells enter S phase, two additional p220-positive CBs become associated with replication-dependent histone gene clusters on chromosome 1q21. p220-positive CBs persist until mitosis, when CB components become dispersed. By using phosphorylation-specific antibodies against Cdk2 sites in p220, we demonstrated that CB-associated p220 is phosphorylated during the cell cycle (26) and the timing of phosphorylation correlated with accumulation of cyclin E in CBs during late G1 (23, 26). Consistent with a role in histone transcription, overexpression of p220 in tissue culture cells leads to activation of histone H4 and H2B promoter-reporter constructs through cell cycle regulatory elements in these promoters, and in this context, p220 is activated by cyclin E/Cdk2 (26, 53). It is not clear whether p220 is also required for activation of endogenous histone transcription.
Enforced expression of p220 drives cells from G1 into S phase, apparently without affecting the ability of cells to progress through S phase (52). Recent work with p220 mutants that are unable to activate H4 transcription indicated that its ability to promote cell cycle entry is not dependent on its ability to activate histone transcription (50). Moreover, it is not clear whether p220 normally plays a direct role in allowing cells to enter S phase. To delineate the roles of p220 in cell cycle control, we have examined the phenotype of human somatic cells engineered to conditionally express p220. We found that p220 is essential for cell proliferation and that its absence during the G1 phase of the cell cycle leads to cell cycle arrest prior to S-phase entry. This arrest occurs in the presence of high Cdk2 activity, suggesting that p220 activity is required downstream of Cdk2 activation. This arrest occurs concurrently with dissociation of the CB component p80coilin from CBs, suggesting a role for p220 in maintaining proper CB assembly as cells attempt to enter the cell cycle. Interestingly, expression of human papillomavirus (HPV) E7—which inactivates pRb—overrides cell cycle arrest resulting from p220 depletion. In contrast, E6—which blocks p53 function—has no effect on S-phase entry in p220-null cells. p220-null cells entering S phase as a result of E7 expression display reduced levels of mRNAs for all four core histones, demonstrating a role for p220 in replication-dependent histone gene expression. p220 was also found to be critical for "basal" expression of histone H4 outside S phase. These data indicate that p220 is a central component in the cyclin E/Cdk2 signaling pathway responsible for orchestrating the G1/S transition.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
phage was screened with the p220 cDNA, and one candidate clone (p220-22) containing exons 2 and 3 on a 10-kb genomic insert was identified. To generate a conditional knockout construct, the open reading frame of a neomycin (Neo) resistance gene linked with polyadenylation sequences (5) was inserted in frame into exon 2, and flanking loxP sites were inserted 613 nucleotides upstream and 734 nucleotides downstream of the Neo cassette. This was followed by insertion of an additional exon 2 and flanking intronic sequences, as well as an additional loxP site located 734 nucleotides 3' to the duplicated exon 2. A conventional targeting construct contained a promoterless Neo cassette inserted in frame within exon 2, followed by 1.4 kb of exon 5 and flanking intronic sequences, which was produced by PCR from BAC clone RP11-56d3. Generation of p220-deficient cells. HCT116 cells were transfected with a p220 conditional knockout construct with Lipofectamine, and selection was performed with medium containing G418. Screening for homologous recombination events at both 5' and 3' sequences was accomplished by PCR with Extended High Fidelity polymerase (Roche) and oligonucleotide pairs specific to the conditional allele and sequences outside the homology used for recombination (Fig. 1). One clone identified in this manner was infected with adenovirus (Ad)-Cre, and colonies were screened for loss of the exon 2-Neo fusion by PCR. These p220flox/+ cells were then transfected with a promoterless Neo vector containing Neo in exon 2 and with exons 3 and 4 deleted. Recombination at the existing wild-type allele was verified by PCR analysis. PCR products representing the junctions of recombination sites were directly sequenced to verify their structures. To delete the conditional allele, p220flox/- cells were treated with Ad-Cre or Ad-LacZ as a control and cells were assayed as described below. Equal numbers of infectious particles of Ad-Cre and Ad-LacZ were used, as determined by immunostaining of infected cells with anti-Cre and by in situ ß-galactosidase assays. To generate cells expressing an estrogen receptor-Cre fusion (ER-Cre), whose localization is under the control of hydroxyl-tamoxifen (OHT), p220flox/- cells or p220+/+ cells as controls were transfected with a plasmid expressing ER-Cre recombinase linked with a puromycin resistance marker (32). Two days after transfection, cells were placed on selection medium containing 1 µg of puromycin per ml and three independent colonies were isolated for each genotype (p220flox/- ER-Cre and p220+/+ ER-Cre). Immunoblotting of cell extracts from these cell lines indicated indistinguishable levels of ER-Cre, and immunofluorescence assay indicated cytoplasmic localization of ER-Cre in the absence of OHT and nuclear accumulation in the presence of OHT (data not shown). To generate E6 and E7 p220flox/- cells, p220flox/- cells were infected with retroviruses expressing either HPV E6 or E7. Twenty-four hours after infection, cells were placed on selection medium containing 1 µg of puromycin per ml and pooled puromycin-resistant cells were used in cell cycle and transcription experiments.
|
Immunofluorescence assay and flow cytometry. For immunofluorescence assays, cells were grown on ultrathin cover slides (Fisher), fixed in 95% ethanol-5% glacial acetic acid, and permeabilized with 0.2% Triton X-100 for 10 min. Cells were then blocked with 5% goat serum (Sigma) for 30 min, incubated with primary antibodies (affinity-purified anti-p220 at 1:100) for 1 h, washed five times with phosphate-buffered saline, incubated with fluorochrome-conjugated secondary antibody for 1 h, and generously washed. For double immunostaining, cells at this point were fixed again and the immunostaining procedure was repeated with other primary and secondary antibodies. The following primary antibodies were used: anti-coilin monoclonal antibody (provided by M. Carmo-Fonseca, University of Portugal), anti-p220 DH4 monoclonal antibody (provided by J. Zhao, University of Rochester), and anti-phospho Pol II (Santa Cruz Biotechnology). To measure the relative levels of phosphorylated and unphosphorylated p220, cells were stained first with monoclonal antibody DH4 and subsequently stained with a antibodies directed against phosphor-T1350 (26). Nuclei were then counterstained with 4',6'-diamidino-2-phenylindole (DAPI), and cells were mounted in SlowFade Light Antifade reagent (Molecular Probes). Images were taken on a Nikon/DeltaVision deconvolution microscope (Applied Precision) as a series of 0.2-µm-thick z sections, processed with a Softworx image workstation, and presented as a projection of transnuclear z sections, or on an Olympus BX60 microscope fitted with a Hamamatsu charge-coupled device camera.
For bromodeoxyuridine (BrdU) incorporation, cells were pulse-labeled with BrdU, incubated in 3 N HCl for 10 min, stained with AlexaFluor594-conjugated mouse anti-BrdU antibody (Molecular Probes), and then stained for p220 as described above. For bromouridine (BrU) incorporation, cells were pulse-labeled with BrU for 15 min, fixed, and stained with an anti-BrdU antibody. For flow cytometry, cells were harvested, fixed in ethanol, and stained with propidium iodide. Flow cytometry analysis was performed with a FACScan instrument.
Transcription analysis.
For luciferase assays, p220flox/- ER-Cre or p220+/+ ER-Cre cells at 70% confluence were rendered quiescent in the presence or absence of OHT and then transiently transfected in triplicate with pGL2-histone H4 promoter luciferase (53) and CMV-LacZ plasmids (0.1 µg) with Fugene 6 (Roche). Thirty-six hours after transfection, cells were collected and luciferase assays were performed with a luciferase assay kit (Promega) as previously described (50). ß-Galactosidase assay were used to normalize the luciferase activities. To examine the expression of endogenous histone genes, mRNA was isolated from cells after synchronization, Ad infection, and release with RNAzol. mRNA was subjected to Northern blot analysis with histone H4 or ß-actin as a probe or used for quantitative reverse transcription (RT)-PCR. mRNA was subjected to RT with oligonucleotides specific for each of the four core histones, as well as glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a control. Quantitative PCR (in triplicate) was accomplished with SYBR-green fluorescence (Applied Biosystems) and an ABI Prism 7700 sequence detection system. The following oligonucleotides were used: H2A, 5' primer GACGAGGAGCTCAACAAGCTG and 3' primer TGTTGGGCAGGACACCG; H2B, 5' primer CCGACACCGGCATCTCAT and 3' primer GCGCTCGAAGATATCGTTGAC; H3, 5' primer TACCAGAAGTCCACCGAGCTG and 3' primer GATTTCTCGCACCAGGCG; H4, 5' primer AATCCGCGATGCAGTTACCT and 3' primer CCACGTCCATGGCTGTGA. For Northern blot assays, mRNA levels were quantified by phosphorimager analysis. The fold difference in histone transcripts versus histone transcript levels in p220+/+ cells infected with Ad-LacZ was calculated by the 
CT method, with GAPDH signals as an internal control.
Kinase assays. To examine Cdk2 kinase activity, the indicated cells were lysed in 50 mM Tris-HCl-2 mM EDTA-150 mM NaCl-0.1% Triton X-100-10 mM ß-glycerol phosphate-5 mM NaF-10 mM p-nitrophenylphosphate-protease inhibitors (Roche) and cleared by centrifugation (14,000 x g, 15 min). Extracts (0.5 mg) were subjected to immunoprecipitation with anti-Cdk2 or control immunoglobulin G antibodies (Santa Cruz Biotechnology) in combination with protein A-agarose. Twenty percent of the washed immune complexes was used for histone H1 kinase activity as previously described (26). Reaction products were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and visualized by autoradiography. The remaining immune complexes were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and probed with anti-Cdk2 antibodies to demonstrate equal Cdk2 levels.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To verify Cre-dependent excision of exon 2, p220flox/- cells were treated with Ad expressing Cre recombinase (Ad-Cre) or ß-galactosidase (Ad-LacZ) and genomic DNA from these cells was examined for loss of the conditional allele by PCR (Fig. 1D). With Ad-Cre treatment, loss of the 1.5-kb PCR product derived from the floxed allele (but not the corresponding 2.6-kb product derived from the conventional null allele) was observed with concomitant appearance of the 200-bp product produced from the excised allele. In contrast, infection with Ad-LacZ did not alter either p220 allele (Fig. 1D). We verified loss of p220 expression with a highly sensitive immunofluorescence assay and deconvolution microscopy, which allows visualization of p220 as brightly staining nuclear foci (26) (Fig. 1E and F). As early as 24 h after addition of Ad-Cre, 
40% of the cells lacked p220 staining (Fig. 1E and F). During the next 3 days, the percentage of p220-negative cells increased to 85%. In contrast, Ad-LacZ-expressing cells or p220+/+ cells expressing Cre retained p220 expression over the time course (Fig. 1E).
To facilitate analysis of p220flox/- cells, we also generated p220flox/- and corresponding p220+/+ cells that constitutively express an ER-Cre fusion protein (32). ER-Cre is cytoplasmic in the absence of OHT but translocates to the nucleus upon its addition (32; data not shown). Relocation of ER-Cre to the nucleus leads to rapid removal of the conditional allele, as determined by genomic PCR analysis, and immunofluorescence assay of these cells demonstrated the expected loss of p220 protein (data not shown; see below).
p220NPAT is required for cell viability. We next examined whether p220 is required for viability in HCT116 cells. p220flox/- cells were treated with Ad-Cre (or Ad-LacZ as a negative control) for 2 days, which corresponded to the time when >60% of the cells displayed levels of p220 undetectable by immunofluorescence assay. Cells were then plated at low density for 12 days to allow colony visualization. p220flox/- and p220flox/+ cells expressing LacZ formed colonies with high efficiency, while the colony formation seen with Ad-Cre was reduced by more than 10-fold (Fig. 2A and B). Given that a small fraction of the cells still expressed p220 on the basis of immunofluorescence assay results, we examined whether residual colonies contained an intact conditional p220 allele by genomic PCR. Of the more than 60 colonies examined in two independent experiments, none were found to have undergone excision of exon 2 (Fig. 2C and data not shown). Similar results were obtained with p220flox/- ER-Cre cells in the presence of OHT, which displayed an 80-fold reduction in colony number relative to that of cells in the absence of OHT (Fig. 2D and data not shown). Again, surviving colonies (n = 10) had not undergone excision of exon 2 (data not shown). In addition, p220flox/- ER-Cre cells grow poorly in the presence of OHT, relative to control p220+/+ ER-Cre cells in the presence or absence of OHT (Fig. 2E). These data indicate that p220 is required for HCT116 cell viability and/or proliferation.
|
|
G1 arrest in p220-/- cells occurs with high Cdk2 kinase activity. The inability of p220-/- cells to enter S phase could reflect a requirement for p220 downstream of cyclin E/Cdk2, or alternatively, loss of p220 could lead to activation of a checkpoint signal that leads to the inhibition of Cdk2 activity. Such inhibition could occur through induction of Cdk inhibitors, inhibitory phosphorylation of Cdk2, or degradation of cyclin A or E. To examine this question, we examined Cdk2 kinase activity in quiescent p220flox/- and p220-/- cells and in cells 13 h after serum-stimulated cell cycle re-entry. This corresponded to the time when more than 50% of LacZ-expressing p220flox/- cells have entered S phase (Fig. 3). As expected, Cdk2 kinase activity was low in quiescent cells and was increased at 13 h, reflecting cell cycle entry. Importantly, Cdk2 activity and protein levels were equivalent in p220flox/- cells expressing LacZ or Cre (Fig. 4, lanes 7 and 8) and were comparable to those seen in p220+/+ cells treated similarly (Fig. 4, lanes 5 and 6). These data indicate that p220 is required for S-phase entry independently of cyclin E/Cdk2 and cyclin A/Cdk2 activity.
|
|
Initially, we examined histone H4 expression in cells that had been stimulated to re-enter the cell cycle from G0 in the presence or absence of p220. As shown in Fig. 6A, p220+/+ cells treated with Ad-Cre or Ad-LacZ and p220flox/- cells treated with Ad-LacZ displayed cell cycle-regulated expression of an 400-bp histone H4 mRNA, as determined by Northern blot analysis of cells released from G0. The level of histone H4 mRNA was low in G0 and increased about sixfold as cells entered S phase (8 to 16 h) (Fig. 6A, lanes 1 to 12). In contrast, p220flox/- cells treated with Ad-Cre displayed substantially lower levels of histone H4 mRNA throughout the time course, increasing to a maximum of 1.7-fold at 13 h (Fig. 6A, lanes 13 to 16). The small increase in histone mRNA may reflect the absence of complete removal of the p220-floxed allele (Fig. 1). In order to quantify differences in expression and to expand the analysis to other histone subtypes, we used real-time RT-PCR in both G0 cells and in cells released from quiescence by addition of serum (Fig. 6B and C). Subtype-specific primer sets were developed and found to give a single-peak dissociation curve, demonstrating PCR specificity (Fig. 6D and data not shown). In cells synchronized by serum deprivation, loss of p220 led to a 10-fold decrease in the abundance of histones H2A and H4, a 3-fold reduction in H3, and a 2-fold reduction in histone H2B mRNA, relative to controls with p220+/+ cells infected with Ad-LacZ (Fig. 6B). Similar results were observed at 13 h (Fig. 6C), a time when histone H4 mRNA levels in p220-expressing cells was maximal (Fig. 6A).
|
A major limitation of this approach for studying p220 function is that p220-null cells arrest in G1 and therefore, we would anticipate that expression of replication-dependent histone genes would not occur in the absence of p220. In order to examine histone gene expression during S phase in the absence of p220, we took advantage of p220flox/- E7 cells, which enter S phase in the apparent absence of p220. With quantitative RT-PCR assays and cells released from serum starvation for 13 h, we found that the levels of expression for all four core histones were substantially reduced. The levels of H2A and H2B were reduced by 50% relative to those in p220flox/- E7 cells treated with Ad-LacZ, while the levels of H3 and H4 were reduced by more than fourfold (Fig. 5C). Again, the incomplete removal of p220 upon Cre treatment likely contributes to the overall level of histone transcription seen, and the actual contribution of p220 to histone transcription is likely to be larger. Taken together, these data indicate that p220 is critical for optimal levels of core histone expression as cells enter S phase.
Expression of replication-dependent histone genes outside S phase. In experiments examining histone gene expression in serum-starved cells, we noticed that histone H4 mRNA levels were also reduced in p220-/- cells, compared to those in p220-expressing cells (Fig. 6A and B). This, coupled with the fact that previous studies had seen a low, yet quantifiable, level of histone mRNA in G0 and G1 cells (11, 19), led us to ask whether p220 might contribute to low-level histone transcription outside S phase. In principle, the use of highly quantitative PCR techniques that were not available when early studies on histone transcription were performed might allow a more precise determination of whether "replication-dependent" histone expression can occur in the absence of DNA replication.
We first examined the possibility that the differences in the number of residual S-phase cells in these experiments due to p220 depletion is responsible for the differential histone expression observed in G0/G1 cell populations. However, we found that the percentage of residual BrdU-positive cells 48 h after serum deprivation was the same in both p220flox/- Ad-LacZ and p220flox/- Ad-Cre cells (15%; data not shown). Thus, the difference in histone expression see in p220flox/- and p220-/- cells is unlikely to reflect the absence of complete synchrony. To examine histone expression outside S phase, we sought to further reduce the S-phase content of our synchronized population by depleting S-phase cells from the population with aphidicolin, an inhibitor of DNA replication. Previous studies have demonstrated that inhibition of replication by aphidicolin leads to a rapid depletion (<60 min) of histone mRNA. With a highly sensitive BrdU incorporation method, we were unable to detect any S-phase cells (n = 1,000) after 3 h in aphidicolin. Under these conditions, the levels of H2B and H4 mRNAs were reduced to 25 and 45%, respectively, compared with those in untreated cells (Fig. 6E). The BrdU conditions used coupled with deconvolution microscopy are sufficient to allow even a single replication focus to be visualized. Thus, there is clearly detectable H2B and H4 expression in the absence of detectable DNA replication. We then examined whether this expression was dependent on p220. p220flox/- or p220+/+ cells were serum starved and treated with Ad-Cre, and aphidicolin was added prior to mRNA isolation and quantitative PCR to examine the expression of histone genes. We found that the levels of histone H4 were dramatically reduced (fivefold) in p220flox/- cells treated with Ad-Cre relative to those in p220+/+ cells treated similarly (Fig. 6F), indicating that p220 contributes to "basal" histone H4 transcription independently of DNA replication. In contrast, we were unable to detect significant differences in histone H3, H2A, and H2B levels under these conditions (Fig. 6F). The simplest interpretation of this finding is that HCT116 cells express what we refer to as basal levels of histone mRNAs outside S phase and that p220 contributes substantially to histone H4 expression independently of DNA synthesis in S phase.
Three lines of evidence indicate that the loss of histone mRNA is not a reflection of a general loss of transcription due to depletion of p220. First, ß-actin levels accumulated in cells upon cell cycle re-entry independently of p220 status (Fig. 6A). Second, we examined global transcription by monitoring incorporation of BrU into newly transcribed mRNA with an immunofluorescence assay. The extent of BrU incorporation into p220flox/- cells transiently expressing Cre recombinase was indistinguishable in the presence or absence of p220, as determined by immunofluorescence assay (Fig. 6G). Third, we examined the intranuclear distribution of phosphorylated RNA polymerase II, which is an additional marker for ongoing transcription. Again, the punctate patterns of phosphorylated RNA polymerase staining were indistinguishable in p220flox/- and p220-/- cells (data not shown).
p220 phosphorylation status in G0/G1. The finding that p220 contributes to basal histone H4 expression outside S phase led us to examine the phosphorylation status of p220 in G0/G1 cells. Cyclin E/Cdk2 activity is frequently deregulated in tissue culture cells and could, in principle, lead to inappropriate p220 phosphorylation in G0/G1. This phosphorylation could, in turn, lead to increased histone expression outside S phase. HCT116 cells synchronized in G0 by serum deprivation contain two p220 foci. However, these foci do not react with antibodies directed against phospho-T1350 (Fig. 7A). In contrast, HCT116 cells in S phase (13 h after release from serum deprivation) contain the expected four p220 foci and these foci react with the anti-phospho-T1350 antibodies (Fig. 7A). Similar results were obtained with antibodies directed against phospho-T1270 (data not shown). These data indicate that basal p220-dependent histone gene expression occurs without detectable phosphorylation of p220 on two prominent Cdk2 phosphorylation sites and suggest a phosphorylation-independent component to p220 function outside S phase.
|
First, we examined p80coilin localization in asynchronous p220flox/- cells 5 days after infection with either Ad-Cre or Ad-lacZ (Fig. 7B). The vast majority of cells treated with Ad-LacZ maintained focal anti-p220 and anti-coilin staining (Fig. 7B). In contrast, cells treated with Ad-Cre demonstrated a dramatic increase in the number of cells displaying altered patterns of coilin staining. In particular, we noted cells that had lost focal coilin staining and exhibited either a diffuse pattern or a "dissociative" pattern containing a large number of small punctate foci (Fig. 7B). In this asynchronous population, 38% of p220-negative cells displayed dissociative or dispersed patterns of p220 staining. Similar results were obtained with p220flox/- ER-Cre cells treated with OHT (Fig. 7C and data not shown). We next examined coilin staining in synchronized cells lacking p220. p220+/+ or p220flox/- cells were treated with Ad-Cre or Ad-lacZ and arrested in G0 by serum withdrawal. Under these conditions, greater than 68% of the cells displayed normal patterns of coilin foci, independently of the presence of p220 (Fig. 7D). Previous studies have demonstrated that the number of coilin-positive CBs increases as cells enter S phase. When p220flox/- cells expressing Ad-LacZ were stimulated to re-enter the cell cycle with serum, the percentage of cells with focal anti-coilin staining increased to 79 to 92% and, as expected, a subset of coilin-positive foci in these cells were p220 positive. In contrast, with p220flox/- cells treated with Ad-Cre, less than 42% of these cells displayed focal coilin staining (Fig. 7D). These data indicate that p220 is not required for localization of coilin in CBs during G0 but is important for efficient retention of coilin in CBs as cells traverse the G1/S transition.
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In this work, we sought to examine the extent to which cells use p220 to promote events linked with S-phase entry. With promoterless-neo technology, we generated HCT116 cells carrying a conditional allele of p220, allowing removal of p220 in response to expression of Cre recombinase. Several facts were established. First, p220 is required for HCT116 cell proliferation. Second, this defect in cell proliferation appears to manifest itself primarily in a block to DNA replication. G0/G1 cells lacking p220 are unable to enter S phase in response to serum, as determined either by flow cytometry or by BrdU incorporation assay. Third, this arrest occurs in the presence of S-phase levels of cyclin E/Cdk2 activity, confirming that p220 functions downstream of cyclin E/Cdk2 activation. Fourth, expression of HPV E7, but not E6, allows S-phase entry in the absence of p220, implying a role for pRb in maintaining a G1 block when p220 levels fall below a crucial level. Fifth, optimal expression of histone genes during S phase requires p220. Sixth, low levels of histone gene expression were detected outside S phase and expression of histone H4 in this setting was dependent on p220 but apparently independent of p220 phosphorylation by Cdk2. Finally, p220 is required to maintain focal localization of p80coilin in CBs as cells traverse G1/S.
The available data suggest that p220 plays multiple independent roles in cell cycle progression (Fig. 8A). We previously showed that mutations in p220 that block its ability to activate transcription of histone reporter constructs have little effect on the ability of p220 to promote S-phase entry (50). Thus, it seems likely that p220's histone transcriptional activation function is not critical to its S-phase-promoting function. This hypothesis is corroborated by our finding that inactivation of pRb by E7 rescues S-phase entry but not core histone expression in p220-deficient cells. E7 promotes S-phase entry by multiple mechanisms that include (27), but are not limited to (39), derepression of Rb-suppressed transactivation of cyclin E. Thus, expression of E7 shifts the cell cycle balance from Rb-mediated G1 arrest toward constitutive activation of cyclin E/Cdk and accelerates progression through the G1/S transition. This reduction of the S-phase entry threshold might be sufficient to promote DNA replication but not full histone transcription in the absence of p220.
|
The majority of studies on histone transcription have focused on S-phase-dependent activation, and little is known about the pathways controlling basal histone transcription that occurs in G0 or G1. There are both common and specific cis-acting regulatory elements in replication-dependent histone genes (21). Both subtype-specific consensus elements and the common YY1 element located in the structural gene contribute to cell cycle-regulated transcription, and in some cases, trans-acting factors that interact with subtype-specific consensus elements have been identified (Oct1 in the case of H2B and IFR2 in the case of histone H4) (3, 9, 10, 15, 28, 47-49). Our work has uncovered what appears to be a phosphorylation-independent function of p220 in histone H4 expression, but not expression of other core histones, outside S phase. We propose (Fig. 7B) that during G0/G1, unphosphorylated p220 functions to support low levels of histone H4 expression. As cells approach the G1/S transition and p220 becomes phosphorylated by Cdk2 (26), p220 activity is enhanced, leading to an approximately fivefold increase in core histone gene expression in HCT116 cells. Replication-dependent histone genes are relatively unique in that they are organized in large clusters of genes on chromosomes 1 (13 genes) and 6 (55 genes) (1, 30). Presumably, this organization is important for the coordinate expression of the four core histone subtypes, such that a balance of histone precursors is generated during S phase. The tethering of p220-containing CBs with these gene clusters is interesting in this regard and presumably indicates local action of p220 in promoting coordinate expression of these genes. It remains to be determined whether the pathways used by p220 to activate histone H4 transcription during G0/G1 are analogous to those used to achieve higher levels of transcription during S phase and precisely how p220 activates transcription of all for classes of histone genes. One possibility is that p220 functions through elements common to all core histone genes, thereby providing a mechanism for coordinate activation of these genes. It is also possible that p220 plays additional roles in histone mRNA accumulation, possibly through effects on posttranscriptional histone mRNA processing. The identification of proteins that interact with p220 is required to more fully understand how p220 functions to control histone transcription and S-phase entry.
Our work has also revealed a role for p220 in maintaining focal p80coilin localization as cells enter S phase. CBs are heterogeneous in nature (reviewed in reference 36). In the HCT116 cells used here, p220-positive foci always contain p80coilin but not all p80coilin-containing foci, CBs, contain p220. The basis of this heterogeneity is unknown, but it likely reflects the fact that p220-positive CBs are tethered to histone gene clusters while other CBs are bound to other gene loci, including snRNA genes (16, 43). Previous studies have demonstrated that the number of CBs and the intensity of p80coilin immunostaining increase as cells progress from G1 into S phase. This is due, in part, to the generation of two p220-containing CBs tethered to chromosome 1 histone gene clusters during S phase (26, 53). In HCT116 cells arrested by serum deprivation, the focal nature of localization is maintained in the absence of p220. When p220flox/- cells are induced to enter the cell cycle from G0, focal p80coilin staining is maintained, as expected. In contrast, cells lacking p220 display aberrant patterns of coilin staining. In particular, a significant fraction of cells display what we refer to as dissociative p80coilin localization. This pattern features punctate p80coilin staining throughout the nucleus. We found that a subset of p220-deficient cells maintained p80coilin staining. Given the finding that a substantial fraction of quiescent HCT116 cells failed to enter S phase by 13 h after serum addition (Fig. 3A), it is possible that p220-negative cells that retain focal p80coilin staining represent those that did not exit G0. We postulate that the presence of p220 in CBs is required to maintain focal p80coilin staining. This suggests a dynamic interplay among p220, p80coilin, and CBs. These organelles are known to be highly dynamic and to undergo ATP-dependent reorganization (37). The mechanism by which p220 promotes p80coilin localization remains to be determined.
|
ACKNOWLEDGMENTS |
|---|
We are grateful to J. Zhao (University of Rochester) for antibodies, Denise Galloway (Fred Hutchinson Cancer Research Center) for E6 and E7 vectors, and S. Hamilton (Baylor College of Medicine) for access to ABI Prism 7700 equipment.
This work was supported by grants from the National Institutes of Health (GM54137) and the Welch Foundation to J.W.H. Y.W. was supported by a Department of Defense predoctoral fellowship and by Breast Cancer Training Grant DAMD-17-02-0292 from the Department of Defense. G.N. was supported by the Robert A. Welch Foundation (Q-1245).
|
FOOTNOTES |
|---|
Present address: Department of Pathology, Harvard Medical School, Boston, MA 02115.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Aziz, F., A. J. van Wijnen, J. L. Stein, and G. S. Stein. 1998. HiNF-D (CDP-cut/CDC2/cyclin A/pRB-complex) influences the timing of IRF-2-dependent cell cycle activation of human histone H4 gene transcription at the G1/S phase transition. J. Cell. Physiol. 177:453-464.[CrossRef][Medline]
3. Aziz, F., A. J. van Wijnen, P. S. Vaughan, S. Wu, A. R. Shakoori, J. B. Lian, K. J. Soprano, J. L. Stein, and G. S. Stein. 1998. The integrated activities of IRF-2 (HiNF-M), CDP/cut (HiNF-D) and H4TF-2(HiNF-P) regulate transcription of a cell cycle controlled human histone H4 gene: mechanistic differences between distinct H4 genes. Mol. Biol. Rep. 25:1-12.[CrossRef][Medline]
4. Berezutskaya, E., and S. Bagchi. 1997. The human papillomavirus E7 oncoprotein functionally interacts with the S4 subunit of the 26S proteasome. J. Biol. Chem. 272:30135-30140.
5. Brown, J. P., W. Wei, and J. M. Sedivy. 1997. Bypass of senescence after disruption of p21CIP1/WAF1 gene in normal diploid human fibroblasts. Science 277:831-834.
6. Bunz, F., A. Dutriaux, C. Lingauer, T. Waldman, S. Zhou, J. P. Brown, J. M. Sedivy, K. W. Kinzler, and B. Vogelstein. 1998. Requirement for p53 and p21 to sustain G2 arrest after DNA damage. Science 282:1497-1501.
7. Cajal, S. R. Y. 1903. Un sencillo metodo de coloracion seletiva del reticulo protoplasmatico y sus efectos en los diversos organos nerviosos de vertebrados e invertebrados. Trab. Lab. Investig. Biol. 2:129-221.
8. Connell-Crowley, L., S. J. Elledge, and J. W. Harper. 1998. G1 cyclin-dependent kinases are sufficient to initiate DNA synthesis in quiescent human fibroblasts. Curr. Biol. 8:65-68.[CrossRef][Medline]
9. Dailey, L., S. M. Hanly, R. G. Roeder, and N. Heintz. 1986. Distinct transcription factors bind specifically to two regions of the human histone H4 promoter. Proc. Natl. Acad. Sci. USA 83:7241-7245.
10. Dailey, L., S. B. Roberts, and N. Heintz. 1988. Purification of the human histone H4 gene-specific transcription factors H4TF-1 and H4TF-2. Genes Dev. 2:1700-1712.
11. DeLisle, A. J., R. A. Graves, W. F. Marzluff, and L. F. Johnson. 1983. Regulation of histone mRNA production and stability in serum-stimulated mouse 3T6 fibroblasts. Mol. Cell. Biol. 3:1920-1929.
12. Di Fruscio, M., H. Weiher, B. C. Vanderhyden, T. Imai, T. Shiomi, T.-A. Hori, R. Jaenisch, and D. A. Gray. 1997. Proviral inactivation of the Npat gene of Mpv 20 mice results in early embryonic arrest. Mol. Cell. Biol. 17:4080-4086.[Abstract]
13. Dominski, Z., L. X. Zheng, R. Sanchez, and W. F. Marzluff. 1999. Stem-loop binding protein facilitates 3'-end formation by stabilizing U7 snRNP binding to histone pre-mRNA. Mol. Cell. Biol. 19:3561-3570.
14. Dyson, N. 1998. The regulation of E2F by pRb-family proteins. Genes Dev. 12:2245-2262.
15. Eliassen, K. A., A. Baldwin, E. M. Sikorski, and M. M. Hurt. 1998. Role for a YY1-binding element in replication-dependent mouse histone gene expression. Mol. Cell. Biol. 18:7106-7118.
16. Frey, M. R., and A. G. Matera. 1995. Coiled bodies contain U7 small nuclear RNA and associate with specific DNA sequences in interphase human cells. Proc. Natl. Acad. Sci. USA 92:5915-5919.
17. Gall, J. G., M. Bellini, Z. Wu, and C. Murphy. 1999. Assembly of the nuclear transcription and processing machinery: Cajal bodies (coiled bodies) and transcriptosomes. Mol. Biol. Cell 10:4385-4402.
18. Gall, J. G. 2000. Cajal bodies: the first 100 years. Annu. Rev. Cell Dev. Biol. 16:273-300.[CrossRef][Medline]
19. Harris, M. E., R. Bohni, M. H. Schneiderman, L. Ramamurthy, D. Schumperli, and W. F. Marzluff. 1991. Regulation of histone mRNA in the unperturbed cell cycle: evidence suggesting control at two posttranscriptional steps. Mol. Cell. Biol. 11:2416-2424.
20. Hebert, M. D., P. W. Szymczyk, K. B. Shpargel, and A. G. Matera. 2001. Coilin forms the bridge between Cajal bodies and SMN, the spinal muscular atrophy protein. Genes Dev. 15:2720-2729.
21. Heintz, N. 1991. The regulation of histone gene expression during the cell cycle. Biochim. Biophys. Acta 1088:327-339.[Medline]
22. Leng, X., L. Connell-Crowley, D. Goodrich, and J. W. Harper. 1997. S-phase entry upon ectopic expression of G1 cyclin-dependent kinases in the absence of retinoblastoma protein phosphorylation. Curr. Biol. 7:709-712.[CrossRef][Medline]
23. Liu, J., M. D. Hebert, Y. Ye, D. J. Templeton, H. Kung, and A. G. Matera. 2000. Cell cycle-dependent localization of the CDK2-cyclin E complex in Cajal (coiled) bodies. J. Cell Sci. 113:1543-1552.[Abstract]
24. Lukas, J., T. Herzinger, K. Hansen, M. C. Moroni, D. Resnitzky, K. Helin, S. I. Reed, and J. Bartek. 1997. Cyclin E-induced S phase without activation of the pRb/E2F pathway. Genes Dev. 11:1479-1492.
25. Ma, T., N. Zou, B. Y. Lin, L. T. Chow, and J. W. Harper. 1999. Interaction between cyclin-dependent kinases and human papillomavirus replication-initiation protein E1 is required for efficient viral replication. Proc. Natl. Acad. Sci. USA 96:382-387.
26. Ma, T., Van B. Tine, Y. Wei, M. Garrett, D. Nelson, P. D. Adams, J. Wang, J. Qin, L. T. Chow, and J. W. Harper. 2000. Cell-cycle regulated phosphorylation of p220NPAT by cyclin E/Cdk2 in Cajal bodies promotes histone gene transcription. Genes Dev. 14:2298-2313.
27. Martin, L. G., G. W. Demers, and D. A. Galloway. 1998. Disruption of the G1/S transition in human papillomavirus type 16 E7-expressing human cells is associated with altered regulation of cyclin E. J. Virol. 72:975-985.
28. Martinelli, R., and N. Heintz. 1994. H1TF2A, the large subunit of a heterodimeric, glutamine-rich CCAAT-binding transcription factor involved in histone H1 cell cycle regulation. Mol. Cell. Biol. 14:8322-8332.
29. Marzluff, W. F., and R. J. Duronio. 2002. Histone mRNA expression: multiple levels of cell cycle regulation and important developmental consequences. Curr. Opin. Cell Biol. 14:692-699.[CrossRef][Medline]
30. Marzluff, W. F., P. Gongidi, K. R. Woods, J. Jin, and L. J. Maltais. 2002. The human and mouse replication-dependent histone genes. Genomics 80:487-498.[CrossRef][Medline]
31. Matera, A. G. 1999. RNA splicing: more clues from spinal muscular atrophy. Curr. Biol. 9:R140-R142.[CrossRef][Medline]
32. Metzger, D., J. Clifford, H. Chiba, and P. Chambon. 1995. Conditional site-specific recombination in mammalian cells using a ligand-dependent chimeric Cre recombinase. Proc. Natl. Acad. Sci. USA 92:6991-6995.
33. Minella, A. C., J. Swanger, E. Bryant, M. Welcker, H. Hwang, and B. E. Clurman. 2002. p53 and p21 form an inducible barrier that protects cells against cyclin E-cdk2 deregulation. Curr. Biol. 12:1817-1827.[CrossRef][Medline]
34. Nelson, D. M., X. Ye, C. Hall, H. Santos, T. Ma, G. D. Kao, T. J. Yen, J. W. Harper, and P. D. Adams. 2002. Coupling of DNA synthesis and histone synthesis in S phase independent of cyclin/cdk2 activity. Mol. Cell. Biol. 22:7459-7472.
35. Nevins, J. R. 1998. Toward an understanding of the functional complexity of the E2F and retinoblastoma families. Cell Growth Differ. 9:585-593.[Medline]
36. Ogg, S. C., and A. I. Lamond. 2002. Cajal bodies and coilin—moving towards function. J. Cell Biol. 159:17-21.
37. Platani, M., I. Goldberg, J. R. Swedlow, and A. I. Lamond. 2000. In vivo analysis of Cajal body movement, separation, and joining in live human cells. J. Cell Biol. 151:1561-1574.
38. Ramsey-Ewing, A., A. J. Van Wijnen, G. S. Stein, and J. L. Stein. 1994. Delineation of a human histone H4 cell cycle element in vivo: the master switch for H4 gene transcription. Proc. Natl. Acad. Sci. USA 91:4475-4479.
39. Ruesch, M. N., and L. A. Laimins. 1997. Initiation of DNA synthesis by human papillomavirus E7 oncoproteins is resistant to p21-mediated inhibition of cyclin E-cdk2 activity. J. Virol. 71:5570-5578.[Abstract]
40. Sanchez, R., and W. F. Marzluff. 2002. The stem-loop binding protein is required for efficient translation of histone mRNA in vivo and in vitro. Mol. Cell. Biol. 22:7093-7104.
41. Sherr, C. J. 1996. Cancer cell cycles. Science 274:1672-1677.
42. Sherr, C. J., and J. M. Roberts. 1999. CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev. 13:1501-1512.
43. Shpargel, K. B., J. K. Ospina, K. E. Tucker, A. G. Matera, and M. D. Hebert. 2003. Control of Cajal body number is mediated by the coilin C terminus. J. Cell Sci. 116:303-312.
44. Spruck, C. H., K. A. Won, and S. I. Reed. 1999. Deregulated cyclin E induces chromosome instability. Nature 401:297-300.
