Previous Article | Next Article ![]()
Molecular and Cellular Biology, February 2003, p. 1196-1208, Vol. 23, No. 4
0270-7306/03/$08.00+0 DOI: 10.1128/MCB.23.4.1196-1208.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Activity by 15-Deoxy-
12,14-Prostaglandin J2 Induces an Imbalance between Mitogen-Activated Protein Kinases and NF-
B That Promotes Apoptosis in Macrophages
Paqui G. Través,1 Paloma Martín-Sanz,1 Scott Parkinson,2 Peter J. Parker,2 and Lisardo Boscá1*
Instituto de Bioquímica (Centro Mixto CSIC-UCM), Facultad de Farmacia, and Centro Nacional de Investigaciones Cardiovasculares, 28040 Madrid, Spain,1 Protein Phosphorylation Laboratory, Cancer Research UK Lincoln's Inn Fields Laboratories, London WC2A 3PX, United Kingdom2
Received 8 May 2002/ Returned for modification 4 June 2002/ Accepted 21 November 2002
|
|
|---|
(PKC
) and Jun N-terminal kinase (JNK) through a phosphoinositide-3-kinase (PI3-kinase)-dependent pathway. Incubation of LPS-treated cells with the cyclopentenone 15-deoxy-
12,14-prostaglandin J2 (15dPGJ2) promoted a sustained activation of PKC
and JNK and inhibited I
B kinase (IKK) and NF-
B activity. Accordingly, 15dPGJ2 induced an imbalance between JNK and IKK activities by increasing the former signaling pathway and inhibiting the latter signaling pathway. Under these conditions, apoptosis was significantly enhanced; this response was very dependent on PKC
and JNK activation. The effect of 15dPGJ2 on PKC
activity observed in LPS-activated macrophages was not dependent on a direct action of this prostaglandin on the enzyme but was due to the activation of a step upstream of PI3-kinase. Moreover, LPS promoted the redistribution of activated PKC
from the cytosol to the nucleus, a process that was enhanced by treatment of the cells with 15dPGJ2 that favored a persistent and broader distribution of PKC
in the nucleus. These results indicate that 15dPGJ2 and other cyclopentenone prostaglandins, through the sustained activation of PKC
, might contribute significantly to the process of resolution of inflammation by promoting apoptosis of activated macrophages. |
|
|---|
Cyclopentenone prostaglandins (PGs) have been considered important contributors to the resolution of inflammation due to their role as anti-inflammatory mediators. PGA2, PGA1, and PGJ2 are derived from arachidonic acid metabolism, whereas 15-deoxy-
12,14-prostaglandin J2 (15dPGJ2) is formed by dehydration and subsequent modification of PGD2 (66). 15dPGJ2 is abundantly produced by mononuclear cells and has been proposed as an important immunoregulatory lipid mediator for a number of reasons. First, it can be detected at the nanomolar range in the resolution phase in a model of acute inflammation in rats (15, 29, 55). Second, 15dPGJ2 can repress the expression of most genes related to the onset of the inflammatory response in macrophages, such as nitric oxide synthase 2 (NOS-2), cyclooxygenase 2, tumor necrosis factor alpha (TNF-
), and gelatinase B (11, 37, 59, 60, 67). Third, this lipid metabolite promotes apoptosis in different cell types mainly through an increase in reactive oxygen species production (35, 46). In 1995, 15dPGJ2 was reported to be a high-affinity ligand for peroxysomal proliferator-activated receptor
(PPAR-
), and many of its effects have been attributed to the activation of this nuclear receptor (8, 25, 26). However, there is increasing evidence that 15dPGJ2 has many PPAR-
-independent effects (30). Indeed, the PGJ and PGA series have a characteristic
,ß-unsaturated carbonyl group that can modify accessible cysteine residues via Michael addition reactions (61, 66). This is the case for 15dPGJ2-mediated inhibition of I
B kinase 2 (IKK2) activity and the binding of nuclear factor
B (NF-
B) to specific DNA sequences reinforcing the view of 15dPGJ2 as a nuclear receptor-independent anti-inflammatory molecule (13, 61, 62, 67). Activation of NF-
B has been described as a key survival step through the expression of antiapoptotic genes of the Bcl-2 family and various members of the IAP family, which explains its capacity to inhibit caspase activation (3, 6, 75). In addition to this, it has been shown in cells treated with proinflammatory cytokines that inhibition of NF-
B leads to a sustained activation of Jun N-terminal kinase (JNK) that is involved in the apoptotic response through the expression of proapoptotic genes (21, 44, 71). However, in myeloid cells and in fibroblasts lacking NF-
B activity, the sustained activation of JNK in response to proinflammatory cytokines appears to exert an antiapoptotic effect, reinforcing the relevance of the cell type in the cross talk between pathways that regulate the survival and cell death balance (58).
Protein kinase C (PKC) was first identified as a phospholipid-dependent serine/threonine kinase (52), and members of the PKC family play crucial roles in controlling a broad array of cellular functions (48). Targeted disruption of several PKC genes has revealed an important contribution for some isotypes in the regulation of specific functions in cells of the immune system. Remarkably, macrophages from PKC
knockout mice show an attenuated inflammatory response after lipopolysaccharide (LPS) challenge (12); PKC
plays an important role in NF-
B activation in mature lymphocytes as deduced from mice lacking this gene (68), and PKC
mutant mice display impairment in NF-
B activation in response to TNF-
(45). In particular, PKC
has been reported to be involved in LPS signaling cascades in macrophages (56). For this reason, we decided to analyze the effects of cyclopentenone PGs on the activity and biological role of this enzyme (57). Here we show that in LPS-stimulated macrophages, 15dPGJ2 inhibits NF-
B but further activates PKC
because of an increase in the activity of the phosphoinositide-3-kinase (PI3-kinase)/phosphoinositide-dependent protein kinase 1 (PDK-1) pathway (18, 57). This increase in PKC
activity induced by 15dPGJ2 enhances the activities of JNK and extracellular regulated protein kinase (ERK), producing an imbalance between JNK/mitogen-activated protein kinase (MAPK) and NF-
B pathways that results in an intensification of apoptosis that contributes to the resolution of inflammation.
|
|
|---|
Cell culture.
RAW 264.7 cells were subcultured at 6 x 104 to 8 x 104/cm2 in RPMI 1640 medium supplemented with 2 mM glutamine, 10% fetal calf serum (FCS), and antibiotics (penicillin, streptomycin, and gentamicin [50 µg/ml each]). After 2 days in culture, the medium was replaced by RPMI 1640 medium containing 1% FCS, and cells were used in the next 24 h. PGs, rosiglitazone, a pharmacological agonist of PPAR-
, and inhibitors of protein kinases were added 20 min prior to activation with LPS.
Preparation of plasmids and transfection of cells.
The DH5
F' strain of Escherichia coli was transformed with the plasmids PKC
DN, PKC
DN, HA-PKC
DN, HA-PKC
/
, GFP-PKC
, PKC
-E410, PKC
-A410, GFP-JNK1 DN, GFP-JNK2 DN, and p110CAAX that have been described previously (18, 24, 43, 65, 73). After bacterial growth, the plasmids were purified using EndoFree Qiagen columns (Hilden, Germany) (11). For transfection, subconfluent RAW 264.7 cells were transfected for 6 h with FuGENE 6 and 1 µg of DNA per dish (2.5-cm diameter), except for the HA-tagged PKC isotypes (200 ng, unless stated otherwise), following the instructions of the supplier (Roche), and kept overnight with 2 ml of RPMI 1640 medium plus 10% FCS. When transfected, cells were selected by cell sorting, a green fluorescent protein (GFP) plasmid (in a 1:4 DNA ratio) was cotransfected. After the cells were detached with ice-cold phosphate-buffered saline (PBS), the GFP-positive population was collected in a cell sorter (5 x 105 to 7 x 105 cells), seeded at 2 x 105 cells per cm2, and stimulated as indicated in the figures. The AP-1-dependent luciferase reporter plasmid (2 µg/ml; AP-1-LUC) or the promoterless luciferase reporter vector (p-LUC) was cotransfected with 0.3 µg of the ß-galactosidase reporter vector per ml under control of the cytomegalovirus promoter (pCMV-ß-gal; Clontech, Palo Alto, Calif.) that was used as a control in transfection experiments. Luciferase and ß-galactosidase activities were measured using a commercial kit (Promega).
Preparation of cytosolic and nuclear extracts.
The macrophage layers (1.5 x 106 cells) were washed with ice-cold PBS, and cells were collected by centrifugation (11, 74). The cell pellets were homogenized in 100 µl of buffer A (10 mM HEPES [pH 7.9], 1 mM EDTA, 1 mM EGTA, 100 mM KCl, 1 mM dithiothreitol [DTT], 0.5 mM phenylmethylsulfonyl fluoride [PMSF], 2 µg of aprotinin per ml, 10 µg of leupeptin per ml, 2 µg of N
-p-tosyl-L-lysine chloromethyl ketone [TLCK] per ml, 5 mM NaF, 1 mM NaVO4, 10 mM Na2MoO4). After 10 min at 4°C, Nonidet P-40 was added (0.5%, vol/vol), and the tubes were gently vortexed for 15 s. Nuclei were collected by centrifugation at 8,000 x g for 15 min, and the supernatants were stored at -80°C (cytosolic extracts). To obtain nuclear protein extracts, the pellets were resuspended in 50-µl portions of buffer A supplemented with 20% glycerol and 0.4 M KCl, gently shaken for 30 min at 4°C, and centrifuged at 13,000 x g for 15 min. The supernatant was stored at -80°C (nuclear extracts). Protein content was assayed using the detergent-compatible Bio-Rad protein reagent.
EMSAs.
The sequence 5'TGCTAGGGGGATTTTCCCTCTCTCTGT3', corresponding to the distal NF-
B binding site (nucleotides -978 to -952) of the murine nitric oxide synthase 2 (NOS-2) promoter (77) was annealed with the complementary sequence and end labeled with Klenow enzyme fragment in the presence of 50 µCi of [
-32P]dCTP and the other three unlabeled deoxynucleoside triphosphates in a final volume of 50 µl (11). The DNA probe (5 x 104 dpm per assay) was incubated for 15 min at 4°C in a solution containing 3 µg of nuclear protein, 2 µg of poly(dI-dC), 5% glycerol, 1 mM EDTA, 100 mM KCl, 5 mM MgCl2, 1 mM DTT, and 10 mM Tris-HCl (pH 7.8) in a final volume of 20 µl. The DNA-protein complexes were separated on native 6% polyacrylamide gels in 0.5% Tris-borate-EDTA buffer (64). Supershift assays were performed after incubation (1 h at 4°C) of the nuclear extracts with 2 µg of Ab against the c-Rel proteins p50, c-Rel, and p65, followed by electrophoretic mobility shift assays (EMSAs) (not shown).
Characterization of proteins by Western blotting.
Cytosolic protein extracts were separated by size by sodium dodecyl sulfate-10% polyacrylamide gel electrophoresis (SDS-10% PAGE). The gels were blotted onto a Hybond-P membrane (Amersham) and incubated with the following Abs: rabbit antiserum directed against P-T410-PKC
(PKC
with the T410 residue phosphorylated) (previously described [43, 57]); anti-PKC
(an atypical PKC [aPKC] [sc-216], recognizing PKC
and PKC
/
, and the Ab specific for PKC
[sc-7262]); anti-PKC
/
(sc-11399), anti-I
B
(sc-371) and anti-IKK-1 (sc-7182) from Santa Cruz Biotechnology; anti-P-c-Jun and anti-p85
(PI3-kinase subunit) from Upstate Biotech; anti-P-S32-I
B
, anti-P-MAPKs and anti-MAPKs (New England Biolabs); and sheep anti-PDK-1 antiserum, a gift from D. R. Alessi (4). The blots were submitted to sequential reprobing with Abs after treatment with 100 mM ß-mercaptoethanol and 2% SDS in Tris-buffered saline, and heated at 60°C for 30 min. The blots were revealed by enhanced chemiluminescence following the manufacturer's instructions (Amersham).
Confocal microscopy.
RAW 264.7 cells were grown on coverslips and incubated for 30 min with the indicated stimuli. After the coverslips were washed twice with ice-cold PBS, the cells were fixed for 2 min with methanol at -20°C, blocked for 30 min at room temperature with 3% bovine serum albumin, and incubated for 30 min with anti-P-T410-PKC
Ab diluted 1:200. After the coverslips were washed with PBS, the cells were incubated with anti-rabbit immunoglobulin G (IgG) Ab (diluted 1:500) conjugated with Cy3 (Amersham). The cells were visualized using an MRC-1024 confocal microscope (Bio-Rad), and the fluorescence was measured using Laser-sharp software (Bio-Rad). Cells expressing GFP-PKC
were directly visualized in the confocal microscope.
Measurement of PKC
, IKK, and JNK activities.
Cells (107) were homogenized in 1 ml of buffer A and centrifuged for 10 min in a microcentrifuge. The supernatant was precleared, and PKC
and IKK were immunoprecipitated with 1 µg of specific Ab. After the immunoprecipitate was washed with 4 ml of buffer A, the pellet was resuspended in kinase buffer (20 mM HEPES [pH 7.4], 0.1 mM EDTA, 100 mM NaCl, 1 mM DTT, 0.5 mM PMSF, 2 µg of aprotinin per ml, 10 µg of leupeptin per ml, 2 µg of TLCK per ml, 5 mM NaF, 1 mM NaVO4, 10 mM Na2MoO4, 10 nM okadaic acid). Kinase activity was assayed in 100 µl of kinase buffer containing 100 ng of immunoprecipitated protein and 50 µM [
-32P]ATP (0.5 µCi), using myelin basic protein (MBP) as the substrate for PKC
and PKC
/
and using glutathione S-transferase (GST)-I
B
as the substrate for IKK. The reactions were stopped by adding 1 ml of ice-cold buffer A supplemented with 5 mM EDTA (11). JNK activity was measured in cell extracts after pulldown of JNKs with GST-c-Jun (amino acids 1 to 79) following a protocol described elsewhere (73). The kinase assay was performed in the presence of 20 µM ATP (0.3 µCi of [
-32P]ATP), and the phosphorylation of c-Jun was determined after SDS-PAGE and autoradiography.
Assay of PI3-kinase activity.
PI3-kinase activity was measured in the supernatants from cell extracts in buffer A after immunoprecipitation with anti-p85
Ab following the instructions of the supplier (Upstate Biotech). The activity of PI3-kinase present in the resuspended immunoprecipitate was determined using phosphatidylinositol (20 µg) and [
-32P]ATP (22). After thin-layer chromatography, the amount of phosphorylated lipids (PIP) was evaluated using a FUJI BAS1000 detector.
Measurement of DEVDase activity. Cell extracts were prepared in buffer A containing 0.5% Nonidet P-40. After centrifugation for 10 min in an Eppendorf centrifuge, DEVDase activity (corresponding mainly to caspases 3 and 7) was determined in the supernatant using N-acetyl-DEVD-7-amino-4-trifluoromethylcoumarin as the substrate and monitoring the fluorescence of the reaction product according to the instructions of the supplier (Calbiochem). The linearity of the caspase assay was determined over a 30-min reaction period (35).
Measurement of apoptosis by FACS analysis. Propidium iodide staining of apoptotic cells was performed following a previous protocol (34-36). Cells were resuspended in PBS and analyzed in a FACScan cytometer (Becton & Dickinson) equipped with a 25-mW argon laser. The percentage of apoptotic cells was assessed using a dot plot of the forward scatter against the propidium iodide fluorescence. Cell sorting and analysis of DNA integrity of viable and apoptotic populations were performed to confirm the gating criteria (35). The percentage of apoptotic cells after transfection with PKC plasmids was determined by including a pGFP vector at a 1:4 ratio and gating cells positive for GFP expression. When cells were transfected with GFP-JNK1 DN and GFP-JNK2 DN, a similar protocol was followed to evaluate apoptosis.
Data analysis. The number of experiments analyzed is indicated in the figures. Statistical differences (P < 0.05) between mean values were determined by one-way analysis of the variance followed by Student's t test. In experiments using X-ray films (Hyperfilm), different exposure times were employed to avoid saturation of the bands.
|
|
|---|
activation and inhibits IKK in macrophages challenged with LPS.
Treatment of RAW 264.7 cells with LPS resulted in the transient activation of PKC
as deduced by the phosphorylation of the T410 residue (18, 57) using a specific Ab (maximal effect observed at 15 min) (Fig. 1A and B). This activation can also be monitored by the phosphorylation of MBP in an in vitro assay using the immunoprecipitated enzyme (Fig. 1C). Incubation of cells with the cyclopentenone PG 15dPGJ2 increased the time span of LPS-dependent activation of PKC
for more than 30 min (Fig. 1A to C). The LPS-induced phosphorylation of the T410 activation loop, a domain conserved in aPKCs, was mainly due to PKC
modification, since it was observed only after immunoprecipitation of PKC
, but not when the cell extract was immunoprecipitated with a selective anti-PKC
/
Ab. Similar results were obtained when the enzyme activity was measured using MBP as the substrate (Fig. 1D). However, when cells were treated with 100 nM okadaic acid, a condition that favors the phosphorylation of T-410 by inhibiting protein phosphatase 2A activity, the anti-P-T410 PKC Ab recognized the phosphorylation of the activation loop in both aPKCs at the time that an increase in the catalytic activity was observed. In addition to this, when cells were transfected with tagged DN forms of PKC
and PKC
/
, the phosphorylation of T-410 was inhibited, making PKC
a more-efficient inhibitor than PKC
/
(Fig. 1E). Indeed, because both aPKCs have significant homology in the regulatory domains (24), overexpression of these DN forms abolished the phosphorylation of T410 in the activation loop, regardless of the aPKC isotype.
![]() View larger version (49K): [in a new window] |
FIG. 1. 15dPGJ2 increased PKC activation in response to LPS challenge of macrophages. RAW 264.7 cells were incubated for 20 min with 2 µM 15dPGJ2 or 100 nM okadaic acid before stimulation with 500 ng of LPS per ml as indicated above the blots. (A) The phosphorylation in T410 of PKC was analyzed by Western blotting. (B) Quantitative analysis of the band intensities (in arbitrary units [a.u.]) of P-T410-PKC (mean ± standard deviation; n = 4). (C) PKC was immunoprecipitated from cells treated for 15 and 30 min as indicated over the blot, and the activity was determined using MBP as the substrate. (D) The isotype specificity of the LPS-dependent phosphorylation in T410 was assessed after immunoprecipitation (IP) of PKC and PKC / with specific Abs and followed by Western blotting (WB) using the anti-P-T410-PKC Ab and the corresponding isotype-specific Abs; an aliquot of the immunoprecipitated aPKCs was used to determine its catalytic activity using MBP as the substrate. (E) Cells expressing HA-tagged PKC DN or PKC / DN were incubated for 20 min with LPS and 15dPGJ2, and the phosphorylation of the T410 motif of aPKCs was determined by Western blotting. The blots show the results of one representative experiment (of four experiments).
|
, macrophages were treated with this PG and with the noncylopentenone PGE2. As Fig. 2A shows, PGE2 was unable to increase the LPS-dependent phosphorylation at the T410 site of PKC
. The specific pharmacological PPAR-
agonist rosiglitazone also failed to increase PKC
activation and was used to differentiate the effects dependent on the cyclopentenone motif of 15dPGJ2 from those mediated through PPAR-
(Fig. 2B). In addition to this, the inhibitors of PI3-kinase wortmannin and LY294002 eliminated the LPS-dependent phosphorylation of T410 PKC
regardless of the treatment with 15dPGJ2 (Fig. 2B). Moreover, when PKC
was immunoprecipitated with a specific Ab, an enhancement in the band intensity of PDK-1 present in this fraction was observed in cells treated with 15dPGJ2, which suggests an association between PDK-1 and the activation of PKC
(Fig. 2C). To further determine the contribution of PI3-kinase to the activation of PKC
and the potentiation by 15dPGJ2, RAW 264.7 cells were transfected with p110CAAX plasmid to express constitutive PI3-kinase activity, and the phosphorylation of PKC
in T410 was analyzed. As Fig. 3A shows, after transfection with p110CAAX, PKC
was phosphorylated. This was not affected by 15dPGJ2 treatment but was significantly inhibited by wortmannin or LY294002, which suggests that PI3-kinase is necessary for PKC
activation in LPS-treated macrophages. To corroborate this point, the activity of PI3-kinase was measured in these cells. Incubation of macrophages with 15dPGJ2 increased p85-associated PI3-kinase activity; this was not a direct effect, since the activity of the PI3-kinase assayed in vitro was not influenced by the addition of 15dPGJ2 in the assay (Fig. 3B).
![]() View larger version (63K): [in a new window] |
FIG. 2. Effects of PGs on PKC phosphorylation and elimination of the activation by PI3-kinase inhibitors. (A and B) Macrophages were preincubated for 20 min with the PGs, the PPAR- agonist rosiglitazone (2 µM), and the inhibitors of PI3-kinase wortmannin (200 nM) and LY294002 (20 µM) followed by activation with 500 ng of LPS per ml. Cell extracts were prepared, and the phosphorylation of T410-PKC was determined by Western blotting. (C) Association of PDK-1 with activated PKC was analyzed after immunoprecipitation (IP) of cell extracts with anti-PKC Ab followed by Western blotting (WB) using specific anti-PDK-1 Ab ( -PDK1) and anti-P-T410-PKC Ab ( -T410-PKC ). Anti-PKC and anti-PDK-1 Abs were used to evaluate the PKC loads in the lanes of the Western blots and the amounts of PDK-1 in the cell extracts. Results are from one representative experiment (of three experiments).
|
![]() View larger version (41K): [in a new window] |
FIG. 3. 15dPGJ2 increased PKC activation through a PI3-kinase-dependent process. RAW 264.7 cells were transfected for 6 h with the p110CAAX plasmid and maintained in culture for 14 h. (A) The phosphorylation at T410 of PKC was determined after 30 min of incubation with 2 µM 15dPGJ2, 200 nM wortmannin, and 20 µM LY294002. The activity of PI3-kinase (in arbitrary units [a.u.]) was measured by the synthesis of PIP in immunocomplexes from cells treated for the indicated times with 15dPGJ2 and LPS. (B) Immunoprecipitated (IP) PI3-kinase from LPS-treated cells was incubated for 10 min with 2 µM 15dPGJ2 to evaluate the direct effect of this PG on enzyme activity. WB, Western blot; -p85 , anti-p85 Ab. Results are from one representative experiment (of three experiments) for panel A or are the means ± standard deviations for three experiments for panel B. Values that are significantly different from the value for the corresponding condition in the absence of 15dPGJ2 are indicated (P < 0.05 [*] and P < 0.01 [**]).
|
is not directly affected by 15dPGJ2.
To evaluate the possibility of a direct effect of 15dPGJ2 on PKC
phosphorylation and activity, cell extracts from LPS-activated macrophages were prepared and assayed in vitro in the presence of the PG. As Fig. 4A shows, samples obtained at 15 min exhibited enhanced activity (with MBP as the substrate) and an increase in T410 PKC
phosphorylation. However, the presence of 15dPGJ2 in the assay did not modify either parameter. Extracts prepared after 30 min of LPS treatment, when activation of PKC
is lost, failed to show an increase in activity after incubation with this PG. When these samples were analyzed after immunoprecipitation of the IKK complex, 15dPGJ2 inhibited IKK activity when GST-I
B
was the substrate. In addition, a biotinylated 15dPGJ2 derivative was unable to alkylate PKC
, whereas a clear biotinylated IKK2 band was observed as a control (Fig. 4B).
![]() View larger version (45K): [in a new window] |
FIG. 4. 15dPGJ2 does not activate PKC directly. (A) RAW 264.7 cells were treated with LPS (500 ng/ml) for 15 and 30 min. PKC and the IKK complex were immunoprecipitated, and the corresponding kinase activities were assayed in vitro in the absence (-) or presence (+) of 2 µM 15dPGJ2 using MBP (for PKC ) or GST-I B (for IKK) as the substrate. The levels of P-T410-PKC and P-S32-I B were determined by Western blotting. Results are from one representative experiment (of three experiments) for panel A. (B) To evaluate the ability of 15dPGJ2 to alkylate IKK2 and PKC , macrophages were challenged for 15 min with LPS and the extract was treated for 10 min with 15dPGJ2 or biotinylated-15dPGJ2. PKC and IKK2 were immunoprecipitated (IP) with specific Abs (anti-PKC [ -PKC ] and anti-IKK2 ] -IKK2]), and the corresponding Western blots (WB) were revealed with streptavidin-peroxidase (POD).
|
.
To identify targets of the sustained PKC
activation in macrophages treated with LPS and 15dPGJ2, the levels of p42 and p44 phosphorylated ERKs (P-ERKs) and p46 and p54 P-JNK were analyzed. As Fig. 5 shows, treatment of cells with PD98059 inhibited ERK phosphorylation as expected. Significant inhibition was observed in cells treated with Gö6983, an inhibitor of classical PKCs (cPKCs) and aPKCs, but not with Gö6850, which inhibits cPKCs, but not aPKCs (54). Incubation of cells with 15dPGJ2 notably increased the intensity of the ERK phosphorylation, and Gö6983 and wortmannin, but not the cPKC inhibitor Gö6850, abolished this effect. In the case of JNK, an increase in the phosphorylation state was observed after incubation of the cells with 15dPGJ2, and again, this was prevented by Gö6983 and wortmannin, but not by Gö6850. Interestingly, when the activation of NF-
B was measured under these conditions, both PKC inhibitors were unable to modify the binding activity, at least at this sampling time (30 min) and at 60 min (not shown). As expected from previous work (11, 62), because of the inhibition of IKK2 by 15dPGJ2, NF-
B binding was abolished by this PG. Interestingly, wortmannin, which inhibits PKC
activation, enhanced NF-
B binding as described previously (22). These data suggest that 15dPGJ2 inhibits NF-
B activity at the time that it potentiates ERK and JNK stimulation through a PKC
-dependent mechanism.
![]() View larger version (49K): [in a new window] |
FIG. 5. PKC -dependent activation of ERK and JNK in response to 15dPGJ2 in macrophages challenged with LPS. Cells were preincubated (20 min) with 2 µM 15dPGJ2 and treated for 30 min with 200 ng of LPS per ml. The phosphorylation levels of p42 and p44 ERKs and p46 and p54 P-JNKs were determined by Western blotting. The activation of NF- B was determined by EMSAs using the distal B motif of the murine NOS-2 promoter. The nature of the retained complexes was determined by supershift assays (not shown). The inhibitors PD98059 (50 µM), Gö6983 (200 nM), Gö6850 (1 µM), and wortmannin (200 nM) were added 20 min prior to LPS. Results are from one representative blot (of four blots).
|
on NF-
B activation in macrophages, a series of experiments were performed in view of the results from other groups (45) and the above data. Taking advantage of the observation that Gö6983 inhibits cPKCs at low concentrations (Ki = 6 to 10 nM) and aPKCs at higher concentrations (Ki = 60 nM) (54, 72, 76), we evaluated the effect of this inhibitor on NF-
B activity after 60 min of incubation of RAW 264.7 cells with LPS by EMSAs (see Discussion). As Fig. 6A shows, the binding of nuclear proteins to a
B motif was unaffected by this inhibitor. Moreover, when the activity of IKK from cells treated with LPS, Gö6983, and 15dPGJ2 was immunoprecipitated and assayed in vitro using GST-I
B
as the substrate, incubation with Gö6983 was unable to modulate IKK activity (cells treated from 0.06 to 1 µM), whereas 15dPGJ2 abolished this activity (Fig. 6B). In agreement with the previous data, the time course of I
B
phosphorylation in S32 measured using a specific antibody was also unaltered by incubation of cells with Gö6983 (Fig. 6C).
![]() View larger version (61K): [in a new window] |
FIG. 6. NF- B activity was inhibited by 15dPGJ2 in macrophages treated with LPS. (A) RAW 264.7 cells were preincubated for 20 min with 15dPGJ2 or the indicated concentrations of Gö6983. The NF- B binding was determined by EMSAs using protein nuclear extracts from cells activated for 60 min with LPS. (B) IKK activity was measured after immunoprecipitation (IP) of the IKK complex from cells treated for 20 min with the indicated molecules, using GST-I B as the substrate. WB, Western blotting; -IKK-1, anti-IKK1. (C) The levels of P-S32-I B and ß-actin were determined by Western blotting using specific Abs. Results are from one representative experiment (of three experiments).
|
in the nucleus.
Previous work described a translocation of PKC
from the cytosol to the nucleus upon cell activation (41, 51). Since the anti-P-T410 Ab preferentially recognizes the PKC
activation loop after LPS stimulation, we analyzed the subcellular distribution of the active isoenzyme in macrophages treated with LPS. As Fig. 7 shows, a time-dependent nuclear accumulation of P-T410-PKC
was observed and this process was notably enhanced in cells treated with 15dPGJ2. Using confocal microscopy to visualize the redistribution of P-T410-PKC
, the fluorescence corresponding to the activated protein was present in the nucleus 30 min after LPS challenge. This fluorescence exhibited an accumulation in specific nuclear domains, probably excluding the nucleoli. When activated cells were treated with 15dPGJ2, this nuclear distribution was more even and of higher intensity. In addition to the use of this Ab, cells were transfected with a GFP-PKC
expression vector, and the results of the distribution of the fluorescence in the nucleus were quite similar to those obtained with the anti-P-T410-PKC
Ab, indicating that the active protein accumulates transiently in the nucleus and that this process is enhanced by treatment with 15dPGJ2.
![]() View larger version (71K): [in a new window] |
FIG. 7. 15dPGJ2 increased PKC translocation to the nucleus in LPS-activated macrophages. Cells were incubated for the indicated times with LPS and 15dPGJ2 (2 µM). The levels of P-T410-PKC in the nucleus were determined by Western blotting using protein nuclear extracts and by confocal microscopy in fixed cells using a Cy3-labeled secondary Ab. Cells transfected with GFP-PKC were also used to visualize the subcellular distribution of the enzyme after cell challenge with LPS and 15dPGJ2.
|
is involved in the imbalance between JNK activation and NF-
B inhibition promoted by 15dPGJ2.
One phenomenological observation in LPS-activated macrophages treated with 15dPGJ2 was a marked increase in apoptosis observed at 24 h. To investigate the contribution of PKC
to this process, a pharmacological approach was used in which RAW 264.7 cells were incubated with LPS, 15dPGJ2, and Gö6983 (an inhibitor of cPKCs and aPKCs), Gö6850 (an inhibitor of cPKCs, but not aPKCs), and SP600125 (an inhibitor of JNKs [7, 32]). The specificity of these inhibitors was confirmed in in vitro assays (not shown). As Fig. 8A shows, caspase 3 activity (measured as DEVDase) increased notably in cells treated with LPS and 15dPGJ2. This caspase activation was prevented when the cells were incubated with Gö6983, but not with Gö6850, suggesting that an aPKC was involved in the process. Moreover, SP600125 also protected cells from LPS- and 15dPGJ2-induced activation of DEVDase, indicating that JNK was involved in caspase activation. In agreement with these data, when the percentage of apoptotic cells was determined after 24 h of culture, a good correlation with the activation of caspase 3 was observed. In view of the description of a sustained activation of JNK as a mechanism contributing to apoptosis (21, 71), we determined the levels of P-JNK under these conditions. As Fig. 8B shows, treatment of cells with LPS and 15dPGJ2 promoted a sustained activation of JNK. This response decreased in the presence of Gö6983, but not when the cPKC inhibitor Gö6850 was used. Moreover, the kinetic differences in JNK activation were confirmed in pulldown experiments using GSTJun as the substrate (Fig. 8C). To gain insight into the mechanism of PKC
-dependent JNK activation in response to LPS and 15dPGJ2 challenge of macrophages, cells were transfected with distinct PKC constructs. Expression of the DN forms of PKC
and PKC
as representatives of the cPKC and new PKC families did not inhibit JNK phosphorylation (Fig. 8D). Transfection with PKC
-A410, which corresponds to a DN form of the T-410 activation loop, impaired JNK activation compared with the vector or with the more active PKC
-E410 form, which mimics the presence of an active phosphorylated residue (Fig. 8D). Moreover, controlled transfection with the PKC
DN also impaired JNK phosphorylation, whereas transfection with PKC
/
did not significantly influence the phosphorylation of JNK. These constructs have a mutation in the catalytic domain, resulting in complete elimination of the endogenous activity and have been described previously (24). The specificity of SP600125 in JNK inhibition and the differences in activation in response to LPS and 15dPGJ2 were evaluated in cells transfected with an AP-1-LUC reporter vector. As Fig. 8E shows, SP600125 inhibited the expression of the luciferase gene, and the activity of this reporter was significantly higher in cells treated with LPS and 15dPGJ2. Moreover, the measurement of the phospho-c-Jun levels at 1 h after stimulation confirmed the ability of SP600125 to inhibit JNK activity in vivo.
![]() View larger version (42K): [in a new window] |
FIG. 8. Stimulation of PKC by 15dPGJ2 enhanced apoptosis in activated macrophages through a JNK-dependent pathway. (A) RAW 264.7 cells were pretreated (20 min) with 2 µM 15dPGJ2, 200 nM Gö6983, 1 µM Gö6850, or 20 µM SP600125 and activated with 500 ng of LPS per ml. DEVDase activity (in arbitrary units [a.u.]) and the percentage of apoptotic cells were determined after 6 and 24 h of treatment, respectively. (B) The activation of JNK was determined by Western blotting using an Ab that recognized the p46 and p54 P-JNKs. (C) The activity of JNK was determined after pulldown assay of the kinase from extracts of cells incubated with LPS and 15dPGJ2 for the times indicated and was assayed in vitro using GST-c-Jun (amino acids 1 to 79) as the substrate. (D) The effect of the expression of DN forms of PKC , PKC , and the T410 mutated PKC -E410 and PKC -A410 or the catalytically inactive PKC DN and PKC / DN (200 ng of DNA; see Fig. 1E) on JNK phosphorylation was determined after GFP-cotransfected cells were sorted. GFP-adherent cells were treated for 60 min with LPS and 15dPGJ2, and the levels of P-JNK were determined by Western blotting. (E) Cells transfected with an AP-1-LUC vector or the promoterless luciferase vector p-LUC (2 µg/ml) and cotransfected with 0.3 µg of the pCMV-ß-gal plasmid per ml were treated for 6 h with LPS, 15dPGJ2, and 20 µM SP600125, and the luciferase activity was measured and expressed with respect to ß-galactosidase. The phosphorylation of c-Jun was determined at 1 h in cell lysates. Results are the means ± standard deviations from three experiments. In panels A and E, values that were significantly different from those for the vehicle or p-LUC condition or a representative blot (n = 3) are indicated (P < 0.01 [*]).
|
and JNK to apoptosis in cells incubated with 15dPGJ2 were determined in cells cotransfected with a pGFP plasmid and a vector encoding a constitutively active PKC
(PKC
-E410) or a DN form of a PKC in a 1:4 DNA ratio (18, 43) or with the GFP-JNK1 DN and GFP-JNK2 DN vectors (73). As Fig. 9A shows, cells expressing the catalytically inactive PKC
-A410 form or the PKC
DN were significantly resistant to 15dPGJ2-induced apoptosis. However, cells expressing PKC
-E410 exhibited a higher basal apoptosis that was enhanced by 15dPGJ2 and in part prevented when PKC activity was inhibited with Gö6983. Cells expressing DN forms of PKC
, PKC
, and PKC
/
exhibited an important apoptotic rate that was prevented by incubation with Gö6983. Moreover, cells expressing the DN forms of JNK1 and JNK2 also exhibited protection against LPS- and 15dPGJ2-dependent apoptosis, particularly when both forms of JNK were coexpressed (Fig. 9B). In view of the relevance of JNK activation in this apoptotic response, macrophages were treated with LPS and 15dPGJ2, and the JNK inhibitor SP600125 was added at various times from 20 min prior to activation to 18 h after challenge (Fig. 9C). Protection from apoptosis was observed during the first 2 h after treatment with LPS and 15dPGJ2, which suggests that JNK-dependent apoptotic signaling occurs during this period.
![]() View larger version (25K): [in a new window] |
FIG. 9. Contribution of PKC and JNK to apoptosis in activated macrophages treated with 15dPGJ2. (A and B) Cells cotransfected with a GFP vector and the indicated PKC plasmids (A) or with GFP-JNK1 DN and GFP-JNK2 DN (B) were treated with the indicated stimuli, and the percentage of apoptotic cells was determined at 24 h by flow cytometry after gating for the GFP-positive cells. Results are means ± standard deviations from three experiments. Values that were significantly different from those for the LPS condition (P < 0.01 [*]) and for the corresponding LPS plus 15dPGJ2 condition (P < 0.01 [a]) are indicated. The insert in panel B shows the P-c-Jun levels 1 h after activation. (C) The time-dependent effect of the JNK inhibitor SP600125 (20 µM) on the induction of apoptosis by LPS and 15dPGJ2 was analyzed. The arrows indicate the time of SP600125 addition after activation. The 0-h point corresponds to the incubation with the inhibitor 20 min prior to activation. Apoptosis was measured at 24 h.
|
|
|
|---|
engagement and direct protein modification via Michael addition reactions (8, 16, 28, 37, 66, 67). Also, in human T cells and in THP-1 macrophages, 15dPGJ2 induces interleukin 8 (IL-8) production through an NF-
B- and MAPK-dependent mechanism suggesting that this PG may play different roles in the immune system (27, 33).
Looking for targets of this cyclopentenone PG, we observed that 15dPGJ2 prolonged the activation of PKC
in LPS-treated RAW 264.7 cells. Interestingly, PKC
was not activated directly by this PG and this enzyme was not a substrate for cyclopentenone PG modification, pointing to early LPS signaling steps as targets mediating the sustained activation of PKC
by 15dPGJ2. Moreover, this was a very specific response of PKC
, not shared by PKC
/
, and on further analysis, it involved in part steps upstream of PI3-kinase activation.
PKC
has been implicated in the control of many cell functions, including viability in various cell types (42, 48, 52), so we investigated whether this was the case in macrophages. Our data show that PKC
plays a relevant role in the sustained activation of JNK that follows 15dPGJ2 treatment of LPS-stimulated macrophages. Previous work demonstrated that JNK is transiently activated in macrophages treated with LPS (31, 56, 57). The signaling involves the Toll-like receptors 4 and 2 that activate NF-
B through the MyD88-IRAK-TRAF-6-IKK pathway (2, 38). Moreover, it has been reported that LPS activates JNK through a pathway that is mainly dependent on PI3-kinase and PKC
(57). We confirmed these results in RAW 264.7 cells and showed that the activation of PKC
in response to LPS was strictly dependent on PI3-kinase activation. In Bac-1 macrophages, where this pathway has been described in detail, this activation of PKC
stimulates phosphatidylcholine-dependent phospholipase C and acidic sphingomyelinase activities, which constitute the downstream steps responsible for JNK activation (57). In addition to this, it has been described in alveolar macrophages and in other cell types that PKC
is involved in the activation of ERKs (49, 63). Moreover, in vascular smooth muscle cells, PPAR-
ligands have been implicated in the activation of ERKs in a PI3-kinase-dependent manner. However, in that report higher concentrations of thiazolidinediones and 15dPGJ2 were necessary to activate the MAPK pathway (69).
In LPS-stimulated macrophages, the balance between cell activation and cell death is controlled by a strict regulation of several intracellular signaling cascades. LPS activates multiple protein kinases such as IKK, p38, p44/p42 ERKs, JNK, PI3-kinase and PKB/Akt that constitute key steps in determining the final macrophage fate (70). It has been extensively reported that activation of PI3-kinase triggers an antiapoptotic signaling cascade that involves the sequential activation of PDK1-Akt-mTOR. However, the relevance of Akt during the inflammatory response has not been fully elucidated and is a subject of intense research (53). In this regard, we were unable to detect Akt activation after LPS stimulation in RAW 264.7 cells, using the commercially available anti-phospho-Akt antibodies. Indeed, an absence of Akt phosphorylation after TNF-
stimulation has been reported (20), whereas other researchers have found that Akt is a part of the signaling pathway activated after gram-positive bacterial infection (2). Thus, it is not completely understood whether Akt is contributing to the control of cell viability in the inflammatory response to LPS.
Sustained activation of JNK has been associated with apoptotic signaling, specifically when the NF-
B pathway is inhibited (3, 6, 21, 71), and more recently, it has been reported that JNK promotes apoptosis through a Bax-dependent mechanism (44); however, it appears that JNK activity can also protect from apoptosis in other cases (58), reflecting the complexity of the cross-regulation between the JNK and NF-
B pathways. Because IKK is inhibited in the presence of 15dPGJ2 (11, 61, 62), the imbalance between IKK and JNK pathways might contribute to the observed apoptotic response. Indeed, when LPS-dependent NF-
B activation was inhibited with SN50, the percentage of apoptotic cells increased only up to 35% (not shown), whereas the apoptosis triggered by 15dPGJ2 reached ca. 70% of the cells under similar conditions, suggesting other specific effects mediated by this PG. A schematic representation of this signaling is shown in Fig. 10. Using pharmacological (with more or less specific inhibitors of PKC
and JNK), biochemical and genetic approaches and the correlation between the functional studies on caspase 3 activation and apoptosis on the one hand and the LPS/15dPGJ2-dependent inhibition of NF-
B and sustained activation of JNK in these cells on the other hand, our data suggest that PKC
is an important step in the control of apoptosis in RAW 264.7 macrophages under conditions of resolution of inflammation. PKC
has been implicated in the regulation of the survival or apoptosis switch through engagement of different targets (10, 39, 41, 50). The interaction of the regulatory domain of PKC
and other aPKCs with prostate apoptosis response 4 protein (Par-4) has been shown to impair apoptosis (5, 23), whereas the interaction with p62 has been suggested to recruit PKC
to the NF-
B complex and to impair apoptosis (14); however, the contribution of both proteins to apoptosis in RAW 264.7 cells remains to be established. In this regard, we have used several strategies to evaluate the ability of PKC
to modulate NF-
B and JNK activation in these cells. Although aPKCs exhibit a conserved homology in the catalytic domain, the regulatory regions are different, and our data suggest that PKC
is the main isotype of this family up-regulated by 15dPGJ2. Moreover, using Gö6983, the broad inhibitor of cPKCs and aPKCs, at concentrations higher than 100 nM were required to observe the inhibitory effects on JNK, whereas it was ineffective at concentrations in the range of the Ki value for cPKCs (20 nM [not shown]). It should be noted that kinetic parameters for kinase inhibitors are mainly deduced from in vitro studies in which the concentration of substrates, in particular ATP, are much lower than in the cell. However, this caution is overcome by other reports in which concentration-dependent effects, in the range of those used in this work, have been reported (54, 72, 76). In addition to this, DN forms of the activation loop of PKC
(T410A) or the catalytic domain (HA-PKC
DN), but not the DN forms of PKC
, PKC
and PKC
/
, prevented JNK activation and apoptosis. Moreover, pharmacological inhibition of JNK with SP600125 or transfection of cells with DN forms of JNK1 and JNK2 also inhibited apoptosis, suggesting that JNK accounts for most of the apoptotic response promoted by 15dPGJ2 in LPS-treated RAW 264.7 cells. An ancillary conclusion from the analysis with inhibitors is that PKC
appears not to be essential for the activation of NF-
B under conditions of LPS challenge of macrophages. In agreement with these data, it has been shown that in animals lacking PKC
NF-
B activation persists, although this depends on the cell type and stimulus used (42, 45). However, overexpression of PKC
(whether constitutively active or the native form) promotes NF-
B activation in macrophages through mechanisms not yet established (unpublished work).
![]() View larger version (18K): [in a new window] |
FIG. 10. Schematic diagram of 15dPGJ2-dependent imbalance between MAPK and NF- B pathways in activated macrophages. LPS activation of macrophages involves the engagement of several pathways that, in the absence of NO synthesis, maintain cell viability. Treatment with 15dPGJ2 promotes an imbalance between NF- B (which is inhibited) and JNK (which is overactivated), favoring an increase in apoptotic death. PKC plays an important role in the enhancement of JNK and ERK activation under these conditions. TLR, Toll-like receptors.
|
B pathways, we observed a persistent accumulation of P-T410-PKC
in the nucleus of activated cells, although the biological role of this translocation remains to be established. In agreement with this observation, a parallel distribution of GFP-PKC
confirmed the specificity of the translocation observed in these cells. Activation-dependent nuclear localization of PKC
has been described in other cell types, such as B lymphocytes and PC12 cells treated with nerve growth factor (41, 51), although the role of this process remains to be established in these cells.
Previous work indicated that 15dPGJ2 acted to increase synthesis of reactive oxygen and nitrogen species, in particular peroxynitrite, in macrophages treated with LPS and gamma interferon (IFN-
) (35). However, treating RAW 264.7 cells with LPS, at least at concentrations below 500 ng/ml, is not sufficient to induce NOS-2, and indeed, we were unable to observe significant synthesis of NO and peroxynitrite under these conditions. However, in the presence of IFN-
, a coordinate response exists between the distal
B and GAS/ISRE/IRF-1 sites of the murine NOS-2 promoter, allowing the expression of the NOS-2 gene (78) (this is not the case in elicited peritoneal macrophages, which express NOS-2 after LPS challenge even at the low doses used in this work). Therefore, the apoptotic effects observed in LPS-activated RAW 264.7 cells cannot be attributed to the synthesis of NO or peroxynitrite but rather appear to be dependent on the activation of PKC
. Interestingly, the pattern of PKC
activation observed in RAW 264.7 cells in response to 15dPGJ2 challenge was also observed in peritoneal macrophages from wild-type and NOS-2-deficient mice, indicating that this is a characteristic response of activated macrophages.
In conclusion, our data show that in the presence of 15dPGJ2, PKC
and JNK remain activated for longer periods of time, whereas the signaling through IKK/NF-
B is blocked. As a result of this dual action of the PG (mediated through PKC
), the apoptotic process is enhanced. Taken together, these data outline a novel 15dPGJ2-dependent apoptotic pathway in macrophages and suggest that this pathway may contribute to the resolution of inflammation when cyclopentenone PGs accumulate.
This work was supported in part by grants SAF2002-00783 from Comisión Interministerial de Ciencia y Tecnología and 08.3/0010/00 from Comunidad de Madrid.
Present address: Howard Hughes Medical Institute, Department of Pathology and Laboratory Medicine, University of California, Los Angeles, CA 90095-1662. ![]()
|
|
|---|
B activation requires a Rac1-dependent pathway. Nat. Immunol. 1:533-540.[CrossRef][Medline]
B. J. Clin. Investig. 107:241-246.[CrossRef][Medline]
B in preventing TNF-
-induced cell death. Science 274:782-784.
(PPAR-
) and its natural ligand 15-deoxy-
12, 14-prostaglandin J2 in the regulation of microglial functions. Eur. J. Neurosci. 12:2215-2223.[CrossRef][Medline]
12, 14-prostaglandin J2. J. Biol. Chem. 274:17042-17048.
B kinase and I
B phosphorylation by 15-deoxy-
12,14-prostaglandin J2 in activated murine macrophages. Mol. Cell. Biol. 20:1692-1698.
is required for macrophage activation and defense against bacterial infection. J. Exp. Med. 194:1231-1242.
12,14-prostaglandin J2 inhibition of NF-
B-DNA binding through covalent modification of the p50 subunit. J. Biol. Chem. 276:35530-35536.
and PAR-4 and antagonizes PAR-4-induced PKC
inhibition. FEBS Lett. 510:57-61.[CrossRef][Medline]
12,14-prostaglandin J2 induce proliferation of cyclooxygenase-depleted colorectal cancer cells. Cancer Res. 59:2739-2746.
and
induces apoptosis of human monocyte-derived macrophages. J. Biol. Chem. 273:25573-25580.
by PI 3-kinase and PDK-1. Curr. Biol. 8:1069-1077.[CrossRef][Medline]
12,14-prostaglandin J2-induced apoptosis in breast cancer cells. J. Biol. Chem. 276:47131-47135.
B downregulates pro-apoptotic JNK signalling. Nature 414:308-313.[CrossRef][Medline]
/
and stimulates its kinase activity in vitro and in vivo. Mol. Cell. Biol. 16:105-114.
12,14-prostaglandin J2 is a ligand for the adipocyte determination factor PPAR
. Cell 83:803-812.[CrossRef][Medline]
12,14-prostaglandin J2 (15d-PGJ2) in human THP-1 macrophages. Atherosclerosis 160:11-20.[CrossRef][Medline]
transcriptional regulation is involved in platelet-derived growth factor-induced proliferation of human hepatic stellate cells. Hepatology 31:101-108.[CrossRef][Medline]
agonists induce apoptosis in transformed, but not normal, human T lineage cells. Immunology 105:23-34.[CrossRef][Medline]
agonists inhibit production of monocyte inflammatory cytokines. Nature 391:82-86.[CrossRef][Medline]
B at the crossroads of life and death. Nat. Immunol. 3:221-227.[CrossRef][Medline]
12,14-PGJ2 induces synoviocyte apoptosis and suppresses adjuvant-induced arthritis in rats. J. Clin. Investig. 106:189-197.[Medline]
. Eur. J. Immunol. 32:136-143.[CrossRef][Medline]
B kinase ß by protein kinase C isoforms. Mol. Cell. Biol. 19:2180-2188.
PKC gene results in the impairment of the NF-
B pathway. Mol. Cell 8:771-780.[CrossRef][Medline]
12,14-prostaglandin J2 induces apoptosis of human hepatic myofibroblasts. A pathway involving oxidative stress independently of peroxisome-proliferator-activated receptors. J. Biol. Chem. 276:38152-38158.
protects human leukemia cells against drug-induced apoptosis. J. Biol. Chem. 272:27521-27524.
translocation to the nucleus of NGF-treated PC12 cells. FASEB J. 13:2299-2310.
B activation by tumour necrosis factor requires the Akt serine-threonine kinase. Nature 401:82-85.[CrossRef][Medline]
12,14-prostaglandin J2. Proc. Natl. Acad. Sci. USA 96:4668-4673.
and phosphatidylcholine-dependent phospholipase C. Blood 96:2592-2598.
B suppresses the sustained, antiapoptotic activity of Jun kinase induced by tumor necrosis factor. Mol. Cell. Biol. 22:8175-8183.
) as a regulator of monocyte/macrophage function. J. Leukoc. Biol. 66:733-739.[Abstract]
is a negative regulator of macrophage activation. Nature 391:79-82.[CrossRef][Medline]
B by prostaglandin A1: an effect associated with heat shock transcription factor activation. Proc. Natl. Acad. Sci. USA 94:746-750.
B kinase. Nature 403:103-108.[CrossRef][Medline]
by mechanisms that are both dependent and independent of phosphorylation of activation loop (T410) and autophosphorylation (T560) sites. Biochemistry 40:249-255.[CrossRef][Medline]
12,14-prostaglandin J2 inhibits multiple steps in the NF-
B signaling pathway. Proc. Natl. Acad. Sci. USA 97:4844-4849.
is required for TCR-induced NF-
B activation in mature but not immature T lymphocytes. Nature 404:402-407.[CrossRef][Medline]
12,14-prostaglandin J2 and thiazolidinediones activate the MEK/ERK pathway through phosphatidylinositol 3-kinase in vascular smooth muscle cells. J. Biol. Chem. 276:48950-48955.
B target genes. Nature 414:313-317.[CrossRef][Medline]
-induced apoptosis in rat fetal brown adipocytes. Endocrinology 141:4383-4395.
Bß and abrogation of NF-
B activity in peritoneal macrophages stimulated with lipopolysaccharide. J. Biol. Chem. 272:23025-23030.
B antiapoptosis: induction of TRAF1 and TRAF2 and c-IAP1 and c-IAP2 to suppress caspase-8 activation. Science 281:1680-1683.
and bacterial lipopolysaccharide. J. Exp. Med. 177:1779-1784.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»