![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Department of Biochemistry and Molecular Biology, Thoracic Diseases Research Unit, and Mayo Clinic Cancer Center, Mayo Clinic College of Medicine, Rochester Minnesota 55905
Received 8 May 2003/ Returned for modification 10 June 2003/ Accepted 21 August 2003
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
With such a wide variety of responses, it is not surprising that TGF-ß receptor (TGF-ßR) activation and signaling are uniquely regulated (29). There are three primary receptors for TGF-ß on most cell types; they are referred to as the type I, II, and III (ß-glycan) receptors. In the current model of receptor activation, ligand initially binds the type II receptor, which is a constitutively active serine/threonine kinase. This promotes the recruitment and subsequent transphosphorylation of the type I receptor in the juxtamembrane GS domain. The activated type I receptor now serves as a docking site for receptor-associated Smad (R-Smad) proteins that are brought to the receptor complex associated with the FYVE domain protein SARA (Smad anchor for receptor activation). Following phosphorylation at a specific SSxS site in the C terminus by the type I receptor, the R-Smad protein dissociates from the type I receptor, complexes with the common mediator Smad4, and translocates to the nucleus, where it can function as a comodulator of transcription (45). Recent evidence indicates that activation of R-Smad protein Smad2 or Smad3 occurs in an endosomal compartment downstream of dynamin 2ab action (20, 31).
Although the Smad pathway has been shown to be critical for many aspects of TGF-ß signaling, Smad-independent responses have also been documented (16, 22, 48). While this indicates the possibility of various synergistic and/or antagonistic interactions, none of the known pathways have been capable of differentiating TGF-ß signaling in cell types with distinct biologies. For instance, similar Smad-dependent and -independent signaling is observed in both epithelial and mesenchymal cultures. Since these two cell types show distinct biological responses to TGF-ß, it seems likely that additional Smad-independent pathways exist that are modulated by TGF-ß in a cell-type-specific manner. To address that general question, we investigated targets shown to regulate phenotypes uniquely stimulated by TGF-ß in different cell lineages. As morphological alterations were some of the original responses observed in mesenchymal cells following TGF-ß identification (44), we determined whether known cytoskeletal regulators would (i) respond to TGF-ßR signaling and (ii) distinguish TGF-ß responses in fibroblasts versus epithelial cells. To that end, the present report documents that the yeast STE20 gene homologue PAK2 (12) is activated by TGF-ß independently of Smad2 or Smad3 in a cell-type-specific manner.
The p21-activated kinases (PAKs) were first identified as effectors of the Rho GTPases (26). There are currently six human PAK proteins, which fall into two subfamilies (25). The first subfamily (group I) consists of PAK1 (
-PAK), PAK2 (
-PAK, PAK
, hPAK65), and PAK3 (ß-PAK), while the second subfamily (group II) contains PAK4, PAK5, and PAK6. The kinase domains within a subfamily show a high degree of sequence identity, and all PAK proteins bind GTP-bound Rho family members at the amino-terminal p21-binding domain (PBD). While GTP-Cdc42 or -Rac binding does not stimulate group II PAK kinase activity, it is believed that GTPase binding to the PBD results in a conformational shift whereby the binding of the regulatory N terminus with the C-terminal kinase domain is disrupted, leading to activation of the group I PAKs (25, 27). An additional mechanism through which PAK activity is both positively and negatively regulated is the binding of a family of PAK-interacting proteins called Cool (cloned out of library) or Pix (PAK-interactive exchange factor) (3, 28).
In mammalian cells, group I PAK have been implicated as regulators of actin reorganization (25, 26), cell motility (15), apoptosis (40, 42), gene transcription (47), and oncogenesis (9, 34). While PAK1 is activated following ligand addition to a number of tyrosine kinase receptors (21, 39), PAK2 activation primarily occurs in response to a variety of stresses, such as exposure to ionizing radiation, hyperosmotic shock, and serum starvation (37). Much less is known about activation of the group II PAKs; however, group II PAKs similarly modulate actin organization and it has recently been shown that PAK4 is activated via phosphatidylinositol 3-kinase in hepatocyte growth factor-stimulated epithelial cells (46). It is unclear how different stimuli differentially activate various PAK isoforms.
The present study shows that (i) the mammalian homolog of the STE20 gene, PAK2 (not PAK1 or PAK3), is activated in an Smad2- and Smad3-independent manner by TGF-ß; (ii) TGF-ß stimulation of PAK2 activity is only observed in fibroblast cells, no response is seen in a variety of epithelial cell lines although PAK2 protein is equally present; (iii) PAK2 activation is dependent on Cdc42 and Rac1, but not Rac2 or RhoA; and (iv) TGF-ß-induced morphological transformation and fibroblast proliferation are inhibited by dominant negative and/or antisense PAK2. Thus, PAK2 activation represents a new cell-type-specific target of TGF-ß signaling.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Western blotting. Fibroblast lines with a targeted deletion of Smad2 or Smad3 were obtained from Anita Roberts. Cultures treated overnight in serum-free DME were stimulated for the indicated times in the presence or absence of 10 ng of TGF-ß per ml. Cells were lysed (50 mM Tris [pH 7.4], 1% NP-40, 0.25% sodium deoxycholate, 150 mM NaCl, 1 mM EGTA, 1 mM Na3VO4, 1x Complete protease inhibitor), and equivalent protein was probed with a phosphospecific Smad2 antibody, stripped, and tested for total Smad protein. The phospho-Smad2 and total Smad2 antibodies were from Upstate Biotechnology (no. 06-829) and Transduction Labs (no. 618042), respectively, while the total Smad3 antibody was from Zymed Laboratories (no. 51-1500). A rabbit anti-phospho-Smad3 antibody to the peptide COOH-GSPSIRCSpSVpS was generated in our laboratory. This antibody shows little cross-reactivity with phospho-Smad2 (see Fig. 3; data not shown). Other antibodies were from Santa Cruz Biotechnology (anti-PAK1, sc-882; anti-PAK2, sc-7117; anti-PAK3, sc-1871; anti-Cdc42, sc-87; anti-Rac1, sc-95; anti-Rac2, sc-96; anti-TGF-ßRI, sc-398; anti-TGF-ßRII, sc-220) or Roche (anti-GFP, no. 1814460).
|
-32P]ATP per µl. The kinase reaction was allowed to proceed for 10 min at 37°C, stopped with 50 µl of 2x Laemmli buffer, submitted to sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and visualized by autoradiography. Morphological transformation. AKR-2B cells were plated at 2.5 x 105 per six-well dish and incubated at 37°C for 24 h. Confluent cultures were placed in serum-free MCDB 402 for 48 h and stimulated by the addition of fresh serum-free DME alone or containing 10 ng of TGF-ß per ml. The top 1% of EGFP-PAK2- or EGFP-PAK2K278R-expressing cells were plated at 2.5 x 105 per six-well dish and grown for 24 h in DME supplemented with 10% tetracycline-free FBS and 50 µg of hygromycin B per ml. The medium was changed to include 10 µg of tetracycline per ml, and cells were allowed to grow for an additional 24 h to confluence. Cultures were placed in serum-free DME containing 10 µg of tetracycline per ml (24 h) before addition of 10 ng of TGF-ß per ml and incubation for a further 48 h. Documentation was by phase-contrast microscopy (magnification, x20).
To investigate the effect of antisense PAK2, morpholino antisense oligonucleotides representing nucleotides -1 to +24 of mouse PAK2 (5' TTCTAGCTCTCCGTTATCAGACATG) or the invert control (5' GTACAGACTATTGCCTCTCGATCTT) were synthesized with 3' fluorescein by Gene Tools. AKR-2B cells were plated in six-well dishes at a density of 8.0 x 104 per well in 10% DME and incubated at 37°C for 48 h. Confluent cells were transfected with the PAK2 antisense or PAK2 invert control oligonucleotide at a final concentration of 6 µM with Lipofectamine 2000 (Invitrogen). Following 48 h of incubation in 2% DME and 24 h of incubation in 0.1% DME, cultures were stimulated for 48 h at 37°C in 2 ml of serum-free DME alone or containing 5 ng of TGF-ß per ml prior to imaging. Transfected cells were detected by immunofluorescence.
Adenovirus constructs. Dominant negative PAK2-expressing adenovirus was generated by transfection of adenovirus shuttle vector pAdCMV into 293Cre cells plated 24 h earlier at 9 x 105 per six-well dish. Recombinant clones were determined by induction of cytopathic effects in the monolayers, isolated, and plaque purified in 293Cre cells. Cell-free viral supernatants were prepared, and titers were determined in 293 cells. Control GFP-expressing adenovirus was purchased from Riken GenBank (Japan).
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
PAK2 activation requires TGF-ßR kinase activity and is downstream of the TGF-ßR complex.
TGF-ß action is mediated through a complex interaction of type I and II receptors. Fundamental to this response is a requirement for both type I and II TGF-ßR kinase activities. Since TGF-ß stimulation of the PAK2 kinase represents a new cell-type-specific signaling target, we addressed two essential issues. First, what is the role of receptor kinase activity in PAK2 activation, and second, is PAK2 a substrate or binding partner for the TGF-ßR complex? To determine the requirement for TGF-ßR kinase activity in PAK2 activation, we took advantage of the chimeric TGF-ßR model we developed with AKR-2B cells (2). This system uses the ligand-binding domain of the granulocyte-macrophage colony-stimulating factor (GM-CSF) and ß receptors and fuses them to the transmembrane and cytoplasmic domains of the type I or II TGF-ßR. We have previously determined that the chimeric system faithfully recapitulates native TGF-ßR signaling in both substrate specificity and the requirement for type I and II receptor kinase activities (1, 14). To that end, we examined PAK2 activation in AKR-2B clones expressing (i) wild-type type I and II chimeric TGF-ßRs (A105), (ii) wild-type type II and kinase-impaired type I chimeric TGF-ßRs (A708), and (iii) wild-type type I and kinase-impaired type II chimeric TGF-ßRs (A615). As shown in Fig. 2A, while activation of wild-type chimeric receptors with GM-CSF induces PAK2 kinase activity with kinetics similar to those of native TGF-ßRs (compare Fig. 1A and 2A), the absence of receptor kinase activity in either the type I or the type II chimeric TGF-ßR prevents PAK2 activation (Fig. 2A, A708 and A615 cultures, respectively). This does not reflect a general signaling anergy in the A615 or A708 clones, since stimulation of the native TGF-ßRs with TGF-ß resulted in increased PAK2 kinase activity (Fig. 2B).
|
PAK2 activation and Smad phosphorylation occur independently. TGF-ß signaling is primarily mediated through the Smad family of transcriptional coregulators, although Smad-independent signaling has been reported. As PAK2 represents a novel TGF-ß-modulated kinase uniquely controlled in fibroblasts versus epithelial cells, we next determined the role(s) of Smad2 and/or Smad3 in PAK2 activation. Fibroblast cell lines from Smad2 or Smad3 knockout mice were stimulated with TGF-ß, and PAK2 kinase activity was measured. There was no appreciable effect on TGF-ß-stimulated PAK2 activity when either the Smad2 or Smad3 gene was knocked out (Fig. 3, first four columns). Although defined activities for Smad2 and -3 have been reported (32), it is possible that potential redundancy exists such that the loss of one is compensated for by the other. To address this issue, we transfected a dominant negative GFP-Smad2 construct (33) into the Smad3 knockout cell line and sorted for GFP-positive cells. While phosphorylation of both Smad2 and Smad3 was abolished, there was no effect on TGF-ß-stimulated PAK2 activity (Fig. 3, far right two columns).
Although Fig. 3 demonstrates that Smad2 and/or Smad3 phosphorylation is not required for PAK2 activation, it does not address the converse (i.e., whether PAK2 activation is required for Smad2 or Smad3 phosphorylation). Accordingly, AKR-2B cells were transfected with GFP-tagged wild-type or dominant negative PAK2, GFP-positive cells were selected by fluorescence-activated cell sorter analysis, and the level of phosphorylated Smad2 and Smad3 was determined following addition of TGF-ß (Fig. 4). Expression of wild-type (Fig. 4A, columns 3 and 4) or dominant negative (Fig. 4B, columns 3 and 4) PAK2 had no effect on TGF-ß-stimulated R-Smad phosphorylation. The preceding data (Fig. 1 to 4) show that TGF-ß stimulation of PAK2 activity is (i) differentially regulated in fibroblast and epithelial cell types, (ii) dependent on TGF-ßR kinase activity, and (iii) independent of Smad2 and Smad3 phosphorylation.
|
|
Rho protein binding to PAK kinases only occurs in the GTP-bound (activated) state (7, 25). That activation of Cdc42 and/or Rac1 is necessary for TGF-ß-stimulated PAK2 kinase activity is shown in Fig. 5B. AKR-2B cells were transfected with wild-type EGFP-PAK2 alone or with the indicated dominant negative Rho family protein. Following TGF-ß stimulation, the transfected PAK2 was immunoprecipitated with GFP antibodies and kinase activity was determined. While Rac1N17 and Cdc42N17 each inhibited PAK2 kinase activity approximately 40 to 60%, dominant negative RhoA was without effect. Clostridium toxin B was used to document the total Rho dependence on PAK2 activation. Thus, TGF-ß activation of PAK2 in AKR-2B cells uses Rho proteins Rac1 and Cdc42, but not RhoA or Rac2.
PAK2 activity is required for TGF-ß morphological transformation and cell proliferation. The previous data indicate that PAK2 represents a novel intermediary downstream of TGF-ßR activation capable of distinguishing TGF-ß signaling in fibroblast and epithelial cell types (Fig. 1 to 5). Of interest, however, was whether this new pathway could be causally linked to biological phenotypes regulated by TGF-ß. As cytoskeletal alterations resulting in a morphological transformation were one of the earliest cellular findings associated with TGF-ß stimulation of fibroblasts (44) and the pathways leading to PAK2 activation are known to be associated with actin rearrangement (36, 38), we examined the role of PAK2 in this response. As shown in Fig. 6A, AKR-2B cells treated with TGF-ß transform from large "cobblestone-like" round cells into thin elongated cells that spread and crawl over one another, reminiscent of transformed cultures. In order to investigate the role(s) of PAK2 and/or upstream Rho GTPases in TGF-ß morphological transformation, stable cell lines were generated expressing wild-type or dominant negative PAK2 with a tetracycline-on inducible promoter. While the wild-type PAK2 construct was without effect, expression of the dominant negative prevented AKR-2B cells from morphologically transforming in the presence of TGF-ß (Fig. 6A).
|
While the dominant negative PAK2 constructs used in Fig. 6 suggest that PAK2 activation is coincident with or necessary for TGF-ß morphological transformation and cell growth, it is also possible that the dominant negative protein functions by (i) sequestering activated Rac1 and/or Cdc42 and not through direct inhibition of PAK2 and/or (ii) complexing with other PAK family members and inhibiting their activity. To address these issues, we transfected morpholino antisense oligonucleotides to PAK2 and assessed their effect on TGF-ß-stimulated morphological transformation. As shown in Fig. 7, the antisense oligonucleotides, but not the invert control, specifically diminish PAK2 protein (no effect on PAK1 was observed) and prevent the morphological alteration associated with TGF-ß treatment more than 60%.
|
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
TGF-ß addition to fibroblastic AKR-2B cells resulted in activation of the PAK2 kinase within 5 to 15 min; no effect on either PAK1 or PAK3 (i.e., other group I PAKs) was observed (Fig. 1A), nor was PAK2 activated by TGF-ß in a variety of epithelial cell lines (Fig. 1B and C). These findings were of interest for a number of reasons. First, PAK2 has not been previously considered a target of growth factor-activated receptors. In general, while PAK1 has been shown to be downstream of many tyrosine receptor kinases, PAK2 is routinely activated in response to various stress. It is not known why PAK1 is not activated or whether PAK4 to -6 can be activated by TGF-ß. In that regard, the effect of TGF-ß on PAK4 activity would be of interest as PAK4 (similar to TGF-ß) has been reported to be involved in stimulating anchorage-independent growth (9, 34). However, PAK4 to -6 have been classified as group II PAKs and are structurally quite different from the group I PAKs (25). For instance, Rho protein binding to PAK4 does not appear to enhance kinase activity. Second, the activity of any PAK family member has not been previously shown to be regulated by TGF-ß. Third, while PAK2 activation was shown to be dependent on TGF-ßR kinase activity (Fig. 2A and B), PAK2 was neither a substrate nor a binding partner for the TGF-ßR complex (Fig. 2C and D) and was activated in the absence of Smad2 and/or Smad3 (Fig. 3). Thus, TGF-ß stimulation of PAK2 represents a new Smad-independent signaling target downstream of the activated TGF-ßR complex.
It is of note that of the group I PAKs, PAK2 was specifically activated by TGF-ß in fibroblasts and not epithelial cells (Fig. 1). This was observed in both normal and transformed human and murine cell types. While it is unknown if TGF-ß stimulates PAK2 activation in other cell lineages (i.e., hematopoietic, endothelial, neural, etc.) or more differentiated models (i.e., bone, muscle, etc.), the finding of differential TGF-ß signaling in mesenchymal and epithelial cultures provides initial insight into the distinct phenotypes induced by TGF-ß in these two cell types. To that end, we have previously reported that the endocytic response of the TGF-ßR complex is regulated differently in fibroblasts and epithelial cells (14, 18). Further work is required to define the most proximal events subsequent to TGF-ß binding if we hope to modulate distinct components of TGF-ß action.
While both group I and II PAKs bind GTP-bound Rho family proteins, the kinase activity of only the group I PAKs is enhanced (25). This was directly observed in the experiment whose results are shown in Fig. 5, in which both Rac1 and Cdc42 were shown to associate with PAK2, bind to the PAK PBD, and (each) independently regulate approximately 50% of the TGF-ß-dependent increase in PAK2 kinase activity. No effect was observed with Rac2 or RhoA (data not shown and Fig. 5B, respectively). The fact that RhoA (and not Rac1 or Cdc42) has been reported to be required for an epithelial-to-mesenchymal cell transition mediated by TGF-ß (4) might suggest that the transdifferentiated epithelial cell is distinct from a fibroblast, per se, and/or the initial TGF-ß signal is uniquely integrated in the two cell types. Similarly, activation of PAK2 (and/or that of other PAK family member) might correspond to a unique activity stimulated by TGF-ß during the epithelial-to-mesenchymal cell transition process(es). Current projects in the laboratory are addressing that issue.
PAK are involved in or causal to a number of biological processes. Chief among them is the cytoskeletal rearrangement associated with lamellipodia or filopedia and cell migration (25, 26). As TGF-ß induces both PAK2 activity and actin reorganization, PAK2 activation might represent a potential biochemical pathway linking the various morphological changes under TGF-ß control with TGF-ßR signaling. In support of that hypothesis, the experiment whose results are shown in Fig. 6 demonstrated that expression of dominant negative PAK2 prevented TGF-ß-mediated cellular proliferation and morphological transformation. However, the PAK2 dominant negatives could be having unexpected effects in that they could be inhibiting other PAK family members and/or sequestering Rac1/Cdc42 in nonfunctional complexes. To address these concerns, we used morpholino antisense oligonucleotides to PAK2 and demonstrated that (i) PAK2 protein was decreased while PAK1 protein levels were unchanged and (ii) the antisense oligonucleotides diminished the morphological alteration induced by TGF-ß by more than 60% (Fig. 7). As PAK3 is not activated or expressed in AKR-2B cells (Fig. 1A) and the group II PAKs (PAK4 to -6) lack the amino-terminal region to which the antisense oligonucleotide was generated, the results indicate a direct role for PAK2 in TGF-ß morphological transformation.
The morphological change induced by TGF-ß generates a cellular phenotype with similarities to myofibroblasts observed in fibrogenic tissues such as induction of smooth-muscle actin and accumulation of extracellular matrix molecules (5, 19, 43). However, PAK2 is clearly only one component in the pathways required for these alterations and a model is presented in Fig. 8 that depicts that interrelationship. For instance, while we show that PAK2 is activated independently of Smad2 and/or Smad3 (Fig. 3), Smad3 is required for fibrosis and smooth-muscle actin expression (13, 17). In support of these results, we found that dominant negative PAK2 had no effect on the induction of smooth-muscle actin (unpublished data), further supporting the hypothesis that PAK2 and Smad signaling are distinctly regulated (Fig. 3 and 4). Whether the pathways remain parallel, eventually converge, and/or are antagonistic to other TGF-ß responses is not known. However, regardless of any integration between the PAK and Smad pathways, the present study indicates that it may become possible to specifically modulate distinct TGF-ß-regulated phenotypes in defined cell types.
|
ACKNOWLEDGMENTS |
|---|
-PAK) and dominant negative (pRevTRE-EGFP--PAK-K278R) PAK2 plasmids, Azeddine Atfi for the dominant negative (pEGFP-SMAD2-S467A) Smad2 vector, and Jeffrey Field (pCMV5-Rac1N17 and pCMV5-Cdc42N17) and Dan Billadeau (pCMV5-RhoAN19) for dominant negative Rho constructs. Sandra Arline provided excellent technical assistance in the early stages of the project, while Jules Doré provided helpful discussions. This work was supported by Public Health Service grants GM-54200 and GM-55816 from the National Institute of General Medical Sciences.
|
FOOTNOTES |
|---|
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Anders, R. A., and E. B. Leof. 1996. Chimeric granulocyte/macrophage colony-stimulating factor/transforming growth factor-ß (TGF-ß) receptors define a model system for investigating the role of homomeric and heteromeric receptors in TGF-ß signaling. J. Biol. Chem. 271:21758-21766.
3. Bagrodia, S., and R. A. Cerione. 1999. PAK to the future. Trends Cell Biol. 9:350-355.[CrossRef][Medline]
4. Bhowmick, N. A., M. Ghiassi, A. Bakin, M. Aakre, C. A. Lundquist, M. E. Engel, C. L. Arteaga, and H. L. Moses. 2001. Transforming growth factor-ß1 mediates epithelial to mesenchymal transdifferentiation through a RhoA-dependent mechanism. Mol. Biol. Cell 12:27-36.
5. Bissell, D. M. 2001. Chronic liver injury, TGF-ß, and cancer. Exp. Mol. Med. 33:179-190.[Medline]
6. Blobe, G. C., W. P. Schiemann, and H. F. Lodish. 2000. Role of transforming growth factor beta in human disease. N. Engl. J. Med. 342:1350-1358.
7. Bokoch, G. M. 2000. Regulation of cell function by Rho family GTPase. Immunol. Res. 21:139-148.[CrossRef][Medline]
8. Bono, F., I. Lamarche, and J. Herbert. 1997. NGF exhibits a pro-apoptotic activity for human vascular smooth muscle cells that is inhibited by TGF-ß1. FEBS Lett. 416:243-246.[CrossRef][Medline]
9. Callow, M. G., F. Clairvoyant, S. Zhu, B. Schryver, D. B. Whyte, J. R. Bischoff, B. Hallal, and T. Smeal. 2002. Requirement for PAK4 in the anchorage-independent growth of human cancer cell lines. J. Biol. Chem. 277:550-558.
10. Chambard, J.-C., and J. Pouyssegur. 1988. TGF-ß inhibits growth factor-induced DNA synthesis in hamster fibroblasts without affecting early mitogenic events. J. Cell. Physiol. 135:101-107.[CrossRef][Medline]
11. Chen, R., Y. Su, R. L. C. Chuang, and T. Chang. 1998. Suppression of transforming growth factor-ß-induced apoptosis through phosphatidylinositol 3-kinase/akt-dependent pathway. Oncogene 17:1959-1968.[CrossRef][Medline]
12. Chen, Y., and T. Tan. 1999. Mammalian c-Jun N-terminal kinase pathway and STE20-related kinases. Gene Ther. Mol. Biol. 4:83-98.
13. Cogan, J. G., S. V. Subramanian, J. A. Polikandriotis, R. J. Kelm, and A. R. Strauch. 2002. Vascular smooth muscle -actin gene transcription during myofibroblast differentiation requires Sp1/3 protein binding proximal to the MCAT enhancer. J. Biol. Chem. 277:36433-36442.
14. Doré, J. J. E., Jr., M. Edens, N. Garamszegi, and E. B. Leof. 1998. Heteromeric and homomeric transforming growth factor-ß receptors show distinct signaling and endocytic responses in epithelial cells. J. Biol. Chem. 273:31770-31777.
15. Edwards, D. C., L. C. Sanders, G. M. Bokoch, and G. N. Gill. 1999. Activation of LIM-kinase by PAK1 couples Rac/Cdc42 GTPase signaling to actin cytoskeletal dynamics. Nat. Cell Biol. 1:253-259.[CrossRef][Medline]
16. Engel, M. E., M. A. McDonnell, B. K. Law, and H. L. Moses. 1999. Interdependent SMAD and JNK signaling in TGF-ß mediated transcription. J. Biol. Chem. 274:37413-37420.
17. Flanders, K. C., C. D. Sullivan, M. Fujii, A. Sowers, M. A. Anzano, A. Arabshahi, C. Major, C. Deng, A. Russo, J. B. Mitchell, and A. B. Roberts. 2002. Mice lacking Smad3 are protected against cutaneous injury induced by ionizing radiation. Am. J. Pathol. 160:1057-1068.
18. Garamszegi, N., J. J. E. Doré, Jr., S. G. Penheiter, M. Edens, D. Yao, and E. B. Leof. 2001. Transforming growth factor ß receptor signaling and endocytosis are linked through a COOH terminal activation motif in the type I receptor. Mol. Biol. Cell 12:2881-2893.
19. Hashimoto, S., Y. Gon, I. Takeshita, K. Matsumoto, S. Maruoka, and T. Horie. 2001. Transforming growth factor-ß1 induces phenotypic modulation of human lung fibroblasts to myofibroblasts through a c-Jun-NH2-terminal kinase-dependent pathway. Am. J. Respir. Crit. Care Med. 163:152-157.
20. Hayes, S., A. Chawla, and S. Corvera. 2002. TGFß receptor internalization into EEA1-enriched early endosomes: role in signaling to Smad2. J. Cell Biol. 158:1239-1249.
21. He, H., A. Levitzki, H.-J. Zhu, F. Walker, A. Burgess, and H. Maruta. 2001. Platelet-derived growth factor requires epidermal growth factor receptor to activate p21-activated kinase family kinases. J. Biol. Chem. 276:26741-26744.
22. Hocevar, B. A., T. L. Brown, and P. H. Howe. 1999. TGF-ß induces fibronectin synthesis through a c-Jun N-terminal kinase-dependent, Smad4-independent pathway. EMBO J. 18:1345-1356.[CrossRef][Medline]
23. Hocevar, B. A., A. Smine, X.-X. Xu, and P. H. Howe. 2001. The adaptor molecule disabled-2 links the transforming growth factor ß receptors to the Smad pathway. EMBO J. 20:2789-2801.[CrossRef][Medline]
24. Howe, P. H., G. Draetta, and E. B. Leof. 1991. Transforming growth factor ß1 inhibition of p34cdc2 phosphorylation and histone H1 kinase activity is associated with G1/S-phase growth arrest. Mol. Cell. Biol. 11:1185-1194.
25. Jaffer, Z. M., and J. Chernoff. 2002. p21-activated kinases: three more join the Pak. Int. J. Biochem. Cell Biol. 34:713-717.[CrossRef][Medline]
26. Knaus, U. G., and G. M. Bokoch. 1998. The p21Rac-Cdc42-activated kinases (PAKs). Int. J. Biochem. Cell Biol. 30:857-862.[CrossRef][Medline]
27. Lei, M., W. Lu, W. Meng, M. Parrini, M. J. Eck, B. J. Mayer, and S. C. Harrison. 2000. Structure of PAK1 in an autoinhibited conformation reveals a multistage activation switch. Cell 102:387-397.[CrossRef][Medline]
28. Manser, E., T.-H. Loo, C.-G. Koh, Z.-S. Zhao, X.-Q. Chen, L. Tan, I. Tan, T. Leung, and L. Lim. 1998. PAK kinases are directly coupled to the PIX family of nucleotide exchange factors. Mol. Cell 1:183-192.[CrossRef][Medline]
29. Massagué, J., and Y.-G. Chen. 2000. Controlling TGF-ß signaling. Genes Dev. 14:627-644.
30. Massagué, J., and D. Wotton. 2000. Transcriptional control by the TGF-ß/Smad signaling system. EMBO J. 1745-1754.
31. Penheiter, S. G., H. Mitchell, N. Garamszegi, M. Edens, J. J. E. Doré, Jr., and E. B. Leof. 2002. Internalization-dependent and -independent requirements for transforming growth factor ß receptor signaling via the Smad pathway. Mol. Cell. Biol. 22:4750-4759.
32. Piek, E., W. J. Ju, J. Heyer, D. Escalante-Alcalde, C. L. Stewart, M. Weinstein, C. Deng, R. Kucherlapati, E. P. Böttinger, and A. B. Roberts. 2001. Functional characterization of transforming growth factor ß signaling in Smad2- and Smad3-deficient fibroblasts. J. Biol. Chem. 276:19945-19953.
33. Prunier, C., A. Mazars, V. Noë, E. Bruyneel, M. Mareel, C. Gespach, and A. Afti. 1999. Evidence that Smad2 is a tumor suppressor implicated in the control of cellular invasion. J. Biol. Chem. 274:22919-22922.
34. Qu, J., M. S. Cammarano, Q. Shi, K. C. Ha, P. de Lanerolle, and A. Minden. 2001. Activated PAK4 regulates cell adhesion and anchorage-independent growth. Mol. Cell. Biol. 21:3523-3533.
35. Raftery, L. A., V. Twombly, K. Wharton, and W. M. Gelbart. 1995. Genetic screens to identify elements of the decapentaplegic signaling pathway in drosophila. Genetics 139:241-254.[Abstract]
36. Roig, J., Z. Huang, C. Lytle, and J. A. Traugh. 2000. p21-activated protein kinase -PAK is translocated and activated in response to hyperosmolarity. J. Biol. Chem. 275:16933-16940.
37. Roig, J., and J. A. Traugh. 2001. Cytostatic p21 G protein-activated protein kinase -PAK. Vitam. Horm. 62:167-198.[Medline]
38. Roig, J., P. T. Tuazon, P. A. Zipfel, A. M. Pendergast, and J. A. Traugh. 2000. Functional interaction between c-Abl and the p21-activated protein kinase -pak. Proc. Natl. Acad. Sci. USA 97:14346-14351.
39. Royal, I., N. Lamarche, L. Lamorte, K. Kozo, and M. Park. 2000. Activation of Cdc42, Rac, PAK, and Rho-kinase in response to hepatocyte growth factor differentially regulates epithelial cell colony spreading and dissociation. Mol. Biol. Cell 11:1709-1725.
40. Rudel, T., and G. M. Bokoch. 1997. Membrane and morphological changes in apoptotic cells regulated by caspase-mediated activation of PAK2. Science 276:1571-1574.
41. Savage, C., P. Das, A. L. Finelli, S. R. Townsend, C.-Y. Sun, S. E. Baird, and R. W. Padgett. 1996. Caenorhabditis elegans genes sma-2, sma-3, and sma-4 define a conserved family of transforming growth factor beta pathway components. Proc. Natl. Acad. Sci. USA 93:790-794.
42. Schurmann, A., A. F. Mooney, L. C. Sanders, M. A. Sells, H. G. Wang, J. C. Reed, and G. M. Bokoch. 2000. p21-activated kinase 1 phosphorylates the death agonist Bad and protects cells from apoptosis. Mol. Cell. Biol. 20:453-461.
43. Serini, G., and G. Gabbiani. 1999. Mechanisms of myofibroblast activity and phenotype modulation. Exp. Cell Res. 250:273-283.[CrossRef][Medline]
44. Shipley, G. D., C. B. Childs, M. E. Volkenant, and H. L. Moses. 1984. Differential effects of epidermal growth factor, transforming growth factor, and insulin on DNA and protein synthesis and morphology in serum-free cultures of AKR-2B cells. Cancer Res. 44:710-716.
45. ten Dijke, P., M.-J. Goumans, H. Itoh, and S. Itoh. 2002. Regulation of cell proliferation by Smad proteins. J. Cell. Physiol. 191:1-16.[CrossRef][Medline]
46. Wells, C. M., A. Abo, and A. J. Ridley. 2002. PAK4 is activated via P13K in HGF-stimulated epithelial cells. J. Cell Sci. 115:3947-3956.
47. Yang, F., X. Li, M. Sharma, M. Zarnegar, B. Lim, and Z. Sun. 2001. Androgen receptor specifically interacts with a novel p21-activated kinase, PAK6. J. Biol. Chem. 276:15345-15353.
48. Yue, J., and K. M. Mulder. 2001. Transforming growth factor-ß signal transduction in epithelial cells. Pharmacol. Ther. 91:1-34.[CrossRef][Medline]
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
