![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Molecular and Cellular Biology, December 2003, p. 9222-9232, Vol. 23, No. 24
0270-7306/03/$08.00+0 DOI: 10.1128/MCB.23.24.9222-9232.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Takahiro Ishiwata, Qing Nie, and Seigo Izumo*
Cardiovascular Division, Beth Israel Deaconess Medical Center, and Department of Medicine, Harvard Medical School, Boston, Massachusetts 02215
Received 14 March 2003/ Returned for modification 5 May 2003/ Accepted 21 July 2003
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and
METHODSResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and
METHODSResultsDiscussionReferences |
|---|
Myocardin is expressed in cardiac myocytes and smooth muscle cells, and its expression begins in the cardiac crescent at ED 7.75 (42). Myocardin is a transcription cofactor and transactivates the serum response element (SRE) (also referred to as CArG box) dependent promoters by forming a ternary complex with serum response factor (SRF). Expression of a dominant-negative mutant of myocardin in Xenopus embryos prevents heart formation (42). However, regulation of myocardin gene expression is unknown.
Bone morphogenetic proteins (BMPs) are members of the transforming growth factor ß (TGF-ß) superfamily. TGF-ß-activated kinase 1 (TAK1) is a member of the mitogen-activated protein kinase kinase kinase family and a mediator of TGF-ß and BMP signal transduction (43). By using the teratocarcinoma P19 cells and their clonal derivative P19CL6 cells in an in vitro system, BMPs have been shown to be essential for cardiac myocyte differentiation (15, 28). BMP signaling regulates Nkx2.5 activity during cardiomyogenesis in P19 cells (15). In P19CL6 cells, TAK1, Nkx2.5, and GATA-4 play a pivotal role in the cardiogenic BMP signaling pathway (28). In addition, overexpression of a dominant-negative mutant of Nkx2.5 inhibited cardiomyogenesis in both P19 cells and P19CL6 cells (16, 38).
We and others have previously reported that several genes, including atrial natriuretic factor (ANF), B-type natriuretic peptide, CARP, eHAND, MEF2C, myosin light chain 2v (MLC2v), SM22, N-myc, Msx2, Irx4, and Chisel are downregulated in the Nkx2.5-null heart (3, 4, 6, 9, 23, 29, 36, 47). To identify other genes regulated by Nkx2.5 in the developing heart, we performed suppression subtractive hybridization with RNAs isolated from the hearts of wild-type and Nkx2.5-null mice at ED 8.5. We describe here that myocardin and myocardin A are downregulated in Nkx2.5-null hearts. Nkx2.5 transactivates the myocardin promoter. A dominant-negative mutant of myocardin inhibited cardiomyogenesis in P19CL6 cells. BMP2 and TAK1 augmented myocardin A transcriptional activation at the SRE.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and
METHODSResultsDiscussionReferences |
|---|
Cloning of myocardin A cDNA and the promoter region. cDNA clones representing myocardin A were isolated from ED 10 mouse heart cDNA libraries (Stratagene) by using standard methodology. 5' RNA ligase-mediated RACE (rapid amplification of cDNA ends) was performed according to the manufacturer's protocol (Ambion, Inc.). A 2-kb fragment of the myocardin promoter (positions -1961 to +39 in the myocardin gene) was isolated from a bacterial artificial chromosome clone (RP23-298L23; Research Genetics).
In situ hybridization. In situ hybridization was performed with paraformaldehyde-fixed, paraffin-embedded mouse embryos at ED 9.5. A common cDNA fragment for myocardin A and myocardin was made by PCR with mouse heart cDNA as a template with the following primers: a forward primer (5'-CAACTGTCACCTTTCCTGTCACG-3') and a reverse primer (5'-CCACCAGCATCTTGTCCTTCTC-3'). The fragment was cloned into pCRII (Invitrogen) and used to generate a 35S-labeled probe by in vitro transcription. Hybridization, washing, and probe detection were performed as previously described (36).
Northern
blot analysis.
Total RNA
was isolated by using Trizol reagent (Invitrogen) or an RNeasy Mini kit
(Qiagen). mRNA was isolated from total RNA by using NucleoTrap mRNA kit
(Clontech). Total RNA or mRNA was size fractionated on 1.3%
agarose gel containing 2.2 M formaldehyde and transferred to nylon
membranes. The membranes were then hybridized with a probe radiolabeled
with [32P]dCTP by random priming. Blots were
hybridized at 42°C for 16 h in the presence of
50% formamide. After hybridization, the membranes were washed at
65°C in the presence of 0.1x SSC (1x SSC is
0.15 M NaCl plus 0.015 M sodium citrate) and 0.1% sodium dodecyl
sulfate. Visualization was achieved by exposure to Kodak Biomax MS film
(Eastman Kodak Co.). A specific probe for myocardin A was made by PCR
with myocardin A cDNA as a template with a forward primer
(5'-AACTCAGGGGCACACGAAGG-3') and a
reverse primer (5'-CTTTGGATGAATACTTGGGC-3').
A PstI-EcoRV fragment of N-cadherin was
used as a probe as previously described
(36). A
PflMI-EcoRI fragment of Nkx2.5 was used as a probe.
-Myosin heavy chain (MHC) 3'-untranslated
region cDNA was used as a probe for MHC (kindly provided by Margaret
Buckingham, Institut Pasteur, Paris, France). MEF2C cDNA was used as a
probe.
Reverse transcriptase PCR (RT-PCR). Total RNA from embryonic (ED 10.5), neonatal, and adult hearts were treated with RNase-free DNase I. First-strand cDNA synthesis was performed with 1 µg of total RNA with Superscript II RT, and random hexamer. PCR amplification was performed with primers that anneal to both myocardin A and myocardin cDNAs and that flank the myocardin A-specific exon (forward primer [5'-TCACTGTGTGGAGTCCTCAGGTC-3'] and reverse primer [5'-TGGCATCGGCTGGCATTTC-3']). PCR conditions were as follows: 94°C for 2 min and then 30 cycles at 94°C for 15 s, 58°C for 30 s, and 72°C for 1 min. PCR products were electrophoresed on 2% agarose gels and visualized by ethidium bromide staining.
Primer extension analysis. One microgram of mouse heart mRNA and 105 cpm end-labeled oligonucleotide (antisense for mouse myocardin A cDNA nucleotides 27 to 50,5'-TGAGGGTGGCCGGGAACAGCCGCA-3') were hybridized in hybridization buffer (150 mM KCl, 10 mM Tris [pH 8.3], 1 mM EDTA) at 65°C for 90 min and cooled slowly to room temperature. The sample was mixed with reaction mix (20 mM Tris [pH 8.3], 5.5 mM dithiothreitol, 10 mM MgCl2, 150 µM deoxynucleoside triphosphate, 150 µg of actinomycin D/ml, 40 U of Superscript II RT [Invitrogen]) and then incubated at 42°C for 60 min. The sample was treated with 14 µg of RNase A/ml at 37°C for 15 min and extracted with phenol-chloroform. The ethanol precipitated sample was resupended with formamide loading buffer. After heating the mixture at 65°C for 5 min, the sample was loaded onto an 8% acrylamide-8 M urea gel. After electrophoresis, the gel was dried and exposed to film.
Plasmid construct. A cDNA encoding myocardin A with a C-terminal hemagglutinin (HA) epitope was cloned into pcDNA3 (Invitrogen) to generate pcDNA3-myocardin A. A deletion mutant of myocardin A-tagged HA (MC129-509) was made by PCR with pcDNA3-myocardin A as a template with a forward primer (5'-CCCCAAGCTTCCCACCATGGATTCTTCCGTGAAAGAGGCT-3') and a reverse primer (5'-CCGGAATTCTTAAGCGTAATCTGGAACATCGTATGGGTAGCCCGAGCCCCCATTCAGGCTGCTCA-3'). MC129-509 was ligated into pcDNA3 to construct pcDNA3-MC129-509. pcDNA3-myocardin was made by replacing the myocardin A fragment with a myocardin fragment. The myocardin fragment was obtained by PCR with mouse neonatal heart cDNA as a template with the following primers: a forward primer (5'-TCACTGTGTGGAGTCCTCAGGTC-3') and a reverse primer (5'-TGGCATCGGCTGGCATTTC-3'). The PCR fragments were then digested with Bsu36I and EcoRV and ligated with Bsu36I-EcoRV-digested pcDNA3-myocardin A to construct pcDNA3-myocardin. All of the PCR fragments were confirmed by DNA sequencing. A 2-kb fragment of the myocardin promoter was ligated with pGL2-Basic vector (Promega) to construct myocardin-Luc. Promoter mutations were constructed by site-directed mutagenesis with the Quickchange kit (Stratagene). The TCAAGTG nucleotide sequence in the NKE was changed to a TCCCTCG sequence. The AACTTGA nucleotide sequence in the NKEr2 was changed to a AGAGGGA sequence. Mutations of the promoter constructs were checked by sequencing.
Transfection and reporter assay. COS cells and P19CL6 cells were plated at densities of 4.0 x 105 and 1.0 x 105 cells/well, respectively, in six-well plates. The following day, the cells were transfected with 3 µg of myocardin-Luc, ANF luciferase reporter construct (-638 ANF Luc; kindly provided by Kenneth R. Chien, University of California, San Diego), or various SRE mutants in the ANF luciferase reporter construct (kindly provided by Andrew Thorburn, Wake Forest University School of Medicine). The cells were also transfected with 1 µg of expression vectors containing Nkx2.5, Nkx2.5(I183P), myocardin A, myocardin, MC129-509, SRF, TAK1, or TAK1 mutants and 1 µg of pTKß-Gal by the calcium phosphate method. The total plasmid amount was adjusted to 6 µg with an empty vector plasmid. Expression vectors containing TAK1 and TAK1 mutants were kindly provided by Hiroshi Shibuya (Tokyo Medical and Dental University, Tokyo, Japan). An SRF expression vector was kindly provided by Ron Prywes (Columbia University). At 6 h after transfection, cells were washed with phosphate-buffered saline (PBS), and the medium was changed. Cells were cultured for another 24 to 48 h, lysed with 200 µl of reporter lysis buffer (Promega), and assayed for luciferase activity (by a Promega assay) and ß-galactosidase activity. Luciferase activity was normalized against ß-galactosidase activity.
Electrophoretic mobility shift
assay.
Nkx2.5 protein was
prepared by coupled in vitro transcription/translation of a T7-driven
Nkx2.5 plasmid in reticulocyte lysate by using a TNT kit (Promega).
Labeled DNA probes were incubated with 1 µl of programmed
lysate in 2 µg of bovine serum albumin and 2 µg of
poly(dG-dC) in 10 mM HEPES (pH 7.9)-50 mM KCl-1 mM
EGTA-10% glycerol-2.5 mM
dithiothreitol-7 mM MgCl2 in a 20-µl
reaction volume for 30 min at room temperature and then separated in
4% polyacrylamide gel by using a Tris-glycine
buffer. All probes were double stranded and were
radiolabeled with [
-32P]ATP. The
single-stranded sequences of the probes were as follows (the putative
DNA-binding sites are underlined): NKE
(GAATTCCAAGATTCAAGTGCATTGGTGCAACC) and
NKEr2
(GATGTAATAAGAACTTGACCCACAATTTATG).
Replication-defective recombinant adenovirus and gene transfer. HA-tagged myocardin A cDNA and LacZ cDNA were used to generate recombinant adenoviruses expressing myocardin A (AdMCA) and LacZ (AdLacZ), respectively, by using an Adeno-X Expression System (Clontech). At 24 h after seeding, cardiac myocytes were infected with AdMCA or AdLacZ diluted in the culture media at the multiplicity of infection of 10 and incubated for 2 h. The viral suspension was removed, and cardiac myocytes were cultured with the serum-depleted culture medium for 48 h.
Cell culture and differentiation. Rat neonatal cardiac myocyte culture from 1-day-old Wister rats was prepared as previously described with some modifications (32). Mouse neonatal cardiac myocyte culture from 1-day-old C57BL/6 mice was prepared as described above in rat with some modifications. P19CL6 cells were kindly provided by Issei Komuro (Chiba University Graduate school of Medicine). P19CL6 cells were cultured as described previously (12, 27, 28). Briefly, cells were cultured in a-minimal essential medium (Invitrogen), supplemented with 10% fetal bovine serum (Invitrogen), penicillin (100 U/ml), and streptomycin (100 µg/ml). To induce differentiation under adherent conditions, cells were plated at a density of 3.7 x 105 cells in a 60-mm culture dish with 1% dimethyl sulfoxide (DMSO). The medium was changed every 2 days. Days of differentiation were numbered consecutively, with the first day of DMSO treatment as day 0.
Stable transformants. Stable P19CL6 cell lines expressing cDNAs (P19CL6[pcDNA3] and P19CL6[MC129-509]) were generated by using Lipofectamine 2000 reagent according to the manufacturer's protocol (Invitrogen). Stable transformants were selected with 600 µg of G418 (Invitrogen)/ml, and 12 independent cell lines were cloned.
Immunofluorescence. After a 10-min fixation in methanol on ice, cells were rehydrated in PBS for 15 min at room temperature. The fixed cells were incubated for 1 h at room temperature in the presence of MF20, a mouse anti-sarcomeric MHC monoclonal antibody. After three washes with PBS containing 0.5% Tween 20, the cells were incubated for 1 h at room temperature in the dark with TO-PRO-3 (Molecular Probes) and anti-mouse immunoglobulin G conjugated with tetramethyl rhodamine isothiocyanate (TRITC) as the secondary antibody (Jackson Immunoresearch Laboratories). Next, the cells were washed three times and mounted in a solution of 90% glycerol, 10% PBS, and 1 mg of p-phenylenediamine/ml onto glass slides.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and
METHODSResultsDiscussionReferences |
|---|
|
Cloning of myocardin A. Northern blotting revealed multiple transcripts that hybridized to the myocardin cDNA probe and the major hybridized band was ca. 8 kb (Fig. 1B and 3). However, a previous report showed the major hybridized bands of myocardin to be ca. 3 to 5 kb (42). Therefore, we suspected that the major band that we identified was a distinct myocardin isoform. We cloned this isoform by using cDNA libraries of mouse embryonic hearts at ED 10. The sequence of the cDNA encoded a protein of 983 amino acids that was identical to myocardin except for the presence of a 48-amino-acid insertion (Fig. 2). During the course of the present study, a cDNA that has the same insertion site as in our study but starts from the 129th amino acid, as determined in our study, was independently cloned and named myocardin A (GenBank NM_145136). Therefore, we also refer to our gene as myocardin A. Examination of a database of mouse genomic DNA revealed that myocardin A was located on chromosome 11. Myocardin A consists of 14 exons, and the myocardin A-specific exon is located between exon 10 and 11 of myocardin, indicating that myocardin A is an alternative spliced isoform of myocardin.
|
|
Of note, the myocardin A sequence revealed that the probes that we used for in situ hybridization and Northern blotting in Fig. 1 recognize both myocardin and myocardin A transcripts. Therefore, the results of Fig. 1 indicate that overall mRNA expression of myocardin and myocardin A is downregulated in Nkx2.5-null hearts.
Nkx2.5 transactivated the myocardin promoter. To examine whether myocardin expression is regulated by Nkx2.5, we performed a reporter assay using the myocardin promoter. We determined the 5' end of myocardin A cDNA by primer extension analysis (Fig. 4A). We then isolated a 2-kb fragment of the myocardin promoter (positions -1961 to +39 in the myocardin gene). Wild-type Nkx2.5 transactivated the myocardin promoter in a dose-dependent manner (Fig. 4B). On the other hand, a point mutant of Nkx2.5(I183P [Ile183Pro]) that failed to bind DNA (18) did not transactivate the myocardin promoter (Fig. 4C).
|
The result described above suggested that NKE is necessary for the full activation of the myocardin promoter by Nkx2.5. To confirm that Nkx2.5 binds to NKE, an electrophoretic mobility shift assay was performed with in vitro-translated Nkx2.5 protein and oligonucleotide probes corresponding to NKE and NKEr2. As shown in Fig. 4F, Nkx2.5 bound to NKE, whereas it bound to NKEr2 with much lower affinity.
In cardiac myocytes, Nkx2.5 also transactivated the myocardin promoter (Fig. 4G). Together, these results suggest that Nkx2.5 regulates myocardin gene transcription in vitro.
Myocardin A transactivates the ANF promoter through the SRE. Myocardin activates SRE-dependent promoters such as the ANF promoter and the SM22 promoter (42). We examined the transcriptional activity of myocardin A by using the ANF promoter (-638 ANF Luc), which has two SRF binding sites (14). Myocardin A transactivated -638 ANF Luc by >100-fold, and the extent of activation by myocardin A was the same as that caused by myocardin (Fig. 5). We then examined the requirement of the SRE sites in the ANF promoter for responsiveness to myocardin A. Mutation of the SRE2 (no SRE2 Luc) reduced responsiveness to myocardin A by 75%. In contrast, mutation of the SRE1 (no SRE1 Luc) markedly reduced responsiveness to myocardin A, and mutation of both SREs (no SRE1/SRE2 Luc) completely abolished the activation by myocardin A. The requirement of the SRE sites in the ANF promoter for responsiveness to myocardin A was the same as that of myocardin. These results indicate that although there is a difference in the requirement between the SRE1 and the SRE2, the transcriptional activities of myocardin A and myocardin are mediated though the SRE sites.
|
Myocardin is required for cardiomyogenesis in P19CL6 cells. We then examined myocardin expression during cardiomyogenesis in P19CL6 cells. In P19CL6 cells, spontaneously beating cells were first observed in small patches on day 10 after treatment with 1% DMSO, and subsequently the majority of cells beat synchronously, a finding consistent with previous reports (12, 27, 28). As shown in Fig. 6A, myocardin mRNA expression was faintly detectable on day 6 and became maximal on day 8 and 10. The expression pattern of MEF2C mRNA was similar to that of myocardin mRNA because MEF2C mRNA was detectable on day 6 and became maximal on day 8. On the other hand, Nkx2.5 mRNA expression was also first detectable on day 6, but its expression became maximal after day 10. MLC2v mRNA expression was detected on day 10 and increased through day 16.
|
Myocardin A action is modulated by BMP/TAK1 signaling at the SRE. In P19CL6 cells BMPs are required for cardiac myocyte differentiation (28). BMPs act through Smad and TAK1 pathways (40). Smads, TAK1, and their common target ATF2 play pivotal roles in the cardiogenic BMP signaling pathway (27, 28). In cardiac myocytes TGF-ß and TAK1 activate transcription through the SRE (24, 39, 44). Therefore, we examined whether BMP/TAK1 signaling modulates myocardin A action on using the ANF promoter in P19CL6 cells. BMP2 alone did not activate the ANF promoter under our experimental conditions, whereas BMP2 augmented myocardin A-induced ANF promoter activation (Fig. 7A). To examine the effect of TAK1 on BMP signaling, we used a dominant-negative mutant of TAK1 (dnTAK1) in which Lys-63 of the ATP-binding site was replaced by tryptophan (43). dnTAK1 inhibited BMP2 action on myocardin A-induced ANF promoter activation. These results indicate that BMP2 augments responsiveness to myocardin A through TAK1 on the ANF promoter. In addition, wild-type TAK1 augmented myocardin A-induced ANF promoter activation, and a constitutively active TAK1 (caTAK1) which lacks the N-terminal 22 amino acids (43) caused more transactivation (Fig. 7B).
|
We then examined whether TAK1 phosphorylates myocardin A. TAK1 did not phosphorylate myocardin A (data not shown). We also examined whether TAK1 augments SRF action at the SRE. As shown in Fig. 7D, caTAK1 augmented responsiveness to SRF on -132 SRE Luc, indicating that TAK1 signaling regulates SRF function at the SRE site. Together, these results indicate that TAK1 action and myocardin A action are integrated at the SRE sites in P19CL6 cells.
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and
METHODSResultsDiscussionReferences |
|---|
We showed that mutation of both SREs (no SRE1/SRE2 Luc) completely abolished activation by myocardin A (Fig. 5). These results suggest that both SRE sites on the -638 ANF promoter are necessary for myocardin A-dependent transactivation, a finding consistent with previous results showing that myocardin functions as an SRF cofactor at SRE sites (42). However, other sequences in the -638 ANF promoter are also required for full activation of the -638 ANF promoter by myocardin A, because responsiveness to myocardin A on the truncated ANF promoter containing both SRE1 and SRE2 (-132 SRE Luc) was reduced compared to that of the -638 ANF promoter (Fig. 7C). The region deleted in -132 SRE Luc contains binding sites for other transcription factors, including the ATF/CREB family, Nkx2.5, and GATA-4. Hines et al. proposed a model suggesting that SRF at the SRE1 site of the ANF promoter functions as an "activator bridge" to promote productive interactions between activated transcription factors at the other sites and the basal transcription machinery (14). ATF6 has been shown to interact with SRF and be involved in the activation of transcription by SRF (37, 46). SRF also interacts with Nkx2.5 and GATA-4, and the recruitment of Nkx2.5 and GATA-4 by SRF enhances SRF DNA-binding activity (34). Consistent with these data, our results indicate that full ANF promoter activation requires interactions between myocardin and SRF at SRE sites, and other transcription factors at other sites distal to SRE1.
Overexpression of a dominant-negative mutant of Nkx2.5 inhibited cardiomyogenesis in both P19 cells and P19CL6 cells (16, 38). These findings demonstrate that dominant-negative strategies can bypass potential functional redundancies with other family members and allow for the determination of the role of certain genes. To examine the effect of myocardin function on cardiomyogenesis, we used the dominant-negative strategy using the deletion mutant of myocardin A (MC129-509). We showed here that MC129-509 worked as a dominant-negative on the truncated ANF promoter containing SREs and that inhibition of myocardin function prevents differentiation into cardiac myocytes in P19CL6 cells. Expression of a dominant-negative mutant of myocardin in Xenopus embryos interfered with differentiation of myocardial cells (42). Our findings indicate that myocardin function is required for cardiomyogenesis not only in amphibians but also in cultured mammalian cells. The SRF gene was demonstrated to be necessary for cardiac mesoderm formation (1). Our findings indicate that in the presence of SRF, P19CL6 cells cannot differentiate into cardiac myocytes without myocardin function. On the other hand, we could not obtain a cell line expressing wild-type myocardin A. This suggests that timing and the amount of myocardin expression are important for the maintenance of cell function.
BMPs are required for cardiac myocyte differentiation in P19 cells and P19CL6 cells (15, 28). In Drosophila, dpp, the BMP homologue, is required to maintain tinman expression in the mesoderm (10). In chick and Xenopus, disruption of BMP signaling with noggin or dominant-negative BMP receptors can prevent cardiomyogenesis (21, 33, 35, 41). In mouse, BMP2-deficient embryos die before ED 10.5 with a defect in cardiac development (45). These results suggest that BMP signaling is essential for cardiomyogenesis in a number of species.
BMPs function via binding to two types of serine/threonine kinase receptors, type I and type II receptors (19). Among the type I receptors for BMPs, activin receptor-like kinase 3 (ALK3)/BMP type I-A receptor (BMPR-IA) mutant embryos die by ED 9.5 due to a defect in mesoderm formation (26). Development is also arrested in ALK2 mutant embryos at the early gastrulation stage, and these mutants display disruption of mesoderm formation (11, 25). In addition, BMPR-II-deficient embryos die by ED9.5 and lacked mesoderm (2). These results indicate that BMP receptors are important for cardiac development, including mesoderm formation.
BMPs are expressed in tissues adjacent to the precardiac mesoderm, and treatment of BMPs can induce Nkx2.5, GATA-4, and ventricular MHC expression and differentiation into cardiac myocytes of nonprecardiac mesodermal cells in chick (33). However, BMPs can induce heart formation in limited regions of the nonprecardiac mesoderm. These findings suggest that BMP signaling and additional factor(s) in the specified region cooperatively regulate cardiac specificity.
The SRE site is important for expression of early response genes such as c-fos, and cardiac, skeletal, and smooth muscle specific genes (31). Although SRF is highly expressed in muscle cell lineages during embryogenesis, it is not muscle specific. Myocardin has been reported to be expressed in cardiac myocytes and smooth muscle cells (8, 42). We showed here that myocardin A mRNA is highly expressed in heart. However, it was also weakly detected in lung, kidney, and testis. This raises the possibility that expression of SRF and myocardin alone may not account for cardiac myocyte specificity of its target genes and that additional factor(s) are also required for cardiac specificity. Consistent with this viewpoint, the results of the present study showed that BMP/TAK1 signaling augments myocardin function at the SRE sites. Although we have not examined whether the interaction of myocardin with SRF is enhanced by TAK1 or not, our results at least indicate that myocardin A action and TAK1 action are integrated at the SRE site. This may be one of the mechanisms of cardiac myocyte specificity of the SRE-dependent genes.
|
ACKNOWLEDGMENTS |
|---|
This study was supported by Japan Heart Foundation and Bayer Yakuhin Research Grant Abroad, a postdoctoral fellowship from the American Heart Association (AHA; New England affiliate) to T.U., an AHA (Massachusetts Affiliate) Beginning-Grant-in-Aid to H.K., and SCOR in congenital Heart Disease grant from the NIH (P50-HL61036) to S.I.
|
FOOTNOTES |
|---|
Present address: Department of Physiology and Functional Genomics, University of Florida College of Medicine, Gainesville, FL 32610-0274.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and
METHODSResultsDiscussionReferences |
|---|
2. Beppu, H., M. Kawabata, T. Hamamoto, A. Chytil, O. Minowa, T. Noda, and K. Miyazono. 2000. BMP type II receptor is required for gastrulation and early development of mouse embryos. Dev. Biol. 221:249-258.[CrossRef][Medline]
3. Biben,
C., and R. P. Harvey. 1997. Homeodomain
factor Nkx2-5 controls left/right asymmetric expression of bHLH
gene eHand during murine heart development. Genes Dev.
11:1357-1369.
4. Biben, C., S. Palmer, D. A. Elliott, and R. P. Harvey.1997 . Homeobox genes and heart development. Cold Spring Harbor Symp. Quant. Biol. 62:395-403.
5. Bodmer, R. 1993. The gene tinman is required for specification of the heart and visceral muscles in Drosophila.Development 118:719-729.[Abstract]
6. Bruneau, B. G., Z. Z. Bao, M. Tanaka, J. J. Schott, S. Izumo, C. L. Cepko, J. G. Seidman, and C. E. Seidman. 2000. Cardiac expression of the ventricle-specific homeobox gene Irx4 is modulated by Nkx2-5 and dHand. Dev. Biol. 217:266-277.[CrossRef][Medline]
7. Chen,
C. Y., and R. J. Schwartz. 1995.
Identification of novel DNA binding targets and regulatory domains of a
murine tinman homeodomain factor, Nkx-2.5. J. Biol.
Chem.
270:15628-15633.
8. Chen, J., C. M. Kitchen, J. W. Streb, and J. M. Miano. 2002. Myocardin: a component of a molecular switch for smooth muscle differentiation. J. Mol. Cell Cardiol. 34:1345-1356.[CrossRef][Medline]
9. Christoffels, V. M., P. E. Habets, D. Franco, M. Campione, F. de Jong, W. H. Lamers, Z. Z. Bao, S. Palmer, C. Biben, R. P. Harvey, and A. F. Moorman.2000 . Chamber formation and morphogenesis in the developing mammalian heart. Dev. Biol. 223:266-278.[CrossRef][Medline]
10. Frasch, M. 1995. Induction of visceral and cardiac mesoderm by ectodermal Dpp in the early Drosophila embryo.Nature 374:464-467.[CrossRef][Medline]
11. Gu, Z., E. M. Reynolds, J. Song, H. Lei, A. Feijen, L. Yu, W. He, D. T. MacLaughlin, J. van den Eijnden-van Raaij, P. K. Donahoe, and E. Li. 1999. The type I serine/threonine kinase receptor ActRIA (ALK2) is required for gastrulation of the mouse embryo. Development 126:2551-2561.[Abstract]
12. Habara-Ohkubo, A. 1996. Differentiation of beating cardiac muscle cells from a derivative of P19 embryonal carcinoma cells. Cell Struct. Funct. 21:101-110.[Medline]
13. Harvey, R. P. 1996. NK-2 homeobox genes and heart development. Dev. Biol. 178:203-216.[CrossRef][Medline]
14. Hines,
W. A., J. Thorburn, and A. Thorburn.1999
. A low-affinity serum response element allows other
transcription factors to activate inducible gene expression in cardiac
myocytes. Mol. Cell. Biol.
19:1841-1852.
15. Jamali, M., C. Karamboulas, P. J. Rogerson, and I. S. Skerjanc. 2001. BMP signaling regulates Nkx2-5 activity during cardiomyogenesis. FEBS Lett. 509:126-130.[CrossRef][Medline]
16. Jamali,
M., P. J. Rogerson, S. Wilton, and I. S.
Skerjanc. 2001. Nkx2-5 activity is essential
for cardiomyogenesis. J. Biol. Chem.
276:42252-42258.
17. Kasahara, H., S. Bartunkova, M. Schinke, M. Tanaka, and S. Izumo.1998 . Cardiac and extracardiac expression of Csx/Nkx2.5 homeodomain protein. Circ Res. 82:936-946.
18. Kasahara,
H., A. Usheva, T. Ueyama, H. Aoki, N. Horikoshi, and S. Izumo.2001
. Characterization of homo- and heterodimerization of
cardiac Csx/Nkx2.5 homeoprotein. J. Biol.
Chem.
276:4570-4580.
19. Kawabata, M., T. Imamura, and K. Miyazono. 1998. Signal transduction by bone morphogenetic proteins. Cytokine Growth Factor Rev. 9:49-61.[CrossRef][Medline]
20. Komuro,
I., and S. Izumo. 1993. Csx: a murine
homeobox-containing gene specifically expressed in the developing
heart. Proc. Natl. Acad. Sci. USA
90:8145-8149.
21. Ladd, A. N., T. A. Yatskievych, and P. B. Antin. 1998. Regulation of avian cardiac myogenesis by activin/TGFß and bone morphogenetic proteins. Dev. Biol. 204:407-419.[CrossRef][Medline]
22. Lints, T. J., L. M. Parsons, L. Hartley, I. Lyons, and R. P. Harvey. 1993. Nkx-2.5: a novel murine homeobox gene expressed in early heart progenitor cells and their myogenic descendants. Development 119:419-431. (Erratum, 119:969.)[Abstract]
23. Lyons,
I., L. M. Parsons, L. Hartley, R. Li, J. E.
Andrews, L. Robb, and R. P. Harvey. 1995.
Myogenic and morphogenetic defects in the heart tubes of murine embryos
lacking the homeo box gene Nkx2-5. Genes Dev.
9:1654-1666.
24. MacLellan,
W. R., T. C. Lee, R. J. Schwartz, and
M. D. Schneider. 1994. Transforming growth
factor-beta response elements of the skeletal alpha-actin gene.
Combinatorial action of serum response factor, YY1, and the SV40
enhancer-binding protein, TEF-1. J. Biol.
Chem.
269:16754-16760.
25. Mishina, Y., R. Crombie, A. Bradley, and R. R. Behringer.1999 . Multiple roles for activin-like kinase-2 signaling during mouse embryogenesis. Dev. Biol. 213:314-326.[CrossRef][Medline]
26. Mishina,
Y., A. Suzuki, N. Ueno, and R. R. Behringer.1995
. Bmpr encodes a type I bone morphogenetic protein
receptor that is essential for gastrulation during mouse embryogenesis.Genes Dev.
9:3027-3037.
27. Monzen,
K., Y. Hiroi, S. Kudoh, H. Akazawa, T. Oka, E. Takimoto, D. Hayashi, T.
Hosoda, M. Kawabata, K. Miyazono, S. Ishii, Y. Yazaki, R. Nagai, and I.
Komuro. 2001. Smads, TAK1, and their common target
ATF-2 play a critical role in cardiomyocyte differentiation.J. Cell Biol.
153:687-698.
28. Monzen,
K., I. Shiojima, Y. Hiroi, S. Kudoh, T. Oka, E. Takimoto, D. Hayashi,
T. Hosoda, A. Habara-Ohkubo, T. Nakaoka, T. Fujita, Y. Yazaki, and I.
Komuro. 1999. Bone morphogenetic proteins induce
cardiomyocyte differentiation through the mitogen-activated protein
kinase kinase kinase TAK1 and cardiac transcription factors
Csx/Nkx-2.5 and GATA-4. Mol. Cell. Biol.
19:7096-7105.
29. Palmer,
S., N. Groves, A. Schindeler, T. Yeoh, C. Biben, C. C. Wang,
D. B. Sparrow, L. Barnett, N. A. Jenkins,
N. G. Copeland, F. Koentgen, T. Mohun, and R. P.
Harvey. 2001. The small muscle-specific protein Csl
modifies cell shape and promotes myocyte fusion in an insulin-like
growth factor 1-dependent manner. J. Cell
Biol.
153:985-998.
30. Radice, G. L., H. Rayburn, H. Matsunami, K. A. Knudsen, M. Takeichi, and R. O. Hynes. 1997. Developmental defects in mouse embryos lacking N-cadherin. Dev. Biol. 181:64-78.[CrossRef][Medline]
31. Reecy, L., N. Belaguli, and R. Schwartz. 1999. Serum response factor-NK homeodomain interaction: role in cardiac development, p. 273-287. In R. Harvey and N. Rosenthal (ed.), Heart development. Academic Press, Inc., New York, N.Y.
32. Sadoshima,
J., L. Jahn, T. Takahashi, T. J. Kulik, and S. Izumo.1992
. Molecular characterization of the stretch-induced
adaptation of cultured cardiac cells: an in vitro model of load-induced
cardiac hypertrophy. J. Biol. Chem.
267:10551-10560.
33. Schultheiss,
T. M., J. B. Burch, and A. B. Lassar.1997
. A role for bone morphogenetic proteins in the
induction of cardiac myogenesis. Genes Dev.
11:451-462.
34. Sepulveda,
J. L., S. Vlahopoulos, D. Iyer, N. Belaguli, and R.
J. Schwartz. 2002. Combinatorial expression of GATA4,
Nkx2-5, and serum response factor directs early cardiac gene
activity. J. Biol. Chem.
277:25775-25782.
35. Shi, Y., S. Katsev, C. Cai, and S. Evans. 2000. BMP signaling is required for heart formation in vertebrates. Dev. Biol. 224:226-237.[CrossRef][Medline]
36. Tanaka, M., Z. Chen, S. Bartunkova, N. Yamasaki, and S. Izumo.1999 . The cardiac homeobox gene Csx/Nkx2.5 lies genetically upstream of multiple genes essential for heart development.Development 126:1269-1280.[Abstract]
37. Thuerauf,
D. J., N. D. Arnold, D. Zechner, D. S.
Hanford, K. M. DeMartin, P. M. McDonough, R.
Prywes, and C. C. Glembotski. 1998. p38
Mitogen-activated protein kinase mediates the transcriptional induction
of the atrial natriuretic factor gene through a serum response element:
a potential role for the transcription factor ATF6. J.
Biol. Chem.
273:20636-20643.
38. Toko,
H., W. Zhu, E. Takimoto, I. Shiojima, Y. Hiroi, Y. Zou, T. Oka, H.
Akazawa, M. Mizukami, M. Sakamoto, F. Terasaki, Y. Kitaura, H. Takano,
T. Nagai, R. Nagai, and I. Komuro. 2002.
Csx/Nkx2-5 is required for homeostasis and survival of cardiac
myocytes in the adult heart. J. Biol. Chem.
277:24735-24743.
39. Ueyama, T., S. Kawashima, T. Sakoda, K. Hirata, Y. Ohashi, W. Yamochi, H. Akita, and M. Yokoyama. 1998. Transforming growth factor-ß1 and protein kinase C synergistically activate the c-fos serum response element in myocardial cells. J. Mol. Cell Cardiol. 30:551-562.[CrossRef][Medline]
40. von Bubnoff, A., and K. W. Cho. 2001. Intracellular BMP signaling regulation in vertebrates: pathway or network? Dev. Biol. 239:1-14.[CrossRef][Medline]
41. Walters, M. J., G. A. Wayman, and J. L. Christian. 2001. Bone morphogenetic protein function is required for terminal differentiation of the heart but not for early expression of cardiac marker genes. Mech. Dev. 100:263-273.[CrossRef][Medline]
42. Wang, D., P. S. Chang, Z. Wang, L. Sutherland, J. A. Richardson, E. Small, P. A. Krieg, and E. N. Olson. 2001. Activation of cardiac gene expression by myocardin, a transcriptional cofactor for serum response factor.Cell 105:851-862.[CrossRef][Medline]
43. Yamaguchi,
K., K. Shirakabe, H. Shibuya, K. Irie, I. Oishi, N. Ueno, T. Taniguchi,
E. Nishida, and K. Matsumoto. 1995. Identification of
a member of the MAPKKK family as a potential mediator of TGF-ß
signal transduction. Science
270:2008-2011.
44. Zhang, D., V. Gaussin, G. E. Taffet, N. S. Belaguli, M. Yamada, R. J. Schwartz, L. H. Michael, P. A. Overbeek, and M. D. Schneider. 2000. TAK1 is activated in the myocardium after pressure overload and is sufficient to provoke heart failure in transgenic mice. Nat. Med. 6:556-563.[CrossRef][Medline]
45. Zhang, H., and A. Bradley. 1996. Mice deficient for BMP2 are nonviable and have defects in amnion/chorion and cardiac development.Development 122:2977-2986.[Abstract]
46. Zhu, C., F. E. Johansen, and R. Prywes. 1997. Interaction of ATF6 and serum response factor. Mol. Cell. Biol. 17:4957-4966.[Abstract]
47. Zou, Y., S. Evans, J. Chen, H. C. Kuo, R. P. Harvey, and K. R. Chien. 1997. CARP, a cardiac ankyrin repeat protein, is downstream in the Nkx2-5 homeobox gene pathway. Development 124:793-804.[Abstract]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|
