Previous Article | Next Article ![]()
Molecular and Cellular Biology, December 2003, p. 9283-9292, Vol. 23, No. 24
0270-7306/03/$08.00+0 DOI: 10.1128/MCB.23.24.9283-9292.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Department of Chemistry and Biochemistry and Molecular Biology Institute, University of California, Los Angeles, California 90095
Received 6 March 2003/ Returned for modification 5 May 2003/ Accepted 5 September 2003
|
|
|---|
|
|
|---|
In 1999, using conserved AdoMet binding motifs, we identified 26 putative methyltransferases (designated F1 to F26) encoded by the genome of the yeast Saccharomyces cerevisiae (40). Biochemically, we have been able to show that two of these species are in fact methyltransferases; F3 (YDR465c) catalyzes the transfer of a methyl group to the delta-nitrogen atom of arginine residues in a novel protein posttranslational reaction (40, 58), while F9 (YER175c) catalyzes the methyl esterification of the small molecule trans-aconitate (9). Recently, F1 (YDL201w) was found to be responsible for formation of 7-methylguanosine at position 46 of tRNA (3).
One major approach in identifying novel enzymes has been the comparison of the methylation spectra of strains lacking the putative methyltransferase and those of their isogenic wild-type parents by separation techniques such as sodium dodecyl sulfate (SDS) gel electrophoresis (26, 59). In the yeast S. cerevisiae, one can study biological methylation in vivo by incubating cells with S-adenosyl-L-[methyl-3H]methionine ([3H]AdoMet), the major biological methyl donor (26). As a result, all methyl-accepting species such as RNAs, proteins, and small molecules can become radiolabeled and the fate of the methylated species can be followed biochemically. One can then look for differences in the methylation spectra between a mutant strain and its parent.
In all domains of life, tRNAs are highly modified posttranscriptionally (46, 47). Methylation reactions account for the majority of these modifications. In the yeast S. cerevisiae, eight tRNA methyltransferases have been identified so far. The TRM1 gene product forms N2,N2-dimethylguanosine at position 26 (14). TRM2 encodes a protein that forms 5-methyluridine at position 54 (41). TRM3 encodes a protein that catalyzes methylation on the 2'-O-ribose moiety of guanosine 18 (11). TRM4 encodes a methyltransferase that forms 5-methylcytosine at positions 34, 40, 48, and 49 (37). The TRM5 gene product forms 1-methylguanosine (m1G37) at position 37 and 1-methylinosine (m1I) and participates in Y-base (yW) formation (8). The GCD14 gene product is part of a complex that forms 1-methyladenosine (4). Trm7 was identified as a methyltransferase that forms 2'-O-methylribose in the anticodon loop (43). Recently, Trm8, working in a complex, was found to be required for formation of 7-methylguanosine at position 46 of tRNA (3).
In this paper, we present evidence for the identification of the F6 (YML014w) candidate methyltransferase as the enzyme responsible for the esterifications of the modified 5-methylcarbonylmethyluridine (mcm5U) and 5-methylcarbonylmethyl-2-thiouridine (mcm5s2U) wobble bases in tRNA. We show that deletion of the F6 gene can lead to hypo-methyl esterification of tRNA at these bases in vivo. In addition, we show that the F6 gene product can methyl esterify tRNA in vitro, and we have now designated the F6 gene TRM9. Finally, we show that trm9 deletion mutants are hypersensitive to the translational inhibitor paromomycin at elevated temperatures, suggesting the importance of the methyl-esterified bases during heat shock.
|
|
|---|
his
1 leu2
0 lys2
0 ura3
0) and the F6 (YML014w) kanamycin insert deletion strain in the BY4742 background were obtained from ResGen/Invitrogen (Carlsbad, Calif.). In this work, we designated the F6 deletion strain HKY101 (BY4742 trm9::Kanr). The CEN.PK2-1C strain (MAT
ura3 his3 leu2 trp1) was a gift from Cathy Clarke, University of CaliforniaLos Angeles. Strain HKY102 (CEN.PK2-1c trm9::TRP1) was made using a PCR-based methodology with forward primer 5'-ATGGAGATAAACCAAGCGGCTGAAAAAGAACAGGAGTATGCCGCGGTGGCCGCTCTA-3', reverse primer 5'-TCATCTCTTCTGGGCCACCACCCACCAATTGTCGCGGCATCGATAAGCTTGATATCGA-3', and template plasmid pBluescript KS(+)-TRP1 (6). To generate the expression vector pRS316-TRM9, PCR methodology was used to amplify a 1,292-bp genomic fragment that contains the entire coding sequence of TRM9 and 452 bp upstream of the TRM9 gene. The forward primer (5'-GCCGGATCCGGGACTTTGTTGTTGATAGAGTCCGG-3') contains BamHI site-flanking sequences and the reverse primer (5'-TAAGTCGACTCATCTCTTCTGGGCCACCACCAC-3') contains SalI site-flanking sequences. The HKY111 strain, in which the wild-type TRM9 gene is replaced in the yeast genome by a fusion of TRM9 with an N-terminal hemagglutinin (HA) epitope-encoding segment under the control of the GAL1 promoter, was prepared as described previously (26). Briefly, specific primers included a forward primer containing nucleotides -90 to -51 of the promoter region of YML014w incorporated into the 5' end of the F1 sequence and a reverse primer containing nucleotides +50 to +11 of YML014w incorporated into the 5' end of the R1 sequence (26). In vivo labeling and preparation of cell extracts. Strains of S. cerevisiae were grown to early log phase (optical density at 600 nm [OD600] of between 0.6 and 0.8) in 50 ml of medium (1% yeast extract [Difco, Detroit, Mich.], 2% peptone [Difco], and 2% of either D-glucose for yeast extract-peptone-dextrose [YPD] medium or D-galactose [Sigma Chemical Co., St Louis, Mo.] for yeast extract-peptone-glucose [YPG] medium).An aliquot of 5 OD600 units of cells was collected by centrifugation at 110 x g for 5 min at 4°C, and the cells were washed three times with 10 ml of YPD or YPG medium. The cell pellet was resuspended in 820 µl of YPD or YPG medium and 180 µl of [3H]AdoMet (80 Ci/mmol in hydrochloric acid-ethanol diluted 9:1 [pH 2.0 to 2.5; Amersham Biosciences, Piscataway, N.J.]) to give a final [3H]AdoMet concentration of 2 µM. Cells were incubated in a gyratory shaker at 225 rpm for 30 min at 30°C, pelleted as described above, and washed twice with 1 ml of water.
The cell pellet was then resuspended in 50 µl of lysis buffer (1% SDS [wt/vol] and 0.67 mM phenylmethylsulfonyl fluoride). Glass beads (0.2 g and 0.5 mm in diameter; Biospec Products, Inc., Bartlesville, Okla.) were added to the cell suspension, and the mixture was vortexed for 1 min, followed by incubation on ice for another 1 min. The vortexing step was repeated seven times. The extract was collected into a new tube, and another 50 µl of lysis buffer was added to the beads and vortexed for 30 s to wash the remaining protein from the beads. This washed extract was then pooled with the original extract.
SDS gel electrophoresis and analysis of 3H-methylated species. Approximately 50 µl of the extract was mixed with an equal volume of concentrated gel electrophoresis sample buffer (3.5% [vol/vol] ß-mercaptoethanol, 6% [wt/vol] SDS, 0.18 M Tris-HCl [pH. 6.8], 10% glycerol, 0.005% [wt/vol] bromophenol blue), incubated at 100°C for 5 min, and loaded onto a 1.5-mm-thick slab gel containing a stacking gel and a 10.5-cm-long resolving gel. The resolving gel was made from 10% (wt/vol) acrylamide and 0.34% (wt/vol) N,N-methylenebisacrylamide. Molecular mass standards (20-µl aliquots of Bio-Rad low-molecular-weight standard, no. 161-0304, each at 2 mg/ml) were mixed with 20 µl of sample buffer; 10 µl was loaded into wells. Electrophoresis was performed at 20 mA until the dye front ran off the end of the resolving gel (32). Gels were stained for 15 min in 0.1% Coomassie brilliant blue in 50% (vol/vol) methanol and 10% (vol/vol) acetic acid in water and then destained overnight at room temperature in 5% (vol/vol) methanol and 10% (vol/vol) acetic acid in water. The gels were vacuum-dried at 65°C onto Whatman 3MM chromatography paper.
Dried gels were cut into 3-mm-thick slices that were 8 mm wide. To analyze gel slices for 3H radioactivity in methyl ester linkages, 150 µl of 1.5 M Na2CO3 (pH 12) was added to each dried gel slice in a 1.5-ml polypropylene microcentrifuge tube. The tubes were gently placed into 20-ml scintillation vials containing 5 ml of Safety Solve counting fluid (Research Products International, Mt. Prospect, Ill.) so that no mixing occurred, and the vials were tightly capped. Vials were incubated at 37°C for 24 h to allow [3H]methanol derived from base hydrolysis of methyl esters to diffuse in the vapor phase from the microcentrifuge tubes to the scintillation fluid. Scintillations in vialswere counted using a Beckman LS6500 scintillation counter. To determine the total level of 3H radioactivity present in each gel slice, 1 ml of 30% hydrogen peroxide was added gently to each microcentrifuge tube containing the gel slice after the scintillations in the vials were counted to measure [3H]methanol levels. Vials were capped loosely and incubated at 37°C for an additional 24 h to allow for the digestion of the gel slice. After the vials were shaken to mix completely the contents of the microcentrifuge tube with the scintillation fluid, scintillations in the vials were recounted.
tRNA extraction and digestion. Yeast cells grown in 50 or 500 ml of YPD to log phase (OD600 of 0.5 to 1.0) at 30°C were harvested by centrifugation for 5 min at 1,300 x g at 4°C. The cells were resuspended in 300 µl of 0.9% NaCl per 10 OD units of cells, and 2 volumes of phenol were then added to the suspension. The mixture was rotated gently at room temperature for 30 min. Chloroform (0.1 volume) was then added to the mixture, and the samples were incubated for an additional 15 min at room temperature. The samples were spun down at 10,600 x g for 20 min. The aqueous phase was collected and mixed with 2.5 volumes of ethanol and 0.1 volume of 20% potassium acetate to precipitate RNA. tRNA was purified with the 2 M LiCl extraction method as described previously (5). The tRNA pellet was washed twice with 80% ethanol and finally dissolved in water or 2.4 M tetraethylammonium chloride. tRNA was digested as previously described (18, 44). Briefly, 50 µl (100 to 200 µg of RNA as determined by A260) of tRNA was heat denatured at 90°C for 2 min and 5 µl of 10 mM zinc sulfate and 10 µl (200 U per ml) of nuclease P1 (Boehringer-Mannheim, Mannheim, Germany) were added. The mixture was incubated at 37°C for 16 h. Ten microliters of 0.5 M Tris buffer (pH 8.0) and 10 µl (100 U per ml) of alkaline phosphatase (bacterial type III; Sigma) were added. The mixture was incubated at 37°C for 2 h.
Purification of specific tRNAs. To isolate specific tRNA species, the total tRNA extract described above was hybridized to matrix-bound oligonucleotides. Synthetic nucleotides containing biotin at the 5' end were designed to specifically hybridize to S. cerevisiae tRNAArg3 or tRNAGlu. Biotinylated primers were synthesized that were specific for tRNAArg3 and tRNAGlu and contained 35 nucleotides complementary to the 5' ends up to position 34, at which the mcm5U or mcm5s2U nucleotides are present. The probe (0.5 nmol) was bound to Dynabeads M-280 with streptavidin covalently attached to the surface, according to the recommendation of the manufacturer (Dynal A.S., Olso, Norway). Briefly, the beads were washed three times in the high salt buffer (5 mM Tris-HCl, 0.5 mM EDTA, 1 M NaCl). The beads were resuspended in 250 µl of the high salt buffer and 10 µl (1 nmol) of biotinylated synthetic probes. The mixture was incubated at room temperature for 15 min. Beads were washed three times with the high salt buffer. The hybridization method used here is described elsewhere (49). Briefly, tRNA (50 to 200 µg), dissolved in 2.4 M tetraethylammonium chloride, was denatured at 60°C for 3 min and then mixed with the streptavidin-bound oligonucleotide beads at 15°C for 30 min. The beads were washed three times with 2.4 M tetraethylammonium chloride, and then bound tRNA was eluted after heating at 60°C for 3 min in 100 µl of 2.4 M tetraethylammonium chloride. tRNA was concentrated and desalted by centrifugation by using Centricon 10 columns (Amicon, Beverly, Mass.).
High-pressure liquid chromatography (HPLC). In a modification of the method of Pomerantz and McCloskey (44), digested tRNA was injected onto a C18 reverse-phase column (Supelcosil; 5-µm-diameter beads, 4.6-mm inside diameter, and 250-mm length) equilibrated in solvent A (5 mM ammonium acetate, pH 6.0) for 15 min and eluted at 1 ml/min at 25°C with increasing solvent B (40% acetonitrile in 60% water) concentrations. Amounts of time (in minutes) and percentages of A and B were as follows: 0, 100, and 0; 3, 100, and 0; 5.8, 98, and 2; 7.2, 97, and 3; 10, 95, and 5; 25, 75, and 25; 30, 50, and 50; 34, 25, and 75; 37, 25, and 75; 43, 0, and 100; and 48, 0, and 100, respectively. The nucleotides were detected using a UV detector (Waters Lambda-Max model 489) set at 254 nm. The fractions were collected at either at 1- or 0.5-min intervals. The collected fractions were used directly for the base-labile assay (described below) or dried overnight under a vacuum for mass spectrometry.
HPLC fractions were analyzed for [3H]methyl esters by mixing 100 to 150 µl with NaOH to give a 1 M solution in a 200-µl final volume to form [3H]methanol. The hydrolysate was spotted onto a 1.5- by 8-cm piece of Whatman 3MM paper and suspended in the neck of a 20-ml scintillation vial above 5 ml of Safety Solve scintillation fluid. After 2 h at room temperature, the paper was removed and the scintillations in the vial were counted to measure the level of [3H]methanol that had transferred to the fluid in the vapor phase.
Mass spectrometry. A Perkin-Elmer Sciex API III triple quadrupole mass spectrometer was used as previously described (27). HPLC fractions containing nucleosides were analyzed by direct injection (15 µl) into a mixture of water-acetonitrile-formic acid (50/50/0.1, vol/vol/vol). Normal spectra were obtained by scanning from an m/z of 200 to an m/z of 600 (0.3-Da step size, 30-msec dwell time, 6.0 s/scan, and orifice voltage of 60). Ion series were transformed using version 3.3 of MacSpec software. For tandem mass spectrometry (MS/MS) analysis, positive ion spectra of Q1 preselected parent ions were generated by collisionally induced dissociation (10% nitrogen in argon) with a collision gas thickness instrument setting (CGT) of 100 and an R0-R2 offset of 20 V via scanning of Q3 from an m/z of 50 to an m/z of 400 (step size, 0.3 Da; dwell time, 30 ms; scan time, 5.02 s; orifice voltage, 60).
Preparation of saponified tRNA. Yeast tRNA was saponified as described previously (29). Briefly, 1 ml of 0.5% of a commercial preparation of yeast tRNA (Boehringer-Mannheim) was mixed with 125 µl of 1 M NaOH and the mixture was incubated at room temperature for 10 min. The solution was neutralized with 125 µl of 1 M acetic acid. This preparation was used directly in the in vitro reactions.
In vitro methylation of immunoprecipitated HA-tagged protein. Genomically HA-tagged TRM9 gene product was immunoprecipitated from extracts of HKY111 cells (100 OD600 units) as described previously (26). Briefly, the protein-bound beads were resuspended in 150 µl of buffer containing 50 mM Tris-HCl (pH 7.5) and 150 mM NaCl. An in vitro reaction mixture containing 5 µl of [3H]AdoMet (final concentration of 1.4 µM in hydrochloric acid-ethanol diluted 9:1 [pH 2.0 to 2.5]), 40 µl of beads, and various amounts of commercially purchased baker's yeast tRNA (Boehringer-Mannheim) was incubated at 37°C for 30 min. The reaction was stopped using 2x gel electrophoresis sample buffer, and the [3H]methyl ester counts were measured as described previously (26).
Preparation of a GST-Trm9 fusion protein.
Plasmid pAN105 was made by Agnieszka Niewmierzycka in our laboratory to express a glutathione-S-transferase (GST)-Trm9 fusion protein (39). Briefly, DNA including the open reading frame of YML014w (TRM9) was amplified by PCR from yeast genomic DNA by using primers containing a BamHI site in the 5' end (CTAGGATCCAACATGGAGATAAACC) and an EcoRI site in the 3' end (CTAGAATTCACCTTCATCTCTTCTG). The amplified products and the plasmid pGEX-2T (Amersham Biosciences) were then each digested with EcoRI and BamHI. The digested insert was ligated into the digested vector in frame with the GST coding region to encode a GST-Trm9 fusion protein. Escherichia coli DH5
cells were transformed with the ligation reaction, and the correct clone was selected by restriction analysis. The GST fusion protein was expressed by IPTG (isopropyl-ß-D-thiogalactopyranoside; 1 mM final concentration) induction of a 2-liter culture of cells in Luria-Bertani broth containing 100 µg of ampicillin/ml at an OD600 of 0.4. After 3 h, the cells were spun down and washed twice, and the pellet was resuspended in 25 ml of a mixture of 140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.8 mM KH2PO4 (pH 7.3) containing a dissolved protease cocktail tablet (Roche, Inc.). The resuspended cells were sonicated for 5 min, and the mixture was spun down by centrifugation at 18,600 x g for 15 min at 4°C. The supernatant was transferred to 0.5 ml of a 50% glutathione-Sepharose 4B slurry (Amersham Biosciences) and shaken gently at 4°C for 1 h. Beads were spun down and washed three times with the lysis buffer. The fusion protein was eluted using 1 ml of 10 mM reduced glutathione-50 mM Tris-HCl (pH 8.0).
|
|
|---|
![]() View larger version (27K): [in a new window] |
FIG. 1. [3H]methyl ester spectra of yeast extracts separated by SDS gel electrophoresis. Yeast cells were labeled in vivo with [3H]AdoMet as explained in Materials and Methods. Subsequently, the cellular extract was fractionated by SDS-10% polyacrylamide gel electrophoresis and the [3H]methanol resulting from hydrolysis of methyl esters was measured as described previously (26). Polypeptide size standards are as follows: phosphorylase b, 97 kDa; bovine serum albumin, 66 kDa; ovalbumin, 45 kDa; carbonic anhydrase, 31 kDa; and soybean trypsin inhibitor, 21 kDa. For RNase treatment, extracts containing approximately 100 µg of protein were incubated with 40 µg of bovine pancreatic RNase A (preincubated by heating at 100°C for 15 min). Symbols: , wild-type strain BY4742; , F6 (YML014w) deletion mutant HKY101; , RNase-treated wild-type strain BY4742; , RNase-treated F6 (YML014w) deletion mutant HKY101.
|
F6 is a tRNA methyltransferase (Trm9) responsible for the methylation of mcm5U and mcm5s2U nucleosides. We focused on tRNA methylation because tRNAs would be expected to migrate in the 21-kDa region of SDS gels. tRNA was extracted from in vivo [3H]AdoMet-radiolabeled cells and was subsequently hydrolyzed to nucleosides. The resulting nucleosides were separated by HPLC, and the fractions were analyzed either by direct counting for total radioactivity or by the vapor phase assay for [3H]methyl esters. No large differences were observed in the patterns of total radioactivity in F6 deletion strains, suggesting that the F6 gene product is not one of the major tRNA methylated species (data not shown). However, when the methyl ester radioactivity levels were compared, it was found that two of the major species were completely missing in the F6 deletion strain (Fig. 2). One of these missing species eluted at 26 min (fraction 52) and the other at 32 min (fraction 64). Two candidate modified nucleosides that would be expected to elute at these positions are mcm5U and mcm5s2U (18, 44). When the elution profiles of authentic mcm5U and mcm5s2U (both generous gifts of Darrell R. Davis, University of Utah) were examined under our HPLC conditions, mcm5U eluted exactly with the 26-min peak missing in the F6 deletion mutant and mcm5s2U eluted exactly with the 32-min peak also absent in the F6 deletion mutant (data not shown). We thus designate the F6 (YML014w) gene TRM9 (for tRNA methyltransferase).
![]() View larger version (22K): [in a new window] |
FIG. 2. HPLC fractionation of methyl-esterified tRNA nucleosides. Total tRNA was extracted from in vivo-radiolabeled cells (10 OD units) as described in Materials and Methods. Subsequently, tRNA was digested with P1 nuclease and alkaline phosphatase to generate free nucleosides and then fractionated by HPLC as described in Materials and Methods. Methyl ester radioactivity was measured by adding 100 µl of 2 N NaOH to 100 µl of each fraction and measuring vapor phase [3H]methanol as described in Materials and Methods. Symbols: , wild-type strain BY4742; , F6 deletion mutant HKY101.
|
![]() View larger version (26K): [in a new window] |
FIG. 3. Large-scale HPLC fractionation of tRNA-derived nucleosides. Total tRNA from yeast cells (500 OD units) was extracted and treated to generate nucleosides as described in the legend to Fig. 2, and chromatography was performed as described in Materials and Methods. (A) Wild-type parent BY4742. (B) F6 deletion mutant HKY101.
|
![]() View larger version (30K): [in a new window] |
FIG. 4. Mass spectral identification of modified nucleosides missing in the trm9 deletion mutant. HPLC fractions corresponding to the mcm5U and mcm5s2U peaks shown in Fig. 3 were analyzed as described in Materials and Methods. The MS/MS spectrum of the ion of m/z 317.0 from the 26-min peak is shown in the upper panel (A); the MS/MS spectrum of the ion of m/z 333.0 from the 32-min peak is shown in the lower panel (B).
|
![]() View larger version (20K): [in a new window] |
FIG. 5. Isolation and characterization of tRNAArg3 and tRNAGlu from in vivo-radiolabeled yeast cells. Total tRNA was isolated from 15 OD600 units of radiolabeled cells as described in Materials and Methods. Biotinylated primers specific for either tRNAArg3 or tRNAGlu were used to purify the tRNAs from either the wild-type parent BY4742 or the HKY101 trm9 deletion strain. Isolated tRNA was digested with P1 nuclease and alkaline phosphatase to generate free nucleosides that were fractionated by HPLC as described in the legend to Fig. 2. One hundred microliters of each fraction was used for measuring the methyl ester radioactivity as described in the legend to Fig. 2. (A) Methyl ester radioactivity from digested tRNAArg3 from the parent ( ) and the trm9 deletion ( ) strains. (B) Methyl ester radioactivity from digested tRNAGlu from the parent ( ) and the trm9 deletion ( ) strains.
|
|
View this table: [in a new window] |
TABLE 1. In vitro methyl esterification catalyzed by the Trm9 methyltransferasea
|
Genome-wide analysis of yeast protein complexes has suggested that the Trm9 protein is present in a complex with another putative methyltransferase, F8 (YDR140w), as well as three other gene products (YNR050c, YOL124c, and YNR046w) (17). The deletion mutants lacking these interacting proteins were examined, with the exception of the YNR046w deletion mutant, since deletion of YNRO46w is lethal. All deletion mutants were found to contain the mcm5U and mcm5s2U modified nucleosides (Fig. 6).
![]() View larger version (27K): [in a new window] |
FIG. 6. HPLC fractionation of methyl-esterified tRNA nucleosides from mutant yeast cells deficient in products potentially found in a complex with Trm9 (17). Total tRNA was extracted from in vivo-radiolabeled cells with mutations in the F8 (YDR140w), YNR050c, and YOL124c genes as well as in the TRM9 gene as described in the legend to Fig. 2. Subsequently, tRNA was digested with P1 nuclease and subjected to alkaline phosphatase to generate free nucleosides, which were fractionated by HPLC. Methyl ester radioactivity was measured by adding 100 µl of 2 N NaOH to 100 µl of each fraction and measuring vapor phase [3H]methanol as described in Materials and Methods. The elution positions of mcm5U and mcm5s2U methyl esters are shown with arrows. For clarity, the baseline has been adjusted; there is no significant radioactivity seen except in the region of mcm5U and mcm5s2U.
|
![]() View larger version (24K): [in a new window] |
FIG. 7. In vitro formation of mcm5U and mcm5s2U catalyzed by GST-Trm9. Saponified yeast tRNA (50 µg) prepared as described in Materials and Methods was incubated with [3H]AdoMet (final concentration of 0.8 µM) and the purified GST-Trm9 fusion protein (5 µg of protein, prepared as described in Materials and Methods) in a final volume of 50 µl of 100 mM Tris-HCl, pH 8.0. Samples were incubated for 60 min at 30°C. Reactions were stopped by adding 1 volume of phenol and 1 volume of chloroform. tRNA was precipitated from the aqueous phase by adding 2 volumes of ethanol. Samples were enzymatically digested and fractionated by HPLC as described in Materials and Methods. Methyl ester radioactivity in fractions was measured by adding 50 µl of 4 N NaOH to 150 µl of each fraction and measuring vapor phase [3H]methanol as described in Materials and Methods ( ). The elution positions of mcm5U and mcm5s2U are indicated. Control experiments were performed in which no GST fusion protein was added (), in which GST-Trm9 was incubated without tRNA ( ), or in which an unrelated GST fusion protein, GST-Rmt1, was used ( ).
|
![]() View larger version (78K): [in a new window] |
FIG. 8. Protein sequence identity of the Trm9 methyltransferase from S. cerevisiae with potential orthologs from four other eukaryotes. Deduced sequences were aligned using the Clustal method in the MegAlign program. Amino acid residues identical to those in the S. cerevisiae sequence are shaded. GenBank accession numbers are as follows: S. cerevisiae, S55105; Schizosaccharomyces pombe, spac13d.o3; Caenorhabditis elegans, CAB63431; Drosophila melanogaster, CG17807; and Homo sapiens, KIAA1456.
|
![]() View larger version (99K): [in a new window] |
FIG. 9. Sensitivity of trm9 deletion strains to paromomycin. (A) Yeast strains (wild-type parent CEN.PK2-1CHKY102 and the trm9 HKY102 strain) were grown to log phase at 30°C in the presence of 300 µg of paromomycin/ml. Cells (0.5 OD600 unit) were collected and resuspended in 200 µl of sterilized water. Ten microliters of the suspension was diluted in fivefold serial dilutions and plated onto YPD plates, and colonies were allowed to grow for 3 days. (B) Experimental conditions were the same as those described for panel A except that strains were grown at 37°C. (C) Yeast strains containing either the vector pRS316 or the TRM9 expression vector pRS316-TRM9 were grown at 37°C and plated as described above but in a synthetic dextrose medium lacking uracil.
|
|
|
|---|
Uridine residues at the wobble position 34 are generally modified. In E. coli the modification is either of the xo5U (5-hydroxyuridine derivative) type or the xm5(s2) U(m) (5-methyluridine, 5-methyl-2-thiouridine, or 5-2'-O-methyluridine) type. The xo5U modification is found in tRNAs in which the wobble base can recognize all four nucleotides in the codon (53). Modified nucleosides of the xm5(s2) U(m) type include 5-methylaminomethyl-2-thiouridine (mnm5s2U) and 5-carboxymethylaminomethyl-2'-O-methyluridine (cmnm5Um) in E. coli. They are found in tRNA families that can read A or G in the third position of the codon (12, 50). In eukaryotic tRNA, methyl-esterified derivatives of the xm5(s2) U(m) family (mcm5U and mcm5s2U) have been found in the wobble positions of tRNAArg3 and tRNAGlu of yeast (28, 30, 31) and mcm5s2U has been reported in human tRNALys3 as well as in tRNAs of other mammalian species (42, 45). These methyl-esterified modifications have been found only in eukaryotes to date. Their apparent absence in eubacteria and archaebacteria suggests additional functions for these modifications as organisms became more complex.
Crick's original wobble hypothesis proposed that U in position 34 of the anticodon recognizes both A and G in the third position of the codon (13). With knowledge of the modifications of uridine residues in the wobble position, this hypothesis has now been revised to propose that the unmodified U at position 34 can recognize all four bases while the modified uridine residues are more restrictive and limit the recognition to only A and G, or to only one of these residues, at this position (33, 56). As a result, disruption of the modification of this uridine residue may lead to misreading in the third position of the codon and ultimately the incorporation of the wrong amino acid into the protein (57).
In vitro studies have shed some light onto the possible functions of the methyl esterification reaction in relation to these modified nucleotides. It has been shown that the mcm5U modification restricts the pairing of the anticodon UCU so that it recognizes the AGA codon only; yeast tRNAArg3 lacking this modification can recognize both AGA and AGG codons (52). Results of other in vitro binding and translation studies support the hypothesis that the 2-thiouridine (s2U34) modification and the 5-methylaminoethyl (mnm5U34) modification at position 34 restrict the reading of noncognate or near-cognate codons ending in U and C that specify different amino acids but allow recognition of their cognate codons ending in A or G (2, 20, 34, 54). With nuclear magnetic resonance, it has been shown that an mnm5s2U34-hypermodifiedtRNALys stabilizes a U turn structure whereas the s2U34 modification alone cannot bring about the same structural change (48). It is interesting, however, that in vivo studies using E. coli mutants lacking mnm5s2U34 or s2U34 actually demonstrate reduced rather than increased misreading of asparagine codons (22). It is clear that further work is needed to fully understand the role of these modifications.
What is the consequence of the loss of the Trm9 methyltransferase identified in yeast cells? Mutant cells are clearly viable under a number of conditions tested. However, we have been able to demonstrate sensitivity of trm9 mutants to paromomycin at elevated temperatures (Fig. 9). Paromomycin is an aminoglycoside antibiotic that has been found to interact with the ribosomal A site (10, 51). It is possible that the trm9 mutant lacking the methyl ester at the wobble position incorporates incorrect amino acids at a significant rate and that this leads to its sensitivity to paromomycin at the higher temperatures. Strains with TRM9 mutations were also found in a genome-wide screen of viable diploid deletion mutants of S. cerevisiae for gamma-ray sensitivity (7). These mutants also showed sensitivity to bleomycin (a DNA-damaging agent) and resistance to camptothecin (a topoisomerase I inhibitor) and hydroxyurea (an inhibitor of DNA replication). Although we have not confirmed these phenotypes in our haploid deletion mutants, pleiotropic effects may be expected from the disruption of the function of two (or more) tRNA species. In humans, we note that a mutation in a tRNALys species results in a defect in the modification of its wobble 2-thiouridine residue that disturbs the codon-anticodon interaction and is associated with an epilepsy linked to abnormal "ragged-red" muscle fibers (55). Additionally, in at least one host-pathogen interaction, the modified nucleoside mcm5s2U found in human tRNALys3 plays a key role in controlling the primer-template interaction in the reverse transcription initiation complex of human immunodeficiency virus type 1 (24, 25).
Among the eight tRNA methyltransferases in yeast described previously, only the Gcd10/Gcd14 methyltransferase has been shown to be essential (4). However, a deletion strain lacking TRM5, which is responsible for modification of m1G37, m1I, and yW, was found to grow very poorly (8). In addition, a deletion strain lacking TRM7, responsible for 2'-O-methylribose in the anticodon loop, showed slow growth and sensitivity to paromomycin (43). Although the tRNA methyltransferases are evolutionarily conserved among many organisms, which points to essential roles, the generally nonlethal mutant phenotypes suggest subtle roles in fine-tuning of tRNA function under a variety of physiological conditions.
We examined the subcellular localization of Trm9 in yeast cells by using a green fluorescent protein fusion construct and found Trm9 to be present in both nuclei and cytoplasm (data not shown). For those tRNA methyltransferases of which the subcellular localization patterns have been determined, the enzymes are found in either the nucleus or the cytoplasm. Trm1, Trm4, and Gcd10/Gcd14 are found in the nucleus (2, 12, 32), whereas Trm7 is found to be cytoplasmic (43).
In two yeast tRNA methyltransferases (Gcd10/Gcd14 and Trm8/Trm82), the cellular function requires more than one polypeptide chain in a complex (3, 4), and it has been suggested that this situation may be more general (1). It was of interest to us that at least two steps are required to form mcm5U and mcm5s2U from the precursor U. These reactions include the addition of the sulfur atom, the formation of the carboxyl-methyl group on carbon-5, and the methyl esterification step performed by Trm9. It is not clear whether Trm9 can also perform some or all of the other steps mentioned above. The TRM9 gene product has been reported to be associated with four other gene products in a high-throughput pull-down screen (17). However, we show here that deletion mutants lacking one of three of these genes all show the same modification of mcm5U and mcm5s2U as the wild-type parent strain. It is possible that the fourth potentially interacting product, that of YNR046w, of which deletion proves lethal, is a subunit required for one or more of these steps. Nevertheless, YNR046w has no methyltransferase signature motifs and has not been associated with Trm9 in a two-hybrid screen (data not shown).
Our study has described the first enzyme that can catalyze the methyl esterification of a nucleobase, in this case mcm5U and mcm5s2U in yeast tRNA. In gram-negative bacteria, a structurally related methyl-esterified nucleobase, uridine 5-oxyacetic acid methyl ester (mcmo5U), containing an ether moiety is found in several tRNA species (21). A pathway for the biosynthesis of mcmo5U has been suggested in which hydroxylation of C-5 is followed by a methylation step and one or more reactions resulting in the addition of a carboxyl group (21). It is unclear whether the biosynthetic pathways of mcm5U and mcm5s2U may also involve a similar methylated precursor, in this case 5-methyluridine. Determination of the biosynthetic pathways may be complicated by specific structural requirements of the tRNA substrate as well (19). In any case, neither the gene nor the protein for the methyl esterification reaction has been identified in this bacterial system and we observe no prokaryotic homologs of the Trm9 protein.
We thank Darrell R. Davis (Department of Medicinal Chemistry, University of Utah) for his generous gifts of the modified nucleosides. We also thank Kym Faull and Joseph Loo for their insightful suggestions on mass spectrometry experiments.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»