Previous Article | Next Article ![]()
Molecular and Cellular Biology, March 2003, p. 1633-1646, Vol. 23, No. 5
0270-7306/03/$08.00+0 DOI: 10.1128/MCB.23.5.1633-1646.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
at the Plasma Membrane
Division of Endocrinology, Veterans Affairs Medical Center, Long Beach, Long Beach, California 90822,1 Departments of Medicine,2 Pharmacology, University of California, Irvine, Irvine, California 92717,5 Signal Pharmaceuticals Inc., San Diego, California 92121,3 Diabetes and Metabolic Research Unit at the University of California, San Francisco, San Francisco, California 941434
Received 19 July 2002/ Returned for modification 29 August 2002/ Accepted 6 December 2002
|
|
|---|
protein. Based on this, we substituted alanine for the determined serine at amino acid 522 within the E domain of wild-type (wt) ER
. Upon transfection in CHO cells, the S522A mutant ER
resulted in a 62% decrease in membrane receptor number and reduced colocalization with caveolin 1 relative to those with expression of wt ER
. E2 was significantly less effective in stimulating multiple rapid signals from the membranes of CHO cells expressing ER
S522A than from those of CHO cells expressing wt ER
. In contrast, nuclear receptor expression and transcriptional function were very similar. The S522A mutant was also 60% less effective than wt ER
in binding caveolin 1, which facilitates ER transport to the PM. All functions of ER
mutants with other S-to-A substitutions were comparable to those of wt ER, and deletion of the A/B or C domain had little consequence for membrane localization or function. Transfection of ER
S522A into breast cancer cells that express native ER downregulated E2 binding at the membrane, signaling to ERK, and G1/S cell cycle events and progression. However, there was no effect on the E2 transactivation of an ERE-luciferase reporter. In summary, serine 522 is necessary for the efficient translocation and function of ER
at the PM. The S522A mutant also serves as a dominant-negative construct, identifying important functions of E2 that originate from activating PM ER. |
|
|---|
Although the exact sequence of this receptor has not been reported, the membrane ER appears to be very similar, and perhaps identical, to the nuclear receptor. This is based upon the identification of similarly sized nuclear and membrane ER proteins that result from the expression of a single cDNA (and resulting single mRNA) in CHO cells (32). Also, membrane ER have been localized on vascular smooth muscle, pituitary, and endothelial cells that express endogenous receptors, by using antibodies raised against multiple epitopes of the nuclear ER
(25, 26, 36). However, many questions remain concerning this relatively small population of ER at the cell surface.
The membrane ER has been reported to be G protein linked (32, 50), and E2 binding can activate many signal transduction pathways that emanate from G protein activation. These include kinase and endothelial nitric oxide synthase activation, cyclic AMP (cAMP) and inositol phosphate (IP) generation, and phospholipase C (PLC) stimulation (4, 16, 18, 24, 50). Linkage to G proteins may be direct, as shown in transfected CHO cells expressing ER
or ERß (32) or in endothelial cells (50), but it has also been reported that E2 activates an orphan G protein-coupled receptor (10). Furthermore, it is not clear whether this receptor spans the cell membrane or is predominately localized within or associated with the membrane bilayer. Membrane ER have recently been shown to exist in discrete caveolar domains of the PM (6, 13). It has recently been found that membrane ER
can physically associate with the caveolar structural coat proteins caveolin 1 and caveolin 2 (31). Caveolin proteins serve as scaffolds, bringing together various signaling molecules within a discrete area of the PM to regulate cytokine-induced signal transduction (3, 27). These include G proteins, nonreceptor and receptor tyrosine kinases (Src, EGFR), and threonine-serine kinases, such as phosphatidylinositol 3-kinase (PI 3-kinase) and Raf. Organization of signaling molecules within a confined space potentially allows E2-ER to modulate a variety of signaling cascades in target cells.
Signal transduction via the membrane ER has increasingly been found to be important for the cell biological effects of this steroid, including the survival and/or growth of breast cancer, bone, and neural cells (5, 7, 14, 24, 34, 49). This receptor has also been implicated in prevention of the inflammatory response to muscle ischemia-reperfusion injury (40), maintenance of the endothelial cell cytoskeleton, and upregulation of vascular cell migration and angiogenesis (33). E2 stimulation of transcription can also be signal dependent, as stimulation of the mitogen-activated protein (MAP) kinase ERK (extracellular regulated kinase) has been shown to be important for transactivation of the c-fos and prolactin genes (9, 45, 46). Transcription in response to E2 generation of cAMP has also been reported (4). The precise structural features of ER that facilitate the translocation of this steroid binding protein to the membrane are not known, but such information is important for understanding of the details of estrogen action at the cell surface.
The studies reported here result from our attempt to understand the localization and function of this protein at the PM. To begin this, we partially determined the amino acid structure of the mouse membrane ER
, isolated from CHO cells transfected to express this protein. We identified a serine residue at 522 that is necessary for the optimal localization and function of the sex steroid receptor at the cell surface. In contrast, mutation of this serine had no effect on nuclear ER number, affinity for E2, or E2-induced transactivation function. We also report that expression of the S522A mutant ER
resulted in a dominant-negative action only at the membrane, in cells expressing wild-type (wt) ER
. This mutant abolished several important effects of E2 in breast cancer and can be used as a reagent to deduce the cellular actions of E2 originating from membrane ER
.
|
|
|---|
, as previously described (32). This resulted in the expression of both nuclear and membrane receptors. Twenty plates of ER
-transfected CHO cells were scraped and pelleted at 1,000 x g, and pellets were resuspended in 20 mM Tris with 1 mM EDTA, 1 mM dithiothreitol, and protease inhibitors. Cells were then centrifuged at 4°C and 8,000 x g for collection of nuclear receptors, and the supernatant was then ultracentrifuged at 4°C and 100,000 x g for 1 h. The pellet (membranes) was washed and ultracentrifuged again, and membranes were then further separated by sucrose gradient overlay; fractions 3 to 5 contained the buoyant membranes (with caveolae and rafts) that were pooled for all experiments (31). Briefly, membrane samples were first placed in a tube with an equal volume of a solution containing 85% (wt/vol) sucrose, 25 mM A-morpholine-ethanesulfonic acid, and 0.15 M NaCl and were then overlaid with 8.5 ml of 35% sucrose, topped up with 16% sucrose, and centrifuged at 35,000 rpm (105,000 x g) for 18 h at 4°C. Ten fractions (1 ml each) were obtained and either further processed or separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by membrane transfer for immunoblotting. The membrane receptors were solubilized in binding buffer (Pierce) containing 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS; Sigma). The purity of the membranes was confirmed by positive immunoblotting for 5'-nucleotidase and caveolin 1 (membrane proteins) and by the lack of detection of transportin and NTF-2 (nuclear proteins) or ß-coatomer protein (endosomal/Golgi protein) (38). This was followed by affinity column purification. Briefly, protein G bound to an antibody against ER
(H222) (11) was cross-linked with disuccinimidyl suberate to make the column. The ER
-containing membrane or nuclear protein was eluted by using proprietary buffers and a proprietary protocol (Pierce). The eluted receptor proteins were dialyzed or concentrated and then analyzed by SDS-PAGE after being run on a 7.5% gel followed by staining. The gel protein bands corresponding to 67 kDa were cut out, trypsin was extracted from the gel, and the bands were then subjected to peptide degradation-mass spectrometry, as previously described (2, 12). This generated peptide sequences from the membrane and nuclear proteins, and these were compared to the known sequences of the classical mouse nuclear ER
.
Site directed mutagenesis and targeting of mouse ER
.
We carried out tryptic peptide matrix-assisted laser desorption ionization (MALDI)-mass spectrometry "sequencing," as described above. At present this has yielded membrane peptide sequences that identically overlap with 20% of the known nuclear receptor and with 20% of our expressed nuclear receptor, supporting the idea that the two receptors are the same (G. Alton, M. Razandi, A. Pedram, and E. Levin, unpublished data). We identified an overlap sequence from amino acid 508 to amino acid 524 that includes a serine at 522. With surrounding residues, this was identified by computer analysis as a potential (although not a classic) palmitoylation site (HMSN). This sequence is present as amino acids 517 to 520 of the human receptor as well. We then mutated the serine at 522 to alanine in mouse pcDNA3-ER
by PCR using the forward primer 5'-CGGCACATGGCTAACAAAGG-3'. As specificity controls, we also mutated the identified serine residues 10 and 582 to alanine by using the forward primers 5'-CCCTTCACACCAAAGCCGCGGGAATGGCCTTGCTGC-3' and 5'-GCTCCACTTCAGCACATGCCTTACAAACCTACTAC-3', respectively. All mutations were confirmed by sequencing at the University of CaliforniaIrvine sequencing facility. We additionally subcloned the receptors into a green fluorescent protein (GFP) vector, pEGFPc2 (Clontech, Palo Alto, Calif.), and a multicopy histidine-expressing vector to monitor transfection efficiencies. wt and mutant receptor expression plasmids were then used in studies. To generate nuclear and membrane wt ER
constructs, pcDNA3-mouse ER
was used as a template. Twenty-five cycles of PCR (annealing temperature, 55°C) were performed by utilizing the forward primer 5'GCCGCTAGCACCATGACCATGACCCTTCAC3' and the lower primer 5'GCCACCGGTCTGATCGTGTTGGGGAAGCCC3'. The PCR product was ligated into pCR2.1 by using the TA cloning kit (Invitrogen, Carlsbad, Calif.) and digested with AgeI and NheI. This fragment was subcloned into AgeI and NheI sites on the pECFP-Nuc and pECFP-mem vectors (Clontech), yielding ER constructs that were predominantly targeted to either the membrane or the nucleus (confirmed by binding and functional studies).
Receptor binding and cell localization studies.
wt and mutant ER
were expressed in CHO cells, and nuclear and membrane fractions were isolated as detailed above and were used for competitive binding assays or signal transduction studies, as previously described (31, 32). Binding studies were repeated at least three times, and the data were used for Scatchard analysis with the LIGAND computer program. Results were combined for statistical comparison by analysis of variance plus Schefe's test. Additional ER
mutants (HE11G, with the A/B domain deleted; HE19G, with the C domain deleted; and HEG0-537, with helix 12 and the F domain deleted) were provided by Paul Webb and expressed in CHO cells.
For cell localization of wt or S522A mutant ER
, we transiently expressed GFP-tagged fusion proteins for each receptor in CHO cells. CHO cells were grown and transfected on coverslips, and localization of the receptors was examined by laser-scanning confocal microscopy. We also colocalized the receptors at the membrane with endogenous caveolin 1 by using an antibody to this protein (Zymed Laboratories, South San Francisco, Calif.). Each section was processed for GFP-ER
(green), caveolin 1 (second antibody conjugated to Texas red), and colocalized caveolin 1 and ER
(yellow).
Signaling studies.
Adenylate cyclase activity in the membrane was determined by measuring cAMP generation, by methods described previously (32), in CHO-K1 cells expressing wt or S522A mutant ER
after the cells had been incubated for 5 min with 10 nM E2. IP generation and ERK (MAP kinase) activation in the CHO cells were also determined as described in detail elsewhere (32). Activation by E2 of an ERE-luciferase reporter in ER-transfected CHO or MCF-7 cells was assessed at 8 h of exposure to 10 nM E2, as previously published (32). Membranes were isolated by sucrose gradient centrifugation (31).
Myristylation, palmitoylation, and PI-PLC studies in CHO-K1 cells.
Cells were grown on 100-mm-diameter petri dishes in Dulbecco's modified Eagle medium (DMEM)-F12 medium without phenol red. Twenty-four hours after transfection with ER
, the cells were synchronized overnight and then labeled with [3H]palmitic acid (0.5 µCi/ml) or [3H]myristic acid (0.2 µCi/ml) for 2 h. The cells were incubated for 8 h in the presence or absence of 10 nM 17ß-E2, washed with cold phosphate-buffered saline, and then lysed in buffer A (50 mM Tris-HCl [pH 7.5], 5 mM EDTA, 100 mM NaCl, 50 mM NaF, 100 µM phenylmethylsulfonyl fluoride, protease inhibitor cocktail, and 0.2% Triton X-100). Nuclear pellets were collected by low-speed centrifugation. Supernatants were centrifuged at 100,000 x g for 30 min to pellet cell membranes. Both pellets were washed twice, once with buffer A and once without detergent. Membranes were further purified by sucrose gradient centrifugation. Membrane and nuclear fractions were denatured in SDS loading buffer followed by gel electrophoresis, fluorography, and autoradiography. For phosphoinositol (PI)-PLC studies, the cells were incubated with 1 U of PI-PLC (Sigma)/ml for 1 h. Cells were washed and lysed, and the membrane and nuclear fractions were collected. Specific, total binding studies were then carried out on 50 µl of nuclear or membrane protein, incubated in DMEM-F12 medium (with no phenol red), bacitracin (1 mg/ml), and 0.5% bovine serum albumin, and with 3H-labeled E2 and unlabeled E2 (10-11 to 10-7 M).
Cyclin D1 protein expression, thymidine incorporation, and kinase activity.
MCF-7 cells were transfected with pcDNA3 (control) or ER
S522A, recovered, then synchronized by serum deprivation for 24 h, and then incubated in the presence or absence of 10 nM E2 for 8 h. In some cells, the soluble MEK inhibitor PD98059 (10 µM) was added to the incubation mixture 30 min prior to the steroid. The cells were then lysed, precleared, boiled, denatured in SDS reducing buffer, and electrophoretically resolved by PAGE. Western immunoblotting was then carried out using a polyclonal antibody (Santa Cruz). Nuclear thymidine incorporation was carried out in nontransfected or transfected MCF-7 cells after synchronization overnight in serum-free medium. All cells were then incubated for 20 h in the absence or presence of 10 nM 17ß-E2. In some conditions, the MEK inhibitor PD 98059 (10 µM) was added prior to the steroid. After 20 h, 0.5 µCi of [3H]thymidine was added for 4 more h, as previously described (32). Cells were then washed and incubated for 10 min with 10% trichloroacetic acid at 4°C, followed by additional washes. Cells were lysed with 0.2 N NaOH overnight, and lysates were counted in a liquid scintillation ß-counter. For cdk4 activity, MCF-7 cells transfected with pcDNA3 (control) or ER
S522A were incubated with E2 for 6 h and then lysed. The cell lysate was added to a protein A-Sepharose-conjugated cdk4 antibody (Santa Cruz) and then added to in vitro kinase activity tubes containing GST-pRB as a substrate, as previously described (28). This was followed by SDS-PAGE separation and autoradiography. Samples from each condition were assessed for protein loading equivalence, where cdk4 protein was assayed by immunoblotting. For ERK activity assays, transfected or nontransfected CHO, MCF-7, or ZR-75-1 cells were synchronized for 24 h in serum, phenol red, and growth factor-free medium. The cells were then exposed to E2 (10 nM) for 8 min with or without additional substances, and kinase activity was determined by using myelin basic protein (MBP) for the substrate, as previously described (32, 34). For p38ß activity, the cells were incubated with E2 (10 nM) for 20 min and then lysed, and the lysate was immunoprecipitated with protein A-Sepharose conjugated to an antiserum for p38ß. Immunoprecipitated kinases were then added to the protein ATF-1 for in vitro kinase assays as previously described (33). All experiments were repeated two to three times.
Protein and ER association studies.
Cytosolic fractions of CHO-wt ER
or CHO-ER
S522A were incubated with protein A-Sepharose for 1 h, and supernatants were transferred to fresh tubes containing protein A-Sepharose conjugated to caveolin 1 or ER
antibodies and were incubated for 4 h at 4°C. Immune complexes were washed, boiled, and then separated by SDS-PAGE. After transfer to nitrocellulose filters, the nonspecific proteins were blocked with blocking solution (Bio-Rad) and incubated first with a primary antibody to ER
or caveolin 1 for 2 h and then with a second antibody (Santa Cruz Biotechnology). Bound immunoglobulin G's (IgGs) were visualized using ECL reagents (Amersham) and autoradiography. Portions of the immunoprecipitated ER
or caveolin 1 were immunoblotted for evidence of equal protein loading and equal expression of total ER with the two constructs. In additional studies, MCF-7 cells were transfected to express a GFP-ER
S522A protein or GFP alone. After overnight recovery, the cells were lysed and immunoprecipitated with an antibody to GFP, followed by immunoblotting with antibodies to Src, Ras, and Raf proteins (Santa Cruz). In CHO cells, His-wt ER
or GFP-ER
S522A was singly or doubly expressed. To detect homo- or heterodimerization in these cells, the lysate was immunoprecipitated with an antibody to His, followed by blotting with an antibody to GFP, or in reverse order. All studies were repeated at least three times.
|
|
|---|
binding after expression in CHO cells.
We first isolated the mouse ER
in the PM after expression in CHO cells and partially sequenced the protein by peptide degradation-MALDI mass spectroscopy (Razandi et al., unpublished). We identified a peptide (LAQLLLILSHIRHMSNK) that corresponds to a portion of the C terminus in the known mouse ER
sequence (2), beginning with amino acid 508. Furthermore, HMS (boldfaced in peptide sequence) was noted by computer modeling as a possible, but not classic, palmitoylation site (35). We therefore asked whether the ER was palmitoylated at this site (see below), and we also mutated the critical serine at amino acid position 522 to alanine within the mouse ER
cDNA. Additional S-to-A mutations at residues 10 and 582 were created by site-directed mutagenesis, for comparison to mouse ER
S522A (48) and to support the specificity of any findings.
We then expressed the wt and S522A mutant ER
constructs in CHO cells and carried out competitive binding studies in both nuclear and membrane compartments. By Scatchard analysis of the binding data (Fig. 1A), we found that the receptor affinity for E2 (Kd) and the receptor number (Bmax) were very similar for the two ER
receptors in the nucleus (Table 1). Similar transfection efficiencies were demonstrated using GFP fusion constructs (data not shown). We also determined whether the function of the mutant nuclear ER
differed from that of the wt. We therefore cotransfected CHO cells with either wt or S522A mutant ER
and an ERE-luciferase reporter (32) and determined the response to E2. We found that the two receptors were comparably capable of responding to E2 with an upregulation of reporter activity (Fig. 1B). These data indicate that the replacement of S with A at residue 522 does not affect the quantity of nuclear receptor localization, its binding affinity for E2, or the transcriptional response to the steroid.
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() View larger version (231K): [in a new window] |
FIG. 1. (A) Competition binding of 17ß-[3H]E2 to nuclear wt (left) or S522A mutant (right) ER transfected into CHO-K1 cells. (Inset) Binding to cell membrane ER . Data are transformed for Scatchard analysis by using the LIGAND program. Data shown here are from a representative study; results from three separate experiments were combined to create Table 1. (B) Transactivation of an ERE-luciferase reporter construct coexpressed in CHO cells with mouse wt ER or the S522A mutant. Data were determined at 6 h after incubation with either 1 nM E2, 10 nM E2, or no steroid. *, P < 0.05 for the wt or the S522A mutant alone versus the same construct plus E2 (for data combined from three experiments). (C) Serine/threonine residues in the full-length receptor, but not serine 522 in the E domain of ER , are phosphorylated. Western blotting utilized a specific antibody to serine/threonine residues (Sigma) from lysates of CHO cells transfected to express either the full-length receptor or the E domain targeted to the PM or the nucleus. (D) Membrane localization of GFP-tagged wt ER or S522A mutant ER expressed in CHO cells. Arrows indicate a greater membrane localization for wt ER . Dense nuclear populations for both receptors are seen. (E) Colocalization of wt ER with caveolin 1 at the membrane, but markedly less colocalization of ER S522A. Results of a representative study are shown. Arrows indicate differential ER expression (green) at the membrane (panels A and D) and equal caveolin 1 expression (red) (panels B and E). The strong colocalization of wt ER and caveolin 1 (yellow) (arrow, panel C) is not seen for ER S522A (arrow, panel F). (F) Total specific binding of labeled E2 to membranes (left) or nuclei (center) in CHO cells expressing either S10A, S582A, or S522A mutant ER or wt ER . Data are combined from three experiments. *, P < 0.05 for ER S522A versus wt ER or other S-to-A mutant receptors. (Right) Protein blot demonstrating the purity of the membrane preparation. Caveolin 1 (Cav1) and 5' nucleotidase (5'NT) are integral membrane proteins, while transportin and NTF-2 are nuclear proteins. ß-COP is a Golgi protein.
|
|
View this table: [in a new window] |
TABLE 1. Binding characteristics of wt or S522A mutant mouse ER expressed in the nuclei and membranes of CHO-K1 cells
|
resulted in 62% fewer receptors (Bmax) in the PM than expression of wt ER
(Fig. 1A insets; Table 1). This was found in three separate binding experiments, where the reduction ranged from 57 to 65%. The binding affinities (Kd) for E2 at the membrane were comparable for wt and mutant receptors. Thus, serine 522 is an important determinant for full membrane localization of ER
.
It is possible that serine 522 is a phosphorylation site, although this would not be a common mechanism for membrane localization. By mass spectroscopy, there was no evidence of phosphorylation on this residue. We also expressed the full-length wt ER, the S522A mutant, or the E domain (ligand binding domain) of wt ER
in CHO cells, targeting the E domain to both nuclear and membrane locations. As seen in Fig. 1C, the entire receptor is phosphorylated at serine/threonine residues, but we find no evidence that the intact E domain is similarly phosphorylated, either when targeted to the membrane or when targeted to the nucleus.
To visualize the receptor at the membrane, we expressed GFP-tagged wt or S522A mutant ER
in CHO cells and detected membrane localization by confocal microscopy. As seen in Fig. 1D, wt receptor expression clearly reveals a population of membrane-localized sex steroid binding proteins, while the mutant receptor does not. Both show a dense nuclear population. We also examined colocalization of the wt or mutant ER
at the membrane with caveolin 1. In Fig. 1E, wt ER
was clearly seen at the membrane (arrow, panel A), in contrast to sparse membrane expression of ER
S522A (panel D). Caveolin 1 was clearly visualized at the membrane (Fig. 1E, panels B and E). Colocalization of membrane wt ER
with caveolin 1 (Fig. 1E, panel C, arrow) was also seen for the S522A receptor (panel F), but the latter showed decreased amounts colocalized, reflecting a decreased number of receptors at the membrane.
We next compared the binding of wt or S522A mouse ER
to that of S10A and S582A ER
constructs expressed in CHO cells (Fig. 1F). Total specific binding of E2 was determined in the nucleus and PM and revealed that both of the two additional mutant receptors were very similar to the wt receptor in both compartments. By comparison, S522A expression again exhibited significantly lower binding at the membrane only. These data indicate the specificity of S522 for ER localization at the cell surface.
Dissection of the contribution of other domains of ER
to membrane localization and function.
It is possible that elements contained within other domains of ER
contribute importantly to membrane localization. In this respect, Schlegel et al. (37) have recently shown that residues 1 to 282 (the A/B and C domains) of human ER
bind to caveolin 1, a largely membrane localized protein that facilitates membrane localization of ER (31) and that, when overexpressed, promotes nuclear ER localization and transcriptional action. We therefore asked whether mutant ER
that lacked either the A/B or the C domain was capable of localizing to the PM and signaling to ERK. We compared the effects of CHO cells expressing these deletion or truncation mutants to those of CHO cells expressing wt ER
. We found that HE11G (with the A/B domain deleted) and H19G (with the C domain deleted) were comparable to wt ER
, both in specific binding of E2 at the cell membrane and in ERK activation by the steroid (Fig. 2). In contrast, a mutant with helix 12 and the F domain deleted, HEG0-537 (truncated at residue 537), specifically bound little E2 in either the nuclear or the membrane compartment and did not support E2 activation of ERK. Thus, the A/B and C domains do not contribute to membrane ER localization and signaling by E2. However, deleting a small but important region within the E domain (in conjunction with loss of the F domain) has a profound effect on E2 binding to any ER pool, as well as on membrane function. Further understanding of the specific residues within the E domain that are required for ER localization at the membrane will require the characterization of a very extensive series of conservative mutations within this region. These results support a focus on the E domain for further understanding of the compartmentalization of ER.
![]() View larger version (22K): [in a new window] |
FIG. 2. (A) Binding of E2 to the nuclei and membranes of CHO cells expressing either HE11G (A/B domain deleted), HE19G (C domain deleted), or HEG0-537 (helix 12 and F domain deleted) ER or wt ER . The study was repeated. (B) ERK activation in response to E2 in CHO cells expressing either wt ER or a deletion mutant. Activity was determined after 8 min of incubation with 10 nM E2. MBP was used as a substrate for ERK activity. Total ERK protein is shown on the immunoblot beneath the activity results.
|
S522A is less capable than wt ER
of signaling from the membrane.
It was important to ascertain whether the loss of membrane receptors resulting from expression of the S522A mutant also affected signal transduction. We therefore compared ERK (MAP kinase) activation by E2 in CHO cells expressing wt or mutant ER
. E2 significantly stimulated ERK activity after 8 min of exposure to CHO cells expressing wt ER
(Fig. 3A, left). However, ERK activation in response to E2 was reduced by 68% in CHO cells expressing ER
S522A (relative to activation in cells expressing wt ER
) (Fig. 3A, left; compare lanes 2 and 4). Activation of ERK by E2 was further compared in CHO cells that expressed wt or S10A or S582A mutant receptors. Consistent with the binding data, the additional serine mutants were nearly identical to the wt in activation of this MAP kinase (Fig. 3A, right).
![]() ![]() ![]() ![]() ![]() View larger version (118K): [in a new window] |
FIG. 3. (A) (Left) ERK activity is stimulated by E2 in CHO cells expressing wt ER but less so in CHO cells expressing S522A mutant ER . *, P < 0.05 for E2 versus the control (mouse ER [mER ] without E2) in three combined experiments; +, P < 0.05 for ERK response to E2 in CHO cells expressing wt ER (lane 2) versus ER S522A (lane 4) in three combined experiments. (Right) Comparable stimulatory effects by E2 on ERK activity in CHO cells expressing wt ER or the S10A or S582A mutant (lanes 3 to 8). Lanes 1 and 2 show that the intrinsic ERK activity of CHO cells expressing the empty vector, pcDNA3, cannot be stimulated by E2, due to a lack of endogenous ER. *, P < 0.05 for control versus E2. (B) Generation of cAMP in response to E2 in CHO cells expressing wt or S522A mutant ER. (C) IP3 generation in response to E2 in the above cells. Bar graph data are means ± standard errors of the means from triplicate determinations per experiment and are from two (cAMP) or three (IP3) combined studies. (D) Targeting ER to the membrane but not the nucleus allows E2 to rapidly activate ERK. CHO cells were transfected to express either nontargeted wt mER or wt mER targeted to the nucleus (mER -ECFP-nucl.) or the membrane (mER -ECFP-memb.). Cont., control. The study was repeated.
|
-expressing CHO cells (Fig. 3B). Generation of cAMP often arises from G
s stimulation, which was previously demonstrated in response to membrane ER activation by E2 (32). Finally, we measured IP generation (Fig. 3C) and found a significant (53%) difference in production between cells expressing the two types of ER
. IP generation commonly results from the activation of G
q, which was previously shown to be stimulated by E2 activation of membrane ER expressed in CHO cells (32). These data indicate that the reduction in membrane ER levels seen with S522A protein expression has significant functional consequences, and they further support the idea that E2 activates signal transduction through the membrane (and not the nuclear) receptor. To further support the latter concept, we subcloned the full-length wt ER
into vectors that contain membrane or nuclear localization signals and also express a GFP fusion protein (ECFP; Clontech). We then expressed in CHO cells either nontargeted wt ER
or wt ER
targeted either to the membrane or to the nucleus. As seen in Fig. 3D, expression of the nontargeted wt ER
and especially the membrane-targeted receptor supported rapid ERK activation by E2. In contrast, there was no activation of ERK in CHO cells expressing nucleus-targeted ER. Combined with previous experiments targeting the E domain to the membrane or nucleus (31), these data show that it is the membrane ER that supports rapid kinase activation in response to E2.
Palmitoylation, myristylation, and glucosylphosphoinositol (GPI) anchor studies addressing ER localization at the membrane.
A number of posttranslational (or cotranslational) processes have been found to facilitate the movement and anchoring of proteins in the PM. To determine whether any of these alterations helped explain how ER localized to the membrane, we examined lipid modifications of ER. We expressed the wt mouse ER
in CHO cells and then labeled the cells with [3H]palmitate or myristic acid. As expected, there was no uptake or incorporation of either lipid into the nuclear ER
. Furthermore, we found that there was no incorporation of myristate into the membrane ER
, consistent with the lack of a consensus myristylation site determined either from our partial sequence of membrane ER
or from viewing the known full-length sequence (48). Similarly, a possible but nonclassic palmitoylation site was identified from a peptide corresponding to a region in the mouse ER
C terminus, encompassing serine 522. However, in the membrane, there was no specific incorporation of palmitate into ER
in either the presence or the absence of E2 (data not shown). Other modifications, such as farnesylation or geranylgeranylation, usually require concomitant palmitoylation and occur at the very end (usually the N terminus) of the protein. No such sites were identified. Thus, we conclude that ER
is probably not posttranslationally lipidated to effect membrane translocation.
Addition of GPI to a protein in the Golgi complex serves to anchor such modified proteins in the extracellular leaflet of the PM (21). The PI-PLC enzyme cleaves GPI-modified proteins and therefore releases these membrane proteins into the culture medium, so that they cannot be detected by binding ligand at the cell surface. We found that treatment of the ER-expressing CHO cells with this phospholipase did not change the binding of E2 to ER in the PM. Furthermore, the anchoring of ER in the outer leaflet of the PM would generally preclude its localization in the caveolae, a membrane domain where ER has now been detected (6, 13). Thus, it is unlikely that ER undergoes this posttranslational (cotranslational) modification.
Interactions of wt or S522A mutant ER
with caveolin 1.
It was recently reported that endogenous ER physically associates with the caveolin 1 protein in both the PM and cytosol of endothelial, vascular smooth muscle, and MCF-7 cells (31). Furthermore, expression of full-length caveolin 1 in MCF-7 or Caco-2 cells facilitates the movement of ER from the cytosol to the PM. Thus, ER-caveolin binding is important for the ability of ER to localize to the PM. We therefore examined whether the S522A mutant receptor bound to caveolin 1 comparably to wt ER
. This was accomplished in CHO cells, where we expressed the two ER constructs and utilized the endogenous caveolin in these cells. The ER was immunoprecipitated from the CHO cells, followed by immunoblotting for caveolin 1 (and vice versa), and association was examined in the absence of E2. In the cytosol of CHO cells, expression of either wt or S522A mutant ER
resulted in the receptor complexing with endogenous caveolin 1. However, the association of ER
S522A with caveolin 1 was 60% lower than that of wt ER
(Fig. 4). Importantly, as shown, the total ER levels expressed from the two vectors were comparable. These data are compatible with the idea that S522 is important for binding to caveolin 1, a protein that facilitates the membrane localization of the steroid binding protein (31). Thus, we have identified a mechanism to explain why ER
S522A is poorly localized to the PM.
![]() View larger version (22K): [in a new window] |
FIG. 4. ER and caveolin 1 (CAV-1) association in the cytoplasm. CHO-K1 cell cultures (100-mm-diameter dishes) were transfected with 10 µg of wt or S522A mutant ER plasmid DNA. The cells were lysed, and immunoprecipitation for caveolin 1 was carried out, followed by immunoblotting for ER (left panels); or the order was reversed (right panels). Results shown are representative of three experiments. Caveolin 1 and ER immunoblots are shown (lower panels) to demonstrate equal gel protein loading and equal expression of the two ER. mER , mouse ER .
|
S522A interferes with the function of endogenous E2-ER signaling from the membrane. To test this hypothesis, we transiently expressed ER
S522A in MCF-7 and ZR-75-1 breast cancer cells. It was previously shown that E2 induced rapid signaling from membrane ER in these cells (33). In MCF-7 cells transfected to express pcDNA3 (control), E2 caused a twofold activation of ERK activity via the endogenous membrane ER (Fig. 5A, left; compare lane 1 with lane 2). In contrast, ER
S522A-expressing cells responded to E2 with 61% less activation of ERK (Fig. 5A, left; compare lanes 1 and 2 with lanes 3 and 4). Comparably, ER
S522A expression resulted in a 70% decrease in ERK activation in E2-treated ZR-75-1 cells (Fig. 5A, right; compare lanes 1 and 2 with lanes 3 and 4). We also determined that activation of ERK by epidermal growth factor (EGF) or IGF-1 in MCF-7 cells (Fig. 5B, first three columns) was not significantly affected by expression of the mutant ER (last three columns). This demonstrates the specific action of ER
S522A to impair only E2-ER signaling, and it also indicates that signaling by the two growth factors does not require an intact membrane ER signaling system. To further establish the specificity of these results, we expressed the S10A mutant in MCF-7 cells. There was no difference in ERK activation in response to E2 between cells expressing only endogenous ER (pcDNA3 transfected) and the same cells additionally transfected with ER
S10A (data not shown).
![]() ![]() ![]() ![]() View larger version (75K): [in a new window] |
FIG. 5. (A) Expression of ER S522A inhibits E2 activation of ERK. MCF-7 (left) or ZR-75-1 (right) breast cancer cells (which express endogenous ER) were transfected transiently to express either pcDNA3 (control) or S522A mutant ER . The cells were then exposed to 10 nM E2 for 8 min, after which they were lysed, and immunoprecipitated ERK was assayed for activity by using MBP as a substrate. Precipitated ERK protein is shown in the lower gels, and the bar graphs each reflect three experiments combined. *, P < 0.05 for pcDNA3 in the absence versus the presence of E2; +, P < 0.05 for comparison of E2 treatments of pcDNA3-expressing versus ER S522A-expressing cells. (B) ER S522A does not impair EGF or IGF-1 activation of ERK. Data from three experiments are combined. *, P < 0.05 for pcDNA3-transfected or ER S522A-expressing MCF-7 cells in the absence versus the presence of EGF or IGF-1. (C) E2 comparably activates an ERE-luciferase reporter in untransfected MCF-7 cells and MCF-7 cells transfected to express ER S522A. Bar graph shows results for three experiments combined. *, P < 0.05 for pcDNA3- or ER S522A-transfected MCF-7 cells without versus with E2.
|
S522A to fully localize to the membrane contrasted with the normal amount and function of nuclear ER when this construct was expressed in CHO cells. We therefore determined the specificity of S522A to serve as a dominant-negative protein in MCF-7 cells for membrane but not nuclear ER. MCF-7 cells were transiently transfected with an ERE-luciferase reporter in the presence or absence of coexpression of ER
S522A or pcDNA3. In pcDNA3-expressing cells, E2 caused a dose-related, 2.5-fold maximal stimulation of luciferase function (Fig. 5C). When the S522A mutant was expressed in these cells, transactivation of this reporter by E2 was comparable. This indicates that expression of the mutant ER
did not affect endogenous nuclear ER function.
To understand the cell biological effects of S522A expression and the role of the endogenous membrane ER
, we examined the ability of estrogen to promote cyclin D1 protein expression and cdk4 activation in MCF-7 cells. It has previously been shown that, in response to growth factors, signaling through ERK to Ets protein phosphorylation transactivates the cyclin D1 promoter and stimulates cyclin D1 protein synthesis (1, 15). E2 has been shown to stimulate cyclin D1 transcription and protein synthesis (47). We found that E2 was capable of increasing cyclin D1 protein levels nearly threefold (Fig. 6A). This was significantly related to ERK activation, since the MEK inhibitor PD98059 substantially prevented this effect. It was previously shown that PD98059 completely blocked E2 activation of ERK in MCF-7 cells (34). Importantly, expression of ER
S522A inhibited the E2-induced increase in cyclin D1 protein levels by 68%. Thus, the ability of ER
S522A to inhibit ERK activation arising from the endogenous membrane ER greatly contributed to the inhibition of the increase in cyclin D1 protein levels.
![]() View larger version (23K): [in a new window] |
FIG. 6. (A) Cyclin D1 expression is increased in response to E2 and is dependent on ERK activation in wt MCF-7 cells. MCF-7 cells transfected to express ER S522A show a lower response to 100 nM E2. Data are representative of three experiments, which were combined for the bar graph. *, P < 0.05 for pcDNA3-expressing cells without versus with E2; +, P < 0.05 for cells incubated with pcDNA3 plus E2 versus the same condition plus 10 µM PD 98059, or versus cells cotransfected with ER S522A. (B) cdk4 activity is significantly downregulated by ER S522A in MCF-7 cells. Cells were transfected with pcDNA3 or the mutant ER and exposed to 10 nM E2 for 6 h. cdk4 kinase was immunoprecipitated, and an in vitro assay of activity was accomplished by using Rb protein as a substrate. Bar graph data are from three experiments combined. (C) E2-stimulation of p38ß activity in endothelial cells is inhibited by ER S522A. Transfected endothelial cells were incubated with E2 for 20 min, and p38ß activity was determined against the substrate protein ATF-1. Data are from three experiments.
|
We also assessed G1/S progression, determined by thymidine incorporation into DNA. It has previously been shown in MCF-7 or ER-expressing CHO cells that E2 stimulation of DNA synthesis is partly regulated through the ERK signaling pathway (5, 32). We found here that E2 caused a 70% increase in thymidine incorporation into DNA, a marker of the S phase. Two-thirds of this increase was blocked by PD98059. Thus, E2 utilizes several mechanisms to stimulate G1/S progression, but ERK activation is the most important. Upon expression of ER
S522A, E2-induced thymidine incorporation was significantly reduced, by 50%. Thus, expression of the mutant ER
affirms the participation of the membrane steroid receptor in this event.
It would be important to know if the dominant-negative effect of the S522A mutant ER
extended to other cells. It was previously shown that E2 activates p38ß MAP kinase in endothelial cells through endogenous membrane ER and that this leads to the angiogenic and cell survival effects of E2 in these cells (33). Here, we report that E2 activation of p38ß in endothelial cells is 60% reduced when ER
S522A is expressed (Fig. 6C). Thus, this mutant ER may be a useful tool for determining the contributions of the membrane ER
to various cell-signaling and biological functions.
Mechanisms of ER
S522A inhibition of endogenous ER function.
How might ER
S522A inhibit endogenous ER function? One possibility to explain the dominant-negative effect of ER
S522A is that it might heterodimerize with wt ER. Dimerization is necessary for ER to transactivate genes (43), and heterodimerization between ER
and ERß has been reported to inhibit ER
function (29). Since the S522A mutant does not translocate effectively to the PM, it could potentially bind and sequester the endogenous receptor, thus interfering with its signaling function. To assess possible heterodimerization, we expressed GFP-tagged ER
S522A and His-tagged wt ER
in CHO cells and performed pulldown studies. After lysis, the cell extracts were immunoprecipitated and blotted with anti-GFP and anti-His antibodies, in both orders. After E2 treatment of cells where either or both tagged forms of the receptor were expressed, we found evidence for homodimerization and heterodimerization of wt and mutant ER
(Fig. 7A). As specificity controls, the fourth lanes show a lack of ER when His-tagged wt ER
is expressed and immunoprecipitated but blotting is done with an antibody to GFP (Fig. 7A, left), and when GFP-tagged ER
S522A is expressed but blotting is done with an antibody to His (Fig. 7A, right). Furthermore, S522A mutant ER
was as capable as wt ER
of dimerizing to wt ER
(Fig. 7A, left). These data indicate that ER
S522A can bind to wt ER
, thereby potentially sequestering or otherwise limiting endogenous receptor signaling from the membrane.
![]() ![]() ![]() ![]() ![]() View larger version (153K): [in a new window] |
FIG. 7. (A) Homo- and heterodimerization of wt and ER S522A after expression in CHO cells. Doubly or singly transfected cells were first exposed to 10 nM E2 for 10 min and then lysed, and the lysate underwent immunoprecipitation (IP) with an antibody to His or GFP, as indicated, eventually followed by blotting with an antibody to GFP (left) or to His (right). Proteins were separated by SDS-PAGE under nonreducing conditions (native gel). Molecular weight markers indicate the different sizes of the GFP-tagged wt ER and His-tagged ER S522A homodimers and the intermediate size of the heterodimer. (B) Expression of S522A prevents wt ER localization at the membrane. CHO cells were transfected with equal amounts of plasmids encoding GFP-tagged wt ER plus His-tagged wt ER (10 µg of total DNA/100-mm-diameter dish) or with GFP-tagged wt ER plus His-tagged ER S522A. Localization of receptors was determined by confocal microscopy. (C) wt and S522A mutant ER equally associate with Ras, Raf, or Src at the membrane. (Left) CHO cells were transfected to express either receptor, and after normalization, equal receptor protein aliquots were confirmed by Western blotting. Equal protein aliquots were used for immunoblots to determine wt or mutant ER association with Ras or Raf. The study was carried out in the presence of 10 nM E2 for 10 min and was repeated. Immunoprecipitation with no antibody (ab) or an irrelevant antibody to the endothelin-1 peptide did not yield a protein band. (Right) MCF-7 cells were transfected with His-tagged ER S522A (lanes 2 and 3) or with His-tagged pcDNA3 (lane 1) and were incubated or not with 10 nM E2 for 10 min. The cells were lysed and immunoprecipitated for ER (lane 1) or for His (lanes 2 and 3), then immunoblotted for Src. Expression of His-tagged pcDNA3 did not coprecipitate Src (data not shown).
|
in CHO cells transfected to express equal amounts of either (i) GFP-tagged wt ER
plus His-tagged wt ER
or (ii) GFP-tagged wt ER
plus His-tagged ER
S522A. As seen in Fig. 7B, expression of ER
S522A substantially decreased the membrane localization of GFP-tagged wt ER
. By contrast, nuclear receptor expression was not different. Thus, ER
S522A inefficiently translocates to the cell surface and also prevents wt ER
PM localization after heterodimerization. These results provide a mechanism for the dominant-negative action of the mutant ER
, but other effects are tenable.
Membrane wt ER
and S522A mutant ER
bind equally to signaling molecules.
It is also important to consider that mutation of serine 522 to alanine might disturb the inherent ability of membrane ER to associate with important signaling molecules. This could contribute to the differential signaling from the membrane by wt versus S522A mutant ER
. To investigate this, we transfected CHO cells to express either wt or S522A mutant ER
. We immunoprecipitated the ER from membrane preparations and then normalized the proteins for equivalent amounts of receptor(s), as indicated by Western blotting (Fig. 7C). We then took separate (normalized) aliquots of immunoprecipitated wt ER
or ER
S522A and immunoblotted the aliquots for Ras or Raf. We found that the two receptors associated equally with the Ras or Raf signaling molecules in the presence of the steroid (Fig. 7C, left). Control immunoprecipitations without an antibody or with an irrelevant antibody to endothelin-1 (ET-1) did not bring down a Ras or Raf protein band. Especially important is the association of ER with Src, which has been reported to bind to tyrosine 537 of ER
(24). We examined the effect of expression of ER
S522A on subsequent Src association with ER in MCF-7 cells. As seen in Fig. 7C (right), endogenous ER
associated with Src comparably to the S522A mutant receptor, and this was unaffected by E2. This suggests that there is no alteration of association with important signaling molecules by ER
S522A that can account for the differences in signaling from the membrane. Thus, we believe that it is primarily the membrane receptor number that determines the differences in signaling.
|
|
|---|
in nude mice blocked the growth of human breast cancer xenografts (23). This probably resulted from inhibition by the antibodies of membrane ER signaling to ERK and PI 3-kinase. Spatially, the receptor appears to be localized primarily but not exclusively to caveolar fractions of the PM (6, 13). In this confined area, ER potentially interact with a variety of signaling molecules that must localize to the PM for activation. The PM ER acts as a G protein-coupled receptor, directly (31, 50) or indirectly (10), leading to activation of multiple signaling pathways. This results in cAMP generation (4), PLC and inositol triphosphate (IP3) activation (16, 41), and the stimulation of cascades leading to enhanced activity of ERK, JNK, and p38 MAP kinases (23, 32, 33). The importance of these nongenomic mechanisms of estrogen action is analogous to that of the actions of steroids in plants. In Arabidopsis spp., brassinosteroids mediate plant cell developmental growth and fertility (22), and cell action results from steroid binding to a transmembrane, tyrosine kinase receptor protein (44). Thus, steroid action at the cell surface is an ancient function conserved from plants to humans, further indicating its importance.
One important issue with regard to the cell surface ER that we addressed here is the structural requirements for a population of ER to translocate to the PM. We found that ER are not posttranslationally lipidated, as occurs with other PM-localized proteins. Rather, we identified serine 522 as important for membrane translocation. Compared to expression of wt mouse ER
, mutation of this serine to alanine resulted in 62% fewer receptors expressed at the membrane, with little influence on receptor affinity for ligand. However, there was no appreciable effect on the nuclear receptor numbers, affinity, and function (transactivation of an ERE-luciferase reporter). Furthermore, expression of the S522A mutant receptor was markedly less efficient in supporting E2-induced ERK activation, cAMP generation, and stimulation of IP3 than wt receptor expression. Presumably, reduced signaling resulted from a decreased number of receptors available at the membrane. Supporting this, we did not find a loss of association at the membrane between S522A mutant ER
and signaling molecules, compared to that for wt ER
. However, this receptor can serve as a dominant-negative protein for wt ER when expressed in MCF-7 cells, and therefore additional mechanisms of abolishing signal transduction may be relevant (see below). Supporting the specificity of our results, we found that substitution of alanine for serine at residues 10 and 582 of the mouse ER
had no effect on either E2 binding to the membrane or signaling by E2, when these mutants were compared to wt ER
.
How does ER
localize to the membrane, and how does S522 contribute? It was recently determined that caveolin 1 protein facilitates the translocation of ER to the PM and that the two endogenous proteins physically bind in both the cytosol and the PM (31). The scaffolding domain of caveolin 1 (amino acids 82 to 101) is essential for this protein to move from the cytosol to the membrane (3, 27), and we determined that the scaffolding domain facilitates ER movement to the PM. An important question, then, is whether serine 522 is necessary for the association of ER
and caveolin 1. We report here that in the cytoplasm, the physical association between these two proteins was 60% decreased by the mutation of serine 522. In contrast, association of caveolin with S10- or S582-mutated ER
was comparable to that with wt ER (data not shown). It has recently been shown that residues 1 to 282 of ER
bind to caveolin 1 (37). However, Lu et al. recently showed that caveolin 1 associates with the androgen receptor through both N-terminal (A/B domain) and E domain elements (20). We found that an A/B domain deletion mutant ER
localizes to the membrane and supports E2 signaling to ERK equivalently to wt ER
. Thus, the interaction between caveolin and the N terminus of ER may not be functionally important for the membrane ER.
What supports the relevance of S522A for ER action at the membrane? Kousteni et al. showed that by targeting only the E domain of ER
to the PM but not to the nucleus, E2 could rescue cells from apoptotic death (14). It was recently demonstrated that the E domain (and here the full-length ER) is sufficient to convey robust ERK activation in response to E2 when targeted to the PM (31). These overall findings suggest that the E domain is generally important for ER
actions originating at the membrane. Identification of serine 522 provides a novel insight into the specific structural requirements for membrane localization, steroid action, and cell biological functions of E2. We suggest that similar examination of the role of the ligand binding domains of the progesterone, androgen, and other steroid receptors is warranted.
To establish the roles of the membrane ER in cell biology, several approaches could be taken. Targeting of ER to only one compartment in the cell may suggest a specific function for a pool of the endogenous receptor. Another approach is to devise specific agonists or antagonists for the membrane ER, reagents that do not enter the cell to bind the nuclear receptor. Several ER agonists have recently been described that dissociate some membrane signaling from transcriptional activity (14). However, ER signaling through the membrane receptor stimulates gene transcription (9, 46), and thus, these two functions may not always reflect membrane versus nuclear receptor action. A third approach is to express mutant sex steroid receptors that specifically interfere with endogenous ER actions at the membrane. We show here in MCF-7, ZR-75-1, and endothelial cells that ER
S522A is capable of significantly preventing E2 signaling from the endogenous membrane receptor. We propose that this could result from preventing endogenous ER localization at the membrane. Since the dimerization motifs for ER
do not involve serine 522, we reasoned that wt and mutant ER could heterodimerize and thus sequester wt ER from localizing fully at the PM. Supporting this, we provide evidence of heterodimerization between the mutant and wt ER
and a loss of membrane wt ER
when both receptors are coexpressed.
In MCF-7 or ZR-75-1 breast cancer cells, expression of ER
S522A interfered with endogenous ER function. Expression of ER
S522A inhibited E2-induced ERK activation, cyclin D1 production, cdk4 activity, and G1/S progression. Many of these actions of E2 require signaling from the membrane to kinases such as ERK. Furthermore, the utility of this approach was shown in a second cell type, where membrane E2-ER signaling to p38ß MAP kinase (33) was significantly prevented by expression of ER
S522A. The strong inhibition of cyclin D1 protein in MCF-7 cells by ER
S522A expression and the linkage to modulation of ERK activity suggests an important therapeutic intervention in breast cancer. In vitro, E2 induction of cyclin D1 overcomes the tamoxifen-induced G1/S cell cycle block (47). Also, tamoxifen sensitivity can be restored through p27 function, resulting from ERK downregulation (8). In this respect, limiting endogenous membrane ER signaling to ERK (19) and cyclin D1 may be therapeutically desirable, as suggested by our use of the S522A mutant ER
. It has also been recently reported that specifically cyclin D1 is essential to the development of rodent breast cancer, resulting from Ras or Neu oncogene signaling (51). Cyclin D1 has several important functions, but arguably the most important is the regulation of the inactivating phosphorylation of the Rb protein by cdk4, allowing E2F release and the subsequent transcription of genes that drive cell cycle progression in breast cancer (39). Our demonstration that ER
S522A significantly limits these events both points out therapeutic targets and reveals the importance of E2 signaling from the membrane. The ultimate goal of hormone replacement after the menopause is to activate specific, desirable effects of sex steroids (osteoblast survival) without invoking unwanted actions (breast cancer proliferation). This strategy will be best served by defining the array of discrete actions of E2 that result from binding at membrane and nuclear ER in various target cells. Expression of ER
S522A may be very useful in this regard.
We thank M. Lisanti for caveolin plasmids.
|
|
|---|
and endothelial nitric oxide synthase are organized into a functional signaling module in caveolae. Circ. Res. 87:e44-e52.
and ERß expressed in CHO cells. Mol. Endocrinol. 13:307-319.
by caveolin-1. Biochem. J. 359:203-210.[CrossRef][Medline]
i. J. Biol. Chem. 276:27071-27076.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»