Previous Article | Next Article ![]()
Molecular and Cellular Biology, December 2003, p. 8637-8650, Vol. 23, No. 23
0270-7306/03/$08.00+0 DOI: 10.1128/MCB.23.23.8637-8650.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Division of Developmental and Clinical Immunology, Department of Microbiology,1 Department of Pathology, University of Alabama at Birmingham, Birmingham, Alabama 35294-3300,2 National Institute for Basic Biology, Okasaki, Japan3
Received 7 February 2003/ Returned for modification 10 April 2003/ Accepted 19 August 2003
|
|
|---|
|
|
|---|
While it is now clear that Notch1 plays an integral role in T-cell lineage specification, controversy persists surrounding its role in later stages of T-cell development. Early studies in which expression of Notch1IC, driven by the proximal Lck promoter, resulted in skewed thymocyte development to the CD8 lineage led authors to conclude that activated Notch1 influences CD4-versus-CD8-lineage fate (32). However, subsequent studies showed transgenic expression from the proximal Lck promoter of another form of Notch1IC, which included more of its C-terminal transactivation domain, promoted maturation of both CD4 and CD8 SP cells, although the mice expressing this form of Notch1IC also developed an excess of CD8SP (7). In contrast to the findings of both of these studies, retroviral expression of Notch1IC, also with the extended transactivation domain, resulted in an apparent block in T-cell development at the CD4+ CD8+ double-positive (DP) stage (18). Though formal proof is lacking, it has been proposed that differences among the various forms of Notch1IC used in these independent studies resulted in differential expression levels of Notch1IC (18) as well as in differing propensities for tumor formation (11) and may account for the discrepant phenotypes.
In light of these studies, it was surprising that the conditional inactivation of Notch1 in double-negative (CD4- CD8-) thymocytes showed no effects on the development of either CD4SP or CD8SP, suggesting that other Notch family members might compensate in the regulation of SP thymocyte maturation in the absence of Notch1 (40). One such protein is the Notch family member Notch2, which is also expressed in hematopoietic cells, including developing thymocytes (37). Although these latter studies suggest that some functional redundancy may exist between Notch1 and Notch2 in later stages of T-cell development, numerous observations argue against complete redundancy among these proteins throughout hematopoiesis. For instance, the inability of Notch2 to compensate for the loss of Notch1 in T-lineage specification indicates that these proteins do not serve redundant roles in the early stages of T-cell development. In addition, studies have shown that while both Notch1 and Notch2 inhibit the cytokine-induced differentiation of 32D myeloid cells, they do so in a cytokine-specific manner and that structural differences in their notch cytokine response domains are responsible for this functional specificity (2). More recently, it was shown that the phosphorylation of a critical serine residue unique to the Notch2 notch cytokine response domain regulates its cytokine-specific inhibition of 32D myeloid cell differentiation (17). Despite these and other observations highlighting important differences between Notch1 and Notch2, most of what is known of Notch function in hematopoiesis continues to come from studies of the family member Notch1. Consequently, the role of Notch2 and the extent to which it serves unique functionality in hematopoiesis remain unclear.
To investigate the role of Notch2 in hematopoiesis, we analyzed Notch2 protein expression in the hematopoietic system. To obtain insight into its function, we expressed various levels of an activated form of Notch2 (N2IC) in murine hematopoietic progenitors by using a retroviral vector coexpressing green fluorescent protein (GFP) as a reporter. Transduced cells were transplanted into irradiated recipient mice and analyzed at various time points posttransplantation for the effects of N2IC on hematopoiesis. Our studies show that various expression levels of N2IC result in contrasting phenotypes for the T-cell lineage. High levels of N2IC lead to the development of highly proliferative T-cell populations, which invariably give rise to leukemias, while lower levels enhance the maturation of the CD8SP cells, skewing thymocyte development to the CD8 lineage. Furthermore, in contrast to what has been reported for Notch1, we show that N2IC permits early B-cell development but results in a block in conventional B2 B-cell development at the pre-B-cell stage. In addition to blocking maturation of B2 cells, N2IC promoted the selective development of B1 B cells. These results suggest that Notch2 plays a role in CD8SP thymocyte maturation and has a unique function in the development of the B1 B-cell subset.
|
|
|---|
Assessment of ß-Gal activity by flow cytometry for Notch2 protein expression and antibodies. Single-cell suspensions were stained with antibodies to immunophenotypic markers, washed, and loaded with fluorescein di-ß-D-galactopyranoside by using a FluoReporter lacZ flow cytometry kit (Molecular Probes) as described in the manufacturer's protocol. N2 protein expression was determined by assessing ß-Gal activity within specific subpopulations as indicated by the production of fluorescein. For three- and four-color analysis, cells were resuspended in propidium iodide and viable cells were electronically gated and analyzed on either a FACSCalibur (Becton Dickinson) or MoFlo (Cytomation) system. Antibodies included phycoerythrin-conjugated anti-Gr-1, anti-CD43, anti-Syn-1, anti-CD8, anti-CD4, anti-CD3, anti-HSA, anti-CD19, anti-BP-1, anti-CD5, and anti-T-cell-receptor (anti-[TCR]) ß chain; APC-conjugated anti-Mac-1 and anti-CD8; PECy5-conjugated anti-B220, anti-CD44, and anti-CD4; and biotinylated anti-CD23, anti-CD25, anti-c-kit, anti-AA4.1, and anti-CD69. All antibodies were purchased from BD Pharmingen. Streptavidin-conjugated Spectral Red and Texas Red were purchased from Southern BioTech (Birmingham, Ala.). Goat anti-mouse immunoglobulin M (IgM) coupled to Cy5 was purchased from Jackson Immunoresearch Inc. (West Grove, Pa.).
Construction of retroviral vectors. The entire intracellular domain of Notch2 (N2IC), beginning at base pair 5,248 (GenBank accession no. D32210), was generated from full-length Notch2 cDNA cloned into pTracer-CMV (a gift from Yoshio Hamada, National Institute for Basic Biology, Okasaki, Japan) by PCR by using PWO polymerase (Roche) as described in the manufacturer's protocol. N2IC/MSCV forward primer (CGCCGCCATGGTCATCATGGCCAAGCGGAAGCAAGC) and N2IC/MSCV reverse primer (TCATGCATACACCTGCATGTTGCT) were purchased from Operon (Alameda, Calif.). N2IC was blunt cloned into the EcoR1 site upstream of the IRES element of the parental murine stem cell virus (MSCV) IRES/GFP vector (16), which also served as the control. The N2IC insert was verified by DNA sequencing.
Western blotting. NIH 3T3 fibroblasts plated to 80% confluency were transfected with full-length Notch2 (used for PCR generation of the N2IC fragment referred to above), N2IC/MSCV, or control vector by calcium phosphate coprecipitation. At 24 h, cells were lysed in Laemmli buffer and run on an 8% polyacrylamide gel. N2IC protein was detected with a goat anti-mouse antibody raised against a peptide mapping to the carboxy terminus of Notch2 (Santa Cruz Biotechnology, Inc.) and was visualized by anti-goat IgG horseradish peroxidase and enhanced chemiluminescence (Amersham Pharmacia).
Retroviral transduction of whole bone marrow and transplantations. BOSC23 retroviral producer cells were plated at 70% confluency and transfected 24 h later with 10 µg of N2IC/MSCV or control vector DNA by calcium phosphate coprecipitation. On the day of transfection, whole bone marrow (WBM) was harvested from 6- to 8-week-old C57BL/6 mice pretreated 4 days previously with 5-flourouracil by intraperitoneal injection at a dosage of 150 mg/kg of body weight. Harvested WBM was treated for 3 min on ice with sterile ACK (0.15 M NH4Cl and 0.01 M KHCO3) to lyse red blood cells and then plated for 24 h prestimulation as previously described (6). After 24 h, WBM was plated onto transfected and irradiated (30-Gy) BOSC23 retroviral producers with or without the addition of 4 µg of Polybrene/ml for a 48-h coculture prior to transplantation. On the day of the transplant, 6- to 8-week-old congenic C57BL/6-Ly5.1 mice were lethally irradiated with 10 Gy in a split dose separated by 3 h. The transduction efficiency of WBM cocultures was assessed by fluorescence-activated cell sorter (FACS), and 2 x 105 WBM cells were injected by tail vein into irradiated recipient mice. The recipients were maintained for 3 weeks on acidified water containing neomycin sulfate (1.1 g/liter) and polymyxin B sulfate (106 U/liter).
Adoptive transfers. DP and CD8SP populations from N2IChi WBM were isolated by fluorescence-activated cell sorting with a MoFlo (Cytomation) sorter. Cells (8 x 104) from each population were injected into the lateral tail veins of nonirradiated 6- to 8-week-old congenic C57BL/6-Ly5.1 mice. The mice were sacrificed at 6 weeks posttransfer for analysis of peripheral blood, bone marrow, spleen, and thymus.
In vivo LPS treatment. N2IClo and empty control vector mice (12 weeks posttransplant [PT]) and wild-type C57BL/6 mice were treated with 20 µg of lipopolysaccharide (LPS) (Sigma) by intravenous injection. Untreated wild-type C57BL/6, untreated empty control vector, and untreated N2IClo mice served as negative controls. Wild-type C57BL/6 and empty control vector mice treated with the same LPS dosage served as positive controls for comparison of LPS responsiveness within the splenic IgM+ populations. At 48 h after the LPS injection, the mice were sacrificed and single-cell suspensions were prepared from harvested spleens. The cell suspensions were stained with anti-IgM and anti-Syn-1 and resuspended in propidium iodide for analysis of viable cells with FACSCalibur.
|
|
|---|
![]() View larger version (90K): [in a new window] |
FIG. 1. Localization of Notch2 Protein in spleen and thymus. (A) Splenic cryosections at 100x (left panel) and 200x (right panel) magnification. (B) Thymic cryosections at 20x (left panel), 200x (right panel), and 400x (bottom) magnification. TZ, T-cell zone; RP, red pulp; CMJ, cortico-medullary junction; SCZ, cortical-subcapsulary zone. The results are representative of two independent experiments.
|
![]() View larger version (36K): [in a new window] |
FIG. 2. Notch2 protein expression in the myeloid and B-cell lineages. Cells gated on specific lineage markers are represented as histogram overlays of negative control (filled) and N2/ß-Gal (unfilled) cells. (A) Notch2 expression in Mac-1+ Gr-1+ myeloid cells derived from total bone marrow (BM) and total spleen. (B) Total bone marrow was stained with anti-B220, anti-CD19, anti-CD43, and anti-IgM antibodies. B220+ gated cells (left) were fractionated according to the method of Hardy et al. for analysis of Notch2 expression in each subset (right panels) as follows: B220+ CD19- cells (fraction A); CD19+ CD43+ IgM- cells (fractions B through C); CD19+ CD43- IgM- cells (fraction D); and CD19+ CD43- IgM+ cells (fractions E through F). (C) IgM+ gated splenocytes were further gated based on CD21 and CD23 expression for analysis of Notch2 expression in FO and MZ B cells (top panel). Notch2 expression in IgM+/- Syn-1hi plasma cells (right) derived from total spleen is shown (bottom panel). (D) Mac-1+ IgM+ B1 B cells and Mac-1- IgM+ B2 cells of the peritoneal cavity are gated for Notch2 expression. Each value is representative of the results of at least three independent experiments with two mice per analysis.
|
Notch2 is expressed in early T-cell development and in immature CD8+ thymocytes. Within the various subsets of developing triple-negative (TN) thymocytes (CD3- CD4- CD8-; TN1, TN2, TN3, and TN4) (Fig. 3A), Notch2 protein was detected in the earliest population of CD44+ CD25- TNs (TN1) but was largely restricted to CD44hi precursors with no expression in CD44lo cells of this subset (data not shown). Notch2 expression increased as thymocytes progressed to the CD44+ CD25+ (TN2) and CD44- CD25+ stages (TN3) and then declined in a fraction of the CD44- CD25- cells (TN4). Within the CD4+ CD8+ DP population, expression levels were found to be age dependent, with 20 to 30% of DP thymocytes expressing Notch2 in mice 2- to-4-weeks old but only 9 to 12% expressing Notch2 in mice older than 14 weeks (Fig. 3B and data not shown). Analysis of SP subsets revealed no Notch2 expression in CD4SP but significant levels of Notch2 expression within a subset of the CD8SP population (Fig. 3B). Because this population is heterogeneous, consisting of both immature SP thymocytes (ISP) and mature CD8SP, we wished to determine whether Notch2 expression was correlated with the maturational status of the CD8SP. Indeed, we found that within this population, expression was limited to HSA+ TCRlo/- ISP thymocytes and was not detected in mature HSAint/- TCRhi CD8SP (Fig. 3C).
![]() View larger version (33K): [in a new window] |
FIG. 3. Notch2 protein expression in developing thymocytes. (A) CD3- CD4- CD8- gated cells (center) were further fractionated according to defined stages of early thymic development (TN1-4) for analysis of Notch2 expression within subsets (left and right). (B) Total thymus was stained with anti-CD4 and anti-CD8 for analysis of DP and SP populations. (C) Total thymus was stained with anti-CD4, anti-CD8, and either anti-TCR or anti-HSA to delineate immature from mature CD8SP. Each value is representative of the results of at least three independent experiments with two mice per analysis.
|
![]() View larger version (41K): [in a new window] |
FIG.4. A high level of N2IC results in proliferative T-cell populations. (A) Schematic of retroviral vector expressing N2IC and GFP (N2IC/MSCV) and control vector expressing GFP alone (bottom). (B) Western blot showing N2IC expression from the retroviral vector. NIH 3T3 fibroblasts were transfected with N2IC/MSCV, control vector, or full-length Notch2 as the positive control for the anti-Notch2 antibody. (C) GFP+ gated populations from bone marrow, spleen, and thymus of N2IChi and control mice 6 weeks PT stained for CD4 and CD8 expression. (D) Immature phenotype of N2IChi CD8+ cells 6 weeks PT. Total spleen was stained with anti-CD4, anti-CD8, and anti-TCR. TCR expression levels and forward scatter (FSC) properties of GFP+ CD8+ gated splenocytes from N2IChi and control mice are shown (right). The values shown in panels C and D are representative of the results for N2IChi mice (n = 12) analyzed in three independent experiments. (E) DP cells (8 x 104) (top) and CD8SP cells (bottom) FACS-purified from N2IChi bone marrow 26-days PT were adoptively transferred into nonirradiated recipients. Recipient bone marrow 6-weeks postadoptive transfer shows extensive in vivo expansion. The values shown are representative of the results for N2IChi mice (n = 5 for each transferred population) analyzed in two independent experiments.
|
Expanding T-cell populations in the bone marrow may have resulted from an ongoing skew in hematopoiesis toward the T-cell lineage or by the seeding of proliferating T cells following transplantation. In order to assess their proliferative potential, 8 x 104 GFP+ CD4+ CD8+ or GFP+ CD8SP cells FACS-purified from N2IChi bone marrow 26 days PT were adoptively transferred into recipient mice and then monitored by peripheral blood analysis for their in vivo expansion. Aggressive T-cell leukemias comprising the majority of bone marrow cells developed in all recipient mice (n = 5) within 6 weeks PT, demonstrating that the T-cell populations in N2IChi bone marrow were highly proliferative (Fig. 4E). The fact that rapid expansion was achieved from purified T cells indicates that these populations in N2IChi bone marrow were self generating and did not require input of stem cell progenitors for either their maintenance or their expansion.
Low-level expression of N2IC skews thymocyte development to the CD8 lineage. To assess the effects of N2IC on the T-cell lineage in the absence of leukemic cells, more-detailed analyses were done on mice expressing lower levels of N2IC (N2IClo). These mice developed only small (or no) DP T-cell populations in the periphery and remained free from leukemia as long as 10 months PT, thus permitting the analyses of both T- and B-lymphoid compartments.
Within the GFP+ thymocyte population of N2IClo mice, there was a decrease in the relative frequency of DP thymocytes, with a concomitant increase in CD8SP, compared to that of the control mice (Fig. 5A). This skew in thymic development varied in degree but was present in all N2IClo mice analyzed (n = 8) (Fig. 5B). Because the CD8SP population in thymus is heterogeneous and consists of both the ISP (TCRlo/- HSA+) and mature CD8SP (TCRhi HSAint/-), it was not clear whether N2IClo was blocking or otherwise delaying the progression of the ISP to the DP stage or whether N2IClo was enhancing the progression of DP thymocytes to the SP stage. We therefore stained thymocytes with antibodies to markers that identify the maturational status of CD8+ thymocytes. Analysis of this population showed a significantly higher frequency of TCRhi HSAint/- thymocytes than in the controls, indicating a relative increase in mature thymocytes (Fig. 5C). These results, taken with the decrease in DP thymocytes and increase in CD8SP, indicate that N2IClo enhances the progression of DP thymocytes to the SP stage of development and that this effect is preferential to the CD8 lineage.
![]() View larger version (21K): [in a new window] |
FIG. 5. Low level of N2IC skews thymocyte development to the CD8 lineage. (A) N2IClo thymus analyzed at 4- to 6-weeks PT. N2IClo and control thymus were stained with anti-CD4 and anti-CD8.(B) Data compiled from two independent experiments (n = 8) showing the frequencies of DP and SP populations in N2IClo ( ) and control mice ( ). (C) Expression of TCR and HSA on GFP+ CD8+ gated thymocytes from N2IClo and control thymus stained with anti-CD4, anti-CD8, and either anti-TCR or anti-HSA.
|
![]() View larger version (20K): [in a new window] |
FIG. 6. N2IClo results in increased frequencies of TCRhi CD69hi DP thymocytes. (A) Total thymus was stained with anti-CD4, anti-CD8, and either anti-TCR or anti-CD69. (B) Data compiled from two independent experiments (n = 6) showing the frequencies of CD69hi and TCRhi cells within GFP+ DP gated thymocytes. (C) Linear correlation between the frequency of TCRhi DP and CD8SP. The data was compiled from two independent experiments (n = 6). Ctrl, control.
|
3 weeks PT), prior to substantive T cell expansion, showed similar frequencies in B220+ cells for N2IChi and N2IClo mice. However, relative frequencies of B220+ cells in N2IChi mice declined over time as T-cell populations expanded (Fig. 7B). Furthermore, at late stages of leukemic progression (>6 weeks PT), all lineages of both donor and recipient-derived origin were suppressed, as is often the case under leukemic conditions (data not shown). Analyses of the B lineage at early time points PT revealed similar phenotypes for B-cell development for both N2IChi and N2IClo mice (described below).
![]() View larger version (28K): [in a new window] |
FIG. 7. N2IC permits B-cell commitment but inhibits B2 B-cell development at the pre-B-cell stage. (A) Frequency of B220+ cells expressed as a percentage of the GFP+ population in N2IClo, N2IChi, and control bone marrow (BM) analyzed 3- to 6-weeks PT. (B) Decline in frequency of B220+ cells within the GFP+ population of N2IChi bone marrow as T cells expand. (C) CD19 expression on GFP+ B220+ gated cells (left) and BP-1 and c-kit expression on CD19+ gated cells (right) from N2IClo bone marrow. (D) Representative expression profile for CD43 and IgM on B220+ GFP+ gated cells from N2IClo and control bone marrow. (E) Compiled data showing the frequencies of Hardy fraction subsets expressed as percentages of GFP+ B220+ derived from N2IClo and control bone marrow analyzed 3- to 6-weeks PT and of N2IChi bone marrow analyzed 3-weeks PT. The data were compiled from analyses of N2IClo mice (n = 12) from three independent experiments and N2IChi mice (n = 4) from two independent experiments. Ctrl, control.
|
Although early B-cell subsets appeared unimpaired, N2IC had a profound impact on later stages of B-cell development. Within the GFP+ B220+ population of N2IClo bone marrow, there was a severe reduction in Hardy fractions D through F (14) in the bone marrow of all N2IClo mice analyzed from three independent experiments (n = 12) (Fig. 7D and E). The absence of these fractions, which represent the majority of B220+ B-lineage cells in bone marrow, accounts for the severe reduction in B220+ cells in all N2IC mice. Collectively, these results show that the low frequencies of B220+ cells within the GFP+ population of N2IC mice were not due to a block in B-cell commitment but rather were due to a block in developmental progression from the fraction C to the fraction D stage.
N2IC promotes the selective development of B1 B cells. While mature B2 cells were absent in all N2IC mice regardless of N2IC levels, B220+ cells coexpressing IgM and CD43 were present at a significant frequency (between 10 to 20%) of the GFP+ B220+ bone marrow population (Fig. 7D). IgM+ CD43+ cells were found in peripheral blood and represented the vast majority of the GFP+ B-cell population within N2IClo spleen (Fig. 8A). Further analyses showed that these cells exhibited large forward- and side-scatter properties and expressed intermediate to high levels of CD5 in addition to CD43 (Fig. 8B). This phenotype defines the B1 B-cell subset that resides at low frequency in adult spleen and at a greater frequency in the adult peritoneal cavity (22). The generation of B1 B-cells led to a three- to sevenfold increase in the absolute number of B1 B cells in the spleens of N2IC mice and were not a result of clonal expansion, as both kappa and lambda light chains were expressed at appropriate ratios within the GFP+ B220+ population (data not shown). Analysis at 13 days PT showed that developing sIgM- B progenitors expressed CD5 protein (Fig. 8C), consistent with recent unpublished observations that developing fetal B1 B cells express CD5 protein prior to surface IgM expression (P. Kincade et al., personal communication). CD5+ IgM+ cells present in bone marrow were also AA4.1+, indicating that these cells were newly formed, as opposed to recirculating mature B cells (Fig. 8D). The apparent de novo production of B1 B cells persisted over time, as similar results were obtained from analyses of B-cell development as long as 14 weeks PT. Finally, similar results were obtained from studies of N2IChi mice analyzed at early time points PT (data not shown), indicating that the generation of the B1 B-cell phenotype was not a function of N2IC expression levels.
![]() View larger version (38K): [in a new window] |
FIG. 8. N2IC promotes the selective development of B1 B cells. (A) Total spleen was stained with anti-B220, anti-CD43, and anti-IgM. GFP+ B220+ gated cells from N2IClo and control spleen are shown as contour plots (left) with frequencies shown in each quadrant. The forward scatter (FSC)/side scatter (SSC) properties of GFP+ IgM+ gated splenocytes are shown (right). (B) Total spleen was stained with anti-IgM and either anti-CD43 or anti-CD5. Expression of CD43 and CD5 on GFP+ IgM+ gated splenocytes is displayed as histogram overlays of N2IClo (unfilled) and control (filled) cells. (C) Analysis at 13 (left)- and 21 (right)-days PT showing CD5 expression on CD19+ gated cells from N2IC and control bone marrow. (D) AA4.1 expression on GFP+ IgM+ bone marrow cells from N2IClo mice displayed as an overlay of GFP+ IgM+ cells from N2IClo spleen. (E) Representative histogram showing the upregulation of Syn-1 48 h after an LPS injection. GFP+ IgM+ gated splenocytes from treated N2IClo mice and IgM+ gated splenocytes from treated C57BL/6 mice (WT) are shown. For comparison, IgM+ gated splenocytes from untreated wild-type C57BL/6 mice are also shown. (F) Compiled data from two independent experiments (n = 4). The results for untreated N2IClo mice showed frequencies of Syn-1hi cells similar to those for untreated wild-type C57BL/6 mice but are not shown in panel E.
|
|
|
|---|
The fact that different expression levels of N2IC resulted in such contrasting phenotypes suggests that levels of Notch2 signaling may have important consequences for thymocyte development. In mice expressing high levels of N2IC, CD8+ T-cell populations with variable levels of CD4 developed in the bone marrow and spleen and gave rise to leukemias between 6 to 10 weeks posttransplantation, similar to results obtained in a previous study of mice expressing an activated form of Notch1 (30). However, in N2IChi mice, peripheral T-cell populations were shown to be highly proliferative, as demonstrated by their aggressive expansion in vivo upon adoptive transfer. Because GFP+ thymocytes lacked early double-negative thymocytes and were phenotypically indistinguishable from peripheral T-cell populations, it is likely that N2IChi thymocytes were the result of thymic seeding by these same proliferative cells observed in the periphery. Therefore, what appeared to be a block in thymocyte development at the DP stage may reflect disregulation imparted by transformation, thus making it difficult to define a physiologic role for Notch2 in normal thymocyte development from these mice.
In contrast to findings for N2IChi mice, DP T-cell populations were generally not observed outside of the thymus in mice expressing lower levels of N2IC. Consistent with the absence of these proliferative populations, N2IClo mice remained free from pathology as long as 10 months posttransplantation, thus permitting the assessment of N2IC effects on thymocyte development in the absence of leukemia. Within the GFP+ thymocyte population of N2IClo mice, there was a decrease in the frequency of DP thymocytes, with a concomitant increase in CD8SP thymocytes. These results are consistent with previous reports in which an activated form of Notch1IC driven by the proximal Lck promoter influenced a CD4-versus-CD8-lineage outcome (32). Further analyses of the GFP+ CD8SP population in N2IClo mice showed an increased frequency in mature versus immature thymocytes, indicating that the increase in CD8SP was due to enhanced progression from the DP stage rather than a block in ISP progression. In addition, N2IClo also resulted in a higher frequency of CD69hi TCRhi thymocytes, suggesting that activated Notch2 enhances positive selection (33). These results are particularly interesting in light of recent studies which showed that overexpression of CD69 in developing thymocytes resulted in enhanced positive selection, possibly by facilitating the trafficking of thymocytes to the medulla, where maturation of SP thymocytes takes place (10, 27). It is possible that Notch2 signaling during selective events, either directly or indirectly, upregulates expression of CD69 on DP thymocytes, which leads to an increase in postselected thymocytes. If this effect were specific to cells fated to the CD8 lineage, then enhanced migration to the medulla might be one means by which N2IC facilitates CD8SP maturation. Another intriguing possibility, not mutually exclusive, is suggested by recent studies which indicate that the progression of DP thymocytes through a TCRhi stage is a differentiation pathway preferentially taken by CD8 lineage-committed DP thymocytes during the course of their development (5). In this case, the higher frequencies of TCRhi DP thymocytes in N2IClo thymus may reflect the preferred pathway taken by developing CD8 lineage-committed thymocytes, a population that is somehow enhanced by activated Notch2. The striking correlation between the frequency of TCRhi DP thymocytes and the increase in CD8SP supports this possibility.
Previous studies have suggested that Notch1IC determines a T-versus-B-lineage outcome. In one study, mice expressing Notch1IC from a retroviral vector developed T-cell populations in the bone marrow with a concomitant inhibition in B lymphopoiesis (30). These results led the authors to conclude that activated Notch1 determined a T-versus-B-cell-fate decision, presumably through its action on a common lymphoid progenitor residing in bone marrow. The persistence and expansion of T-cell populations in N2IC mice did not appear to result from ongoing hematopoiesis, since their aggressive expansion in vivo upon adoptive transfer revealed these populations to be self generating. While these results do not exclude the possibility that a skew in hematopoiesis to the T-cell lineage was contributing to the presence of T-cell populations in N2IChi bone marrow, they suggest the alternative possibility that populations in bone marrow (and spleen) may have resulted from in situ proliferation of cells seeding these locations following transplantation.
Recent studies provide strong evidence that Delta-1-like induced Notch signaling can act on fetal-derived hematopoietic stem cells to suppress B-cell development in favor of T-cell development (36). The observation that activated Notch2 did not prevent the development of early B-lineage subsets suggests that ligand engagement of Notch members other than Notch2 are involved in a B-versus-T-cell-fate decision. This possibility is supported by previous studies which demonstrated that thymopoiesis is abolished upon conditional inactivation of Notch1, indicating that the Notch2 member cannot compensate at this stage of T-cell development (31). Our data show that endogenous Notch2 protein is highly expressed in pro-B cells, which are dependent on contact with bone marrow stroma shown to express Notch ligands (19, 37). Collectively, these findings indicate that Notch2, in contrast to the Notch1 family member, does not suppress B lymphopoiesis and may even suggest an as-yet-undefined function for Notch2 in early B-cell development.
The apparent block in B2 B-cell development in N2IC mice at the pre-B cell stage may be explained by a number of possibilities. In the retroviral system, N2IC expression continues beyond the normal limit of Notch2 protein expression in developing B cells, which in itself may reflect the necessity for Notch2 to be downregulated in order for conventional B2 B-cell development to progress. Based on their forward-scatter properties, N2IC-expressing fraction C cells were found to be large blasting cells, a finding which is consistent with the rapid proliferation associated with this stage (15). Because exit from the cell cycle is believed to be a prerequisite for the initiation of immunoglobulin light chain gene rearrangement and progression to the fraction D stage, it may be that constitutive Notch2 signaling blocks development at this critical step by sustaining cells in the cycle. In addition, NF-
B activity, which is important in the regulation of the fraction C to D transition (35), has been shown to be targeted by the Notch signaling pathway (1, 4, 29, 38).
An alternative explanation for the block in B-cell development may be that Notch signaling directly induces apoptosis in developing B cells. Though this possibility is consistent with findings of previous studies which showed that Notch1IC induces apoptosis in immature DT40 B cells (26), it is not likely that such an effect would reflect a physiologic role for Notch2 in B-cell development, given the high level of endogenous Notch2 protein expressed in pro- and pre-B cells.
A final intriguing possibility for the apparent block in B lymphopoiesis is suggested by the selective development in N2IC mice of CD5+ B1 B cells. Whether CD5+ B1 B cells constitute a distinct lineage from B2 cells or whether CD5 expression levels represent differential states of activation within a single B-cell lineage is still controversial (34). Without this clear distinction, it is difficult to definitively conclude how activated Notch2 results in the exclusive development of B1 B cells. In terms of a strength-of-signal model, it may be that activated Notch2 modulates pre-BCR signaling such that only B1 B-cell development is favored. From the view of distinct lineages, activated Notch2 might reset B lymphopoiesis in favor of an alternative B1 B-cell developmental program.
Finally, our data showing that Notch2 is expressed in both MZ B and B1 B cells but not in FO B or B2 B cells of the peritoneal cavity further support the notion that the generation of MZ B and B1 B-cell subsets may to some degree share common pathways (23, 39). For instance, there is evidence that members of the NF-
B pathway, which are targeted by Notch signaling, may be involved in the development of both MZ B and B1 B-cell subsets (3, 9). Therefore, it is possible that the selective development of B1 B cells in N2IC mice reflects a determining role for Notch2 in the development of this B-cell subset, possibly by the modulation of NF-
B activity or of other critical factors shown to be associated with altered MZ B and B1 B-cell subset development.
The results presented in this study not only demonstrate the contrasting outcomes resulting from different levels of activated Notch2 but also implicate a role for Notch2 in the maturation of the CD8SP. The profound effect of N2IC on the B-cell lineage, which results in the exclusive development of B1 B cells, also suggests a link between Notch2 signaling and the development of this important B-cell subset.
This work was supported by a Howard Hughes faculty development award to C.A.K. (grant no. 53000281) and a Basic Mechanisms in Lung Disease Predoctoral Training grant to C.M.W (grant no. HL07553). Work by C.S.S. was supported by an Immunology Diseases and Basic Immunology postdoctoral training grant (grant no. AIT3207051).
|
|
|---|
B2 is a putative target gene of activated Notch-1 via RBP-J
. Mol. Cell Biol. 18:2077-2088.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»