Identification of a Structural Determinant Necessary for the Localization and Function of Estrogen Receptor {alpha} at the Plasma Membrane

Estrogen receptors (ER) have been localized to the cell plasmamembrane (PM), where signal transduction mediates some estradiol(E2) actions. However, the precise structural features of ERthat result in membrane localization have not been determined.We obtained a partial tryptic peptide/mass spectrometry analysisof membrane mouse ER ${alpha}$ protein. Based on this, we substitutedalanine for the determined serine at amino acid 522 within theE domain of wild-type (wt) ER ${alpha}$ . Upon transfection in CHO cells,the S522A mutant ER ${alpha}$ resulted in a 62% decrease in membrane receptornumber and reduced colocalization with caveolin 1 relative tothose with expression of wt ER ${alpha}$ . E2 was significantly less effectivein stimulating multiple rapid signals from the membranes ofCHO cells expressing ER ${alpha}$ S522A than from those of CHO cells expressingwt ER ${alpha}$ . In contrast, nuclear receptor expression and transcriptionalfunction were very similar. The S522A mutant was also 60% lesseffective than wt ER ${alpha}$ in binding caveolin 1, which facilitatesER transport to the PM. All functions of ER ${alpha}$ mutants with otherS-to-A substitutions were comparable to those of wt ER, anddeletion of the A/B or C domain had little consequence for membranelocalization or function. Transfection of ER ${alpha}$ S522A into breastcancer cells that express native ER downregulated E2 bindingat the membrane, signaling to ERK, and G₁/S cell cycle eventsand progression. However, there was no effect on the E2 transactivationof an ERE-luciferase reporter. In summary, serine 522 is necessaryfor the efficient translocation and function of ER ${alpha}$ at the PM.The S522A mutant also serves as a dominant-negative construct,identifying important functions of E2 that originate from activatingPM ER.

INTRODUCTION

Top

Introduction

Steroid action is attributed primarily to the regulation oftarget genes through nuclear receptor binding and transactivation,subsequently producing cell biological effects (42). However,it has increasingly been appreciated that steroids, such asestradiol (E2), act rapidly through nongenomic mechanisms ofsignal transduction (4, 16, 41). These signaling mechanismshave important consequences for the effects of steroids on cellbiology (14, 40). For E2, these effects can occur after thesex steroid binds to plasma membrane (PM) estrogen receptors(ER) (17, 30), which has been demonstrated by immunohistochemistry(36) and by immunoblotting of isolated PM domains (6). Somesignaling effects of E2-ER can result from complex interactionswith PM growth factor tyrosine kinase receptors, such as theepidermal growth factor receptor (EGFR) (10).

Although the exact sequence of this receptor has not been reported,the membrane ER appears to be very similar, and perhaps identical,to the nuclear receptor. This is based upon the identificationof similarly sized nuclear and membrane ER proteins that resultfrom the expression of a single cDNA (and resulting single mRNA)in CHO cells (32). Also, membrane ER have been localized onvascular smooth muscle, pituitary, and endothelial cells thatexpress endogenous receptors, by using antibodies raised againstmultiple epitopes of the nuclear ER ${alpha}$ (25, 26, 36). However, manyquestions remain concerning this relatively small populationof ER at the cell surface.

The membrane ER has been reported to be G protein linked (32,50), and E2 binding can activate many signal transduction pathwaysthat emanate from G protein activation. These include kinaseand endothelial nitric oxide synthase activation, cyclic AMP(cAMP) and inositol phosphate (IP) generation, and phospholipaseC (PLC) stimulation (4, 16, 18, 24, 50). Linkage to G proteinsmay be direct, as shown in transfected CHO cells expressingER ${alpha}$ or ERß (32) or in endothelial cells (50), but ithas also been reported that E2 activates an orphan G protein-coupledreceptor (10). Furthermore, it is not clear whether this receptorspans the cell membrane or is predominately localized withinor associated with the membrane bilayer. Membrane ER have recentlybeen shown to exist in discrete caveolar domains of the PM (6,13). It has recently been found that membrane ER ${alpha}$ can physicallyassociate with the caveolar structural coat proteins caveolin1 and caveolin 2 (31). Caveolin proteins serve as scaffolds,bringing together various signaling molecules within a discretearea of the PM to regulate cytokine-induced signal transduction(3, 27). These include G proteins, nonreceptor and receptortyrosine kinases (Src, EGFR), and threonine-serine kinases,such as phosphatidylinositol 3-kinase (PI 3-kinase) and Raf.Organization of signaling molecules within a confined spacepotentially allows E2-ER to modulate a variety of signalingcascades in target cells.

Signal transduction via the membrane ER has increasingly beenfound to be important for the cell biological effects of thissteroid, including the survival and/or growth of breast cancer,bone, and neural cells (5, 7, 14, 24, 34, 49). This receptorhas also been implicated in prevention of the inflammatory responseto muscle ischemia-reperfusion injury (40), maintenance of theendothelial cell cytoskeleton, and upregulation of vascularcell migration and angiogenesis (33). E2 stimulation of transcriptioncan also be signal dependent, as stimulation of the mitogen-activatedprotein (MAP) kinase ERK (extracellular regulated kinase) hasbeen shown to be important for transactivation of the c-fosand prolactin genes (9, 45, 46). Transcription in response toE2 generation of cAMP has also been reported (4). The precisestructural features of ER that facilitate the translocationof this steroid binding protein to the membrane are not known,but such information is important for understanding of the detailsof estrogen action at the cell surface.

The studies reported here result from our attempt to understandthe localization and function of this protein at the PM. Tobegin this, we partially determined the amino acid structureof the mouse membrane ER ${alpha}$ , isolated from CHO cells transfectedto express this protein. We identified a serine residue at 522that is necessary for the optimal localization and functionof the sex steroid receptor at the cell surface. In contrast,mutation of this serine had no effect on nuclear ER number,affinity for E2, or E2-induced transactivation function. Wealso report that expression of the S522A mutant ER ${alpha}$ resultedin a dominant-negative action only at the membrane, in cellsexpressing wild-type (wt) ER ${alpha}$ . This mutant abolished severalimportant effects of E2 in breast cancer and can be used asa reagent to deduce the cellular actions of E2 originating frommembrane ER ${alpha}$ .

MATERIALS AND METHODS

Top

Materials and Methods

Isolation and partial sequencing of a membrane ER. CHO-K1 cells were transiently transfected with a cDNA for themouse ER ${alpha}$ , as previously described (32). This resulted in theexpression of both nuclear and membrane receptors. Twenty platesof ER ${alpha}$ -transfected CHO cells were scraped and pelleted at 1,000x g, and pellets were resuspended in 20 mM Tris with 1 mM EDTA,1 mM dithiothreitol, and protease inhibitors. Cells were thencentrifuged at 4°C and 8,000 x g for collection of nuclearreceptors, and the supernatant was then ultracentrifuged at4°C and 100,000 x g for 1 h. The pellet (membranes) waswashed and ultracentrifuged again, and membranes were then furtherseparated by sucrose gradient overlay; fractions 3 to 5 containedthe buoyant membranes (with caveolae and rafts) that were pooledfor all experiments (31). Briefly, membrane samples were firstplaced in a tube with an equal volume of a solution containing85% (wt/vol) sucrose, 25 mM A-morpholine-ethanesulfonic acid,and 0.15 M NaCl and were then overlaid with 8.5 ml of 35% sucrose,topped up with 16% sucrose, and centrifuged at 35,000 rpm (105,000x g) for 18 h at 4°C. Ten fractions (1 ml each) were obtainedand either further processed or separated by sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followedby membrane transfer for immunoblotting. The membrane receptorswere solubilized in binding buffer (Pierce) containing 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate(CHAPS; Sigma). The purity of the membranes was confirmed bypositive immunoblotting for 5'-nucleotidase and caveolin 1 (membraneproteins) and by the lack of detection of transportin and NTF-2(nuclear proteins) or ß-coatomer protein (endosomal/Golgiprotein) (38). This was followed by affinity column purification.Briefly, protein G bound to an antibody against ER ${alpha}$ (H222) (11)was cross-linked with disuccinimidyl suberate to make the column.The ER ${alpha}$ -containing membrane or nuclear protein was eluted byusing proprietary buffers and a proprietary protocol (Pierce).The eluted receptor proteins were dialyzed or concentrated andthen analyzed by SDS-PAGE after being run on a 7.5% gel followedby staining. The gel protein bands corresponding to 67 kDa werecut out, trypsin was extracted from the gel, and the bands werethen subjected to peptide degradation-mass spectrometry, aspreviously described (2, 12). This generated peptide sequencesfrom the membrane and nuclear proteins, and these were comparedto the known sequences of the classical mouse nuclear ER ${alpha}$ .

Site directed mutagenesis and targeting of mouse ER ${alpha}$ . We carried out tryptic peptide matrix-assisted laser desorptionionization (MALDI)-mass spectrometry "sequencing," as describedabove. At present this has yielded membrane peptide sequencesthat identically overlap with 20% of the known nuclear receptorand with 20% of our expressed nuclear receptor, supporting theidea that the two receptors are the same (G. Alton, M. Razandi,A. Pedram, and E. Levin, unpublished data). We identified anoverlap sequence from amino acid 508 to amino acid 524 thatincludes a serine at 522. With surrounding residues, this wasidentified by computer analysis as a potential (although nota classic) palmitoylation site (HMSN). This sequence is presentas amino acids 517 to 520 of the human receptor as well. Wethen mutated the serine at 522 to alanine in mouse pcDNA3-ER ${alpha}$ by PCR using the forward primer 5'-CGGCACATGGCTAACAAAGG-3'.As specificity controls, we also mutated the identified serineresidues 10 and 582 to alanine by using the forward primers5'-CCCTTCACACCAAAGCCGCGGGAATGGCCTTGCTGC-3' and 5'-GCTCCACTTCAGCACATGCCTTACAAACCTACTAC-3',respectively. All mutations were confirmed by sequencing atthe University of California—Irvine sequencing facility.We additionally subcloned the receptors into a green fluorescentprotein (GFP) vector, pEGFPc2 (Clontech, Palo Alto, Calif.),and a multicopy histidine-expressing vector to monitor transfectionefficiencies. wt and mutant receptor expression plasmids werethen used in studies. To generate nuclear and membrane wt ER ${alpha}$ constructs, pcDNA3-mouse ER ${alpha}$ was used as a template. Twenty-fivecycles of PCR (annealing temperature, 55°C) were performedby utilizing the forward primer 5'GCCGCTAGCACCATGACCATGACCCTTCAC3'and the lower primer 5'GCCACCGGTCTGATCGTGTTGGGGAAGCCC3'. ThePCR product was ligated into pCR2.1 by using the TA cloningkit (Invitrogen, Carlsbad, Calif.) and digested with AgeI andNheI. This fragment was subcloned into AgeI and NheI sites onthe pECFP-Nuc and pECFP-mem vectors (Clontech), yielding ERconstructs that were predominantly targeted to either the membraneor the nucleus (confirmed by binding and functional studies).

Receptor binding and cell localization studies. wt and mutant ER ${alpha}$ were expressed in CHO cells, and nuclear andmembrane fractions were isolated as detailed above and wereused for competitive binding assays or signal transduction studies,as previously described (31, 32). Binding studies were repeatedat least three times, and the data were used for Scatchard analysiswith the LIGAND computer program. Results were combined forstatistical comparison by analysis of variance plus Schefe'stest. Additional ER ${alpha}$ mutants (HE11G, with the A/B domain deleted;HE19G, with the C domain deleted; and HEG0-537, with helix 12and the F domain deleted) were provided by Paul Webb and expressedin CHO cells.

For cell localization of wt or S522A mutant ER ${alpha}$ , we transientlyexpressed GFP-tagged fusion proteins for each receptor in CHOcells. CHO cells were grown and transfected on coverslips, andlocalization of the receptors was examined by laser-scanningconfocal microscopy. We also colocalized the receptors at themembrane with endogenous caveolin 1 by using an antibody tothis protein (Zymed Laboratories, South San Francisco, Calif.).Each section was processed for GFP-ER ${alpha}$ (green), caveolin 1 (secondantibody conjugated to Texas red), and colocalized caveolin1 and ER ${alpha}$ (yellow).

Signaling studies. Adenylate cyclase activity in the membrane was determined bymeasuring cAMP generation, by methods described previously (32),in CHO-K1 cells expressing wt or S522A mutant ER ${alpha}$ after the cellshad been incubated for 5 min with 10 nM E2. IP generation andERK (MAP kinase) activation in the CHO cells were also determinedas described in detail elsewhere (32). Activation by E2 of anERE-luciferase reporter in ER-transfected CHO or MCF-7 cellswas assessed at 8 h of exposure to 10 nM E2, as previously published(32). Membranes were isolated by sucrose gradient centrifugation(31).

Myristylation, palmitoylation, and PI-PLC studies in CHO-K1 cells. Cells were grown on 100-mm-diameter petri dishes in Dulbecco'smodified Eagle medium (DMEM)-F12 medium without phenol red.Twenty-four hours after transfection with ER ${alpha}$ , the cells weresynchronized overnight and then labeled with [³H]palmitic acid(0.5 µCi/ml) or [³H]myristic acid (0.2 µCi/ml) for2 h. The cells were incubated for 8 h in the presence or absenceof 10 nM 17ß-E2, washed with cold phosphate-bufferedsaline, and then lysed in buffer A (50 mM Tris-HCl [pH 7.5],5 mM EDTA, 100 mM NaCl, 50 mM NaF, 100 µM phenylmethylsulfonylfluoride, protease inhibitor cocktail, and 0.2% Triton X-100).Nuclear pellets were collected by low-speed centrifugation.Supernatants were centrifuged at 100,000 x g for 30 min to pelletcell membranes. Both pellets were washed twice, once with bufferA and once without detergent. Membranes were further purifiedby sucrose gradient centrifugation. Membrane and nuclear fractionswere denatured in SDS loading buffer followed by gel electrophoresis,fluorography, and autoradiography. For phosphoinositol (PI)-PLCstudies, the cells were incubated with 1 U of PI-PLC (Sigma)/mlfor 1 h. Cells were washed and lysed, and the membrane and nuclearfractions were collected. Specific, total binding studies werethen carried out on 50 µl of nuclear or membrane protein,incubated in DMEM-F12 medium (with no phenol red), bacitracin(1 mg/ml), and 0.5% bovine serum albumin, and with ³H-labeledE2 and unlabeled E2 (10^-11 to 10^-7 M).

Cyclin D1 protein expression, thymidine incorporation, and kinase activity. MCF-7 cells were transfected with pcDNA3 (control) or ER ${alpha}$ S522A,recovered, then synchronized by serum deprivation for 24 h,and then incubated in the presence or absence of 10 nM E2 for8 h. In some cells, the soluble MEK inhibitor PD98059 (10 µM)was added to the incubation mixture 30 min prior to the steroid.The cells were then lysed, precleared, boiled, denatured inSDS reducing buffer, and electrophoretically resolved by PAGE.Western immunoblotting was then carried out using a polyclonalantibody (Santa Cruz). Nuclear thymidine incorporation was carriedout in nontransfected or transfected MCF-7 cells after synchronizationovernight in serum-free medium. All cells were then incubatedfor 20 h in the absence or presence of 10 nM 17ß-E2.In some conditions, the MEK inhibitor PD 98059 (10 µM)was added prior to the steroid. After 20 h, 0.5 µCi of[³H]thymidine was added for 4 more h, as previously described(32). Cells were then washed and incubated for 10 min with 10%trichloroacetic acid at 4°C, followed by additional washes.Cells were lysed with 0.2 N NaOH overnight, and lysates werecounted in a liquid scintillation ß-counter. For cdk4activity, MCF-7 cells transfected with pcDNA3 (control) or ER ${alpha}$ S522A were incubated with E2 for 6 h and then lysed. The celllysate was added to a protein A-Sepharose-conjugated cdk4 antibody(Santa Cruz) and then added to in vitro kinase activity tubescontaining GST-pRB as a substrate, as previously described (28).This was followed by SDS-PAGE separation and autoradiography.Samples from each condition were assessed for protein loadingequivalence, where cdk4 protein was assayed by immunoblotting.For ERK activity assays, transfected or nontransfected CHO,MCF-7, or ZR-75-1 cells were synchronized for 24 h in serum,phenol red, and growth factor-free medium. The cells were thenexposed to E2 (10 nM) for 8 min with or without additional substances,and kinase activity was determined by using myelin basic protein(MBP) for the substrate, as previously described (32, 34). Forp38ß activity, the cells were incubated with E2 (10nM) for 20 min and then lysed, and the lysate was immunoprecipitatedwith protein A-Sepharose conjugated to an antiserum for p38ß.Immunoprecipitated kinases were then added to the protein ATF-1for in vitro kinase assays as previously described (33). Allexperiments were repeated two to three times.

Protein and ER association studies. Cytosolic fractions of CHO-wt ER ${alpha}$ or CHO-ER ${alpha}$ S522A were incubatedwith protein A-Sepharose for 1 h, and supernatants were transferredto fresh tubes containing protein A-Sepharose conjugated tocaveolin 1 or ER ${alpha}$ antibodies and were incubated for 4 h at 4°C.Immune complexes were washed, boiled, and then separated bySDS-PAGE. After transfer to nitrocellulose filters, the nonspecificproteins were blocked with blocking solution (Bio-Rad) and incubatedfirst with a primary antibody to ER ${alpha}$ or caveolin 1 for 2 h andthen with a second antibody (Santa Cruz Biotechnology). Boundimmunoglobulin G's (IgGs) were visualized using ECL reagents(Amersham) and autoradiography. Portions of the immunoprecipitatedER ${alpha}$ or caveolin 1 were immunoblotted for evidence of equal proteinloading and equal expression of total ER with the two constructs.In additional studies, MCF-7 cells were transfected to expressa GFP-ER ${alpha}$ S522A protein or GFP alone. After overnight recovery,the cells were lysed and immunoprecipitated with an antibodyto GFP, followed by immunoblotting with antibodies to Src, Ras,and Raf proteins (Santa Cruz). In CHO cells, His-wt ER ${alpha}$ or GFP-ER ${alpha}$ S522A was singly or doubly expressed. To detect homo- or heterodimerizationin these cells, the lysate was immunoprecipitated with an antibodyto His, followed by blotting with an antibody to GFP, or inreverse order. All studies were repeated at least three times.

RESULTS

Top

Results

Comparison of wt and S522A mutant ER ${alpha}$ binding after expression in CHO cells. We first isolated the mouse ER ${alpha}$ in the PM after expression inCHO cells and partially sequenced the protein by peptide degradation-MALDImass spectroscopy (Razandi et al., unpublished). We identifieda peptide (LAQLLLILSHIRHMSNK) that corresponds to a portionof the C terminus in the known mouse ER ${alpha}$ sequence (2), beginningwith amino acid 508. Furthermore, HMS (boldfaced in peptidesequence) was noted by computer modeling as a possible, butnot classic, palmitoylation site (35). We therefore asked whetherthe ER was palmitoylated at this site (see below), and we alsomutated the critical serine at amino acid position 522 to alaninewithin the mouse ER ${alpha}$ cDNA. Additional S-to-A mutations at residues10 and 582 were created by site-directed mutagenesis, for comparisonto mouse ER ${alpha}$ S522A (48) and to support the specificity of anyfindings.

We then expressed the wt and S522A mutant ER ${alpha}$ constructs in CHOcells and carried out competitive binding studies in both nuclearand membrane compartments. By Scatchard analysis of the bindingdata (Fig. 1A), we found that the receptor affinity for E2 (K_d)and the receptor number (B_max) were very similar for the twoER ${alpha}$ receptors in the nucleus (Table 1). Similar transfectionefficiencies were demonstrated using GFP fusion constructs (datanot shown). We also determined whether the function of the mutantnuclear ER ${alpha}$ differed from that of the wt. We therefore cotransfectedCHO cells with either wt or S522A mutant ER ${alpha}$ and an ERE-luciferasereporter (32) and determined the response to E2. We found thatthe two receptors were comparably capable of responding to E2with an upregulation of reporter activity (Fig. 1B). These dataindicate that the replacement of S with A at residue 522 doesnot affect the quantity of nuclear receptor localization, itsbinding affinity for E2, or the transcriptional response tothe steroid.

View larger version (231K):
[in this window]
[in a new window]
FIG. 1. (A) Competition binding of 17ß-[³H]E2 to nuclear wt (left) or S522A mutant (right) ER ${alpha}$ transfected into CHO-K1 cells. (Inset) Binding to cell membrane ER ${alpha}$ . Data are transformed for Scatchard analysis by using the LIGAND program. Data shown here are from a representative study; results from three separate experiments were combined to create Table 1. (B) Transactivation of an ERE-luciferase reporter construct coexpressed in CHO cells with mouse wt ER ${alpha}$ or the S522A mutant. Data were determined at 6 h after incubation with either 1 nM E2, 10 nM E2, or no steroid. *, P < 0.05 for the wt or the S522A mutant alone versus the same construct plus E2 (for data combined from three experiments). (C) Serine/threonine residues in the full-length receptor, but not serine 522 in the E domain of ER ${alpha}$ , are phosphorylated. Western blotting utilized a specific antibody to serine/threonine residues (Sigma) from lysates of CHO cells transfected to express either the full-length receptor or the E domain targeted to the PM or the nucleus. (D) Membrane localization of GFP-tagged wt ER ${alpha}$ or S522A mutant ER ${alpha}$ expressed in CHO cells. Arrows indicate a greater membrane localization for wt ER ${alpha}$ . Dense nuclear populations for both receptors are seen. (E) Colocalization of wt ER ${alpha}$ with caveolin 1 at the membrane, but markedly less colocalization of ER ${alpha}$ S522A. Results of a representative study are shown. Arrows indicate differential ER expression (green) at the membrane (panels A and D) and equal caveolin 1 expression (red) (panels B and E). The strong colocalization of wt ER ${alpha}$ and caveolin 1 (yellow) (arrow, panel C) is not seen for ER ${alpha}$ S522A (arrow, panel F). (F) Total specific binding of labeled E2 to membranes (left) or nuclei (center) in CHO cells expressing either S10A, S582A, or S522A mutant ER ${alpha}$ or wt ER ${alpha}$ . Data are combined from three experiments. *, P < 0.05 for ER ${alpha}$ S522A versus wt ER ${alpha}$ or other S-to-A mutant receptors. (Right) Protein blot demonstrating the purity of the membrane preparation. Caveolin 1 (Cav1) and 5' nucleotidase (5'NT) are integral membrane proteins, while transportin and NTF-2 are nuclear proteins. ß-COP is a Golgi protein.

View this table:
[in this window]
[in a new window]
TABLE 1. Binding characteristics of wt or S522A mutant mouse ER ${alpha}$ expressed in the nuclei and membranes of CHO-K1 cells

In contrast, binding experiments revealed that expression ofthe S522A mutant ER ${alpha}$ resulted in 62% fewer receptors (B_max) inthe PM than expression of wt ER ${alpha}$ (Fig. 1A insets; Table 1). Thiswas found in three separate binding experiments, where the reductionranged from 57 to 65%. The binding affinities (K_d) for E2 atthe membrane were comparable for wt and mutant receptors. Thus,serine 522 is an important determinant for full membrane localizationof ER ${alpha}$ .

It is possible that serine 522 is a phosphorylation site, althoughthis would not be a common mechanism for membrane localization.By mass spectroscopy, there was no evidence of phosphorylationon this residue. We also expressed the full-length wt ER, theS522A mutant, or the E domain (ligand binding domain) of wtER ${alpha}$ in CHO cells, targeting the E domain to both nuclear andmembrane locations. As seen in Fig. 1C, the entire receptoris phosphorylated at serine/threonine residues, but we findno evidence that the intact E domain is similarly phosphorylated,either when targeted to the membrane or when targeted to thenucleus.

To visualize the receptor at the membrane, we expressed GFP-taggedwt or S522A mutant ER ${alpha}$ in CHO cells and detected membrane localizationby confocal microscopy. As seen in Fig. 1D, wt receptor expressionclearly reveals a population of membrane-localized sex steroidbinding proteins, while the mutant receptor does not. Both showa dense nuclear population. We also examined colocalizationof the wt or mutant ER ${alpha}$ at the membrane with caveolin 1. In Fig.1E, wt ER ${alpha}$ was clearly seen at the membrane (arrow, panel A),in contrast to sparse membrane expression of ER ${alpha}$ S522A (panelD). Caveolin 1 was clearly visualized at the membrane (Fig.1E, panels B and E). Colocalization of membrane wt ER ${alpha}$ with caveolin1 (Fig. 1E, panel C, arrow) was also seen for the S522A receptor(panel F), but the latter showed decreased amounts colocalized,reflecting a decreased number of receptors at the membrane.

We next compared the binding of wt or S522A mouse ER ${alpha}$ to thatof S10A and S582A ER ${alpha}$ constructs expressed in CHO cells (Fig.1F). Total specific binding of E2 was determined in the nucleusand PM and revealed that both of the two additional mutant receptorswere very similar to the wt receptor in both compartments. Bycomparison, S522A expression again exhibited significantly lowerbinding at the membrane only. These data indicate the specificityof S522 for ER localization at the cell surface.

Dissection of the contribution of other domains of ER ${alpha}$ to membrane localization and function. It is possible that elements contained within other domainsof ER ${alpha}$ contribute importantly to membrane localization. In thisrespect, Schlegel et al. (37) have recently shown that residues1 to 282 (the A/B and C domains) of human ER ${alpha}$ bind to caveolin1, a largely membrane localized protein that facilitates membranelocalization of ER (31) and that, when overexpressed, promotesnuclear ER localization and transcriptional action. We thereforeasked whether mutant ER ${alpha}$ that lacked either the A/B or the Cdomain was capable of localizing to the PM and signaling toERK. We compared the effects of CHO cells expressing these deletionor truncation mutants to those of CHO cells expressing wt ER ${alpha}$ .We found that HE11G (with the A/B domain deleted) and H19G (withthe C domain deleted) were comparable to wt ER ${alpha}$ , both in specificbinding of E2 at the cell membrane and in ERK activation bythe steroid (Fig. 2). In contrast, a mutant with helix 12 andthe F domain deleted, HEG0-537 (truncated at residue 537), specificallybound little E2 in either the nuclear or the membrane compartmentand did not support E2 activation of ERK. Thus, the A/B andC domains do not contribute to membrane ER localization andsignaling by E2. However, deleting a small but important regionwithin the E domain (in conjunction with loss of the F domain)has a profound effect on E2 binding to any ER pool, as wellas on membrane function. Further understanding of the specificresidues within the E domain that are required for ER localizationat the membrane will require the characterization of a veryextensive series of conservative mutations within this region.These results support a focus on the E domain for further understandingof the compartmentalization of ER.

View larger version (22K):
[in this window]
[in a new window]
FIG. 2. (A) Binding of E2 to the nuclei and membranes of CHO cells expressing either HE11G (A/B domain deleted), HE19G (C domain deleted), or HEG0-537 (helix 12 and F domain deleted) ER ${alpha}$ or wt ER ${alpha}$ . The study was repeated. (B) ERK activation in response to E2 in CHO cells expressing either wt ER ${alpha}$ or a deletion mutant. Activity was determined after 8 min of incubation with 10 nM E2. MBP was used as a substrate for ERK activity. Total ERK protein is shown on the immunoblot beneath the activity results.

ER ${alpha}$ S522A is less capable than wt ER ${alpha}$ of signaling from the membrane. It was important to ascertain whether the loss of membrane receptorsresulting from expression of the S522A mutant also affectedsignal transduction. We therefore compared ERK (MAP kinase)activation by E2 in CHO cells expressing wt or mutant ER ${alpha}$ . E2significantly stimulated ERK activity after 8 min of exposureto CHO cells expressing wt ER ${alpha}$ (Fig. 3A, left). However, ERKactivation in response to E2 was reduced by 68% in CHO cellsexpressing ER ${alpha}$ S522A (relative to activation in cells expressingwt ER ${alpha}$ ) (Fig. 3A, left; compare lanes 2 and 4). Activation ofERK by E2 was further compared in CHO cells that expressed wtor S10A or S582A mutant receptors. Consistent with the bindingdata, the additional serine mutants were nearly identical tothe wt in activation of this MAP kinase (Fig. 3A, right).

View larger version (118K):
[in this window]
[in a new window]
FIG. 3. (A) (Left) ERK activity is stimulated by E2 in CHO cells expressing wt ER ${alpha}$ but less so in CHO cells expressing S522A mutant ER ${alpha}$ . *, P < 0.05 for E2 versus the control (mouse ER ${alpha}$ [mER ${alpha}$ ] without E2) in three combined experiments; +, P < 0.05 for ERK response to E2 in CHO cells expressing wt ER ${alpha}$ (lane 2) versus ER ${alpha}$ S522A (lane 4) in three combined experiments. (Right) Comparable stimulatory effects by E2 on ERK activity in CHO cells expressing wt ER ${alpha}$ or the S10A or S582A mutant (lanes 3 to 8). Lanes 1 and 2 show that the intrinsic ERK activity of CHO cells expressing the empty vector, pcDNA3, cannot be stimulated by E2, due to a lack of endogenous ER. *, P < 0.05 for control versus E2. (B) Generation of cAMP in response to E2 in CHO cells expressing wt or S522A mutant ER. (C) IP3 generation in response to E2 in the above cells. Bar graph data are means ± standard errors of the means from triplicate determinations per experiment and are from two (cAMP) or three (IP3) combined studies. (D) Targeting ER to the membrane but not the nucleus allows E2 to rapidly activate ERK. CHO cells were transfected to express either nontargeted wt mER ${alpha}$ or wt mER ${alpha}$ targeted to the nucleus (mER ${alpha}$ -ECFP-nucl.) or the membrane (mER ${alpha}$ -ECFP-memb.). Cont., control. The study was repeated.

We then examined cAMP generation, reflecting adenylate cyclaseactivation in the membrane, and found that E2 was 57% less capableof generating this cyclic nucleotide in S522A mutant-expressingthan in wt ER ${alpha}$ -expressing CHO cells (Fig. 3B). Generation ofcAMP often arises from G ${alpha}$ s stimulation, which was previouslydemonstrated in response to membrane ER activation by E2 (32).Finally, we measured IP generation (Fig. 3C) and found a significant(53%) difference in production between cells expressing thetwo types of ER ${alpha}$ . IP generation commonly results from the activationof G ${alpha}$ q, which was previously shown to be stimulated by E2 activationof membrane ER expressed in CHO cells (32). These data indicatethat the reduction in membrane ER levels seen with S522A proteinexpression has significant functional consequences, and theyfurther support the idea that E2 activates signal transductionthrough the membrane (and not the nuclear) receptor. To furthersupport the latter concept, we subcloned the full-length wtER ${alpha}$ into vectors that contain membrane or nuclear localizationsignals and also express a GFP fusion protein (ECFP; Clontech).We then expressed in CHO cells either nontargeted wt ER ${alpha}$ or wtER ${alpha}$ targeted either to the membrane or to the nucleus. As seenin Fig. 3D, expression of the nontargeted wt ER ${alpha}$ and especiallythe membrane-targeted receptor supported rapid ERK activationby E2. In contrast, there was no activation of ERK in CHO cellsexpressing nucleus-targeted ER. Combined with previous experimentstargeting the E domain to the membrane or nucleus (31), thesedata show that it is the membrane ER that supports rapid kinaseactivation in response to E2.

Palmitoylation, myristylation, and glucosylphosphoinositol (GPI) anchor studies addressing ER localization at the membrane. A number of posttranslational (or cotranslational) processeshave been found to facilitate the movement and anchoring ofproteins in the PM. To determine whether any of these alterationshelped explain how ER localized to the membrane, we examinedlipid modifications of ER. We expressed the wt mouse ER ${alpha}$ in CHOcells and then labeled the cells with [³H]palmitate or myristicacid. As expected, there was no uptake or incorporation of eitherlipid into the nuclear ER ${alpha}$ . Furthermore, we found that therewas no incorporation of myristate into the membrane ER ${alpha}$ , consistentwith the lack of a consensus myristylation site determined eitherfrom our partial sequence of membrane ER ${alpha}$ or from viewing theknown full-length sequence (48). Similarly, a possible but nonclassicpalmitoylation site was identified from a peptide correspondingto a region in the mouse ER ${alpha}$ C terminus, encompassing serine522. However, in the membrane, there was no specific incorporationof palmitate into ER ${alpha}$ in either the presence or the absence ofE2 (data not shown). Other modifications, such as farnesylationor geranylgeranylation, usually require concomitant palmitoylationand occur at the very end (usually the N terminus) of the protein.No such sites were identified. Thus, we conclude that ER ${alpha}$ isprobably not posttranslationally lipidated to effect membranetranslocation.

Addition of GPI to a protein in the Golgi complex serves toanchor such modified proteins in the extracellular leaflet ofthe PM (21). The PI-PLC enzyme cleaves GPI-modified proteinsand therefore releases these membrane proteins into the culturemedium, so that they cannot be detected by binding ligand atthe cell surface. We found that treatment of the ER-expressingCHO cells with this phospholipase did not change the bindingof E2 to ER in the PM. Furthermore, the anchoring of ER in theouter leaflet of the PM would generally preclude its localizationin the caveolae, a membrane domain where ER has now been detected(6, 13). Thus, it is unlikely that ER undergoes this posttranslational(cotranslational) modification.

Interactions of wt or S522A mutant ER ${alpha}$ with caveolin 1. It was recently reported that endogenous ER physically associateswith the caveolin 1 protein in both the PM and cytosol of endothelial,vascular smooth muscle, and MCF-7 cells (31). Furthermore, expressionof full-length caveolin 1 in MCF-7 or Caco-2 cells facilitatesthe movement of ER from the cytosol to the PM. Thus, ER-caveolinbinding is important for the ability of ER to localize to thePM. We therefore examined whether the S522A mutant receptorbound to caveolin 1 comparably to wt ER ${alpha}$ . This was accomplishedin CHO cells, where we expressed the two ER constructs and utilizedthe endogenous caveolin in these cells. The ER was immunoprecipitatedfrom the CHO cells, followed by immunoblotting for caveolin1 (and vice versa), and association was examined in the absenceof E2. In the cytosol of CHO cells, expression of either wtor S522A mutant ER ${alpha}$ resulted in the receptor complexing withendogenous caveolin 1. However, the association of ER ${alpha}$ S522Awith caveolin 1 was 60% lower than that of wt ER ${alpha}$ (Fig. 4). Importantly,as shown, the total ER levels expressed from the two vectorswere comparable. These data are compatible with the idea thatS522 is important for binding to caveolin 1, a protein thatfacilitates the membrane localization of the steroid bindingprotein (31). Thus, we have identified a mechanism to explainwhy ER ${alpha}$ S522A is poorly localized to the PM.

View larger version (22K):
[in this window]
[in a new window]
FIG. 4. ER ${alpha}$ and caveolin 1 (CAV-1) association in the cytoplasm. CHO-K1 cell cultures (100-mm-diameter dishes) were transfected with 10 µg of wt or S522A mutant ER ${alpha}$ plasmid DNA. The cells were lysed, and immunoprecipitation for caveolin 1 was carried out, followed by immunoblotting for ER ${alpha}$ (left panels); or the order was reversed (right panels). Results shown are representative of three experiments. Caveolin 1 and ER ${alpha}$ immunoblots are shown (lower panels) to demonstrate equal gel protein loading and equal expression of the two ER. mER ${alpha}$ , mouse ER ${alpha}$ .

Expression of S522A inhibits endogenous membrane ER function. We then asked whether the expression of ER ${alpha}$ S522A interfereswith the function of endogenous E2-ER signaling from the membrane.To test this hypothesis, we transiently expressed ER ${alpha}$ S522A inMCF-7 and ZR-75-1 breast cancer cells. It was previously shownthat E2 induced rapid signaling from membrane ER in these cells(33). In MCF-7 cells transfected to express pcDNA3 (control),E2 caused a twofold activation of ERK activity via the endogenousmembrane ER (Fig. 5A, left; compare lane 1 with lane 2). Incontrast, ER ${alpha}$ S522A-expressing cells responded to E2 with 61%less activation of ERK (Fig. 5A, left; compare lanes 1 and 2with lanes 3 and 4). Comparably, ER ${alpha}$ S522A expression resultedin a 70% decrease in ERK activation in E2-treated ZR-75-1 cells(Fig. 5A, right; compare lanes 1 and 2 with lanes 3 and 4).We also determined that activation of ERK by epidermal growthfactor (EGF) or IGF-1 in MCF-7 cells (Fig. 5B, first three columns)was not significantly affected by expression of the mutant ER(last three columns). This demonstrates the specific actionof ER ${alpha}$ S522A to impair only E2-ER signaling, and it also indicatesthat signaling by the two growth factors does not require anintact membrane ER signaling system. To further establish thespecificity of these results, we expressed the S10A mutant inMCF-7 cells. There was no difference in ERK activation in responseto E2 between cells expressing only endogenous ER (pcDNA3 transfected)and the same cells additionally transfected with ER ${alpha}$ S10A (datanot shown).

View larger version (75K):
[in this window]
[in a new window]
FIG. 5. (A) Expression of ER ${alpha}$ S522A inhibits E2 activation of ERK. MCF-7 (left) or ZR-75-1 (right) breast cancer cells (which express endogenous ER) were transfected transiently to express either pcDNA3 (control) or S522A mutant ER ${alpha}$ . The cells were then exposed to 10 nM E2 for 8 min, after which they were lysed, and immunoprecipitated ERK was assayed for activity by using MBP as a substrate. Precipitated ERK protein is shown in the lower gels, and the bar graphs each reflect three experiments combined. *, P < 0.05 for pcDNA3 in the absence versus the presence of E2; +, P < 0.05 for comparison of E2 treatments of pcDNA3-expressing versus ER ${alpha}$ S522A-expressing cells. (B) ER ${alpha}$ S522A does not impair EGF or IGF-1 activation of ERK. Data from three experiments are combined. *, P < 0.05 for pcDNA3-transfected or ER ${alpha}$ S522A-expressing MCF-7 cells in the absence versus the presence of EGF or IGF-1. (C) E2 comparably activates an ERE-luciferase reporter in untransfected MCF-7 cells and MCF-7 cells transfected to express ER ${alpha}$ S522A. Bar graph shows results for three experiments combined. *, P < 0.05 for pcDNA3- or ER ${alpha}$ S522A-transfected MCF-7 cells without versus with E2.

The inability of ER ${alpha}$ S522A to fully localize to the membranecontrasted with the normal amount and function of nuclear ERwhen this construct was expressed in CHO cells. We thereforedetermined the specificity of S522A to serve as a dominant-negativeprotein in MCF-7 cells for membrane but not nuclear ER. MCF-7cells were transiently transfected with an ERE-luciferase reporterin the presence or absence of coexpression of ER ${alpha}$ S522A or pcDNA3.In pcDNA3-expressing cells, E2 caused a dose-related, 2.5-foldmaximal stimulation of luciferase function (Fig. 5C). When theS522A mutant was expressed in these cells, transactivation ofthis reporter by E2 was comparable. This indicates that expressionof the mutant ER ${alpha}$ did not affect endogenous nuclear ER function.

To understand the cell biological effects of S522A expressionand the role of the endogenous membrane ER ${alpha}$ , we examined theability of estrogen to promote cyclin D1 protein expressionand cdk4 activation in MCF-7 cells. It has previously been shownthat, in response to growth factors, signaling through ERK toEts protein phosphorylation transactivates the cyclin D1 promoterand stimulates cyclin D1 protein synthesis (1, 15). E2 has beenshown to stimulate cyclin D1 transcription and protein synthesis(47). We found that E2 was capable of increasing cyclin D1 proteinlevels nearly threefold (Fig. 6A). This was significantly relatedto ERK activation, since the MEK inhibitor PD98059 substantiallyprevented this effect. It was previously shown that PD98059completely blocked E2 activation of ERK in MCF-7 cells (34).Importantly, expression of ER ${alpha}$ S522A inhibited the E2-inducedincrease in cyclin D1 protein levels by 68%. Thus, the abilityof ER ${alpha}$ S522A to inhibit ERK activation arising from the endogenousmembrane ER greatly contributed to the inhibition of the increasein cyclin D1 protein levels.

View larger version (23K):
[in this window]
[in a new window]
FIG. 6. (A) Cyclin D1 expression is increased in response to E2 and is dependent on ERK activation in wt MCF-7 cells. MCF-7 cells transfected to express ER ${alpha}$ S522A show a lower response to 100 nM E2. Data are representative of three experiments, which were combined for the bar graph. *, P < 0.05 for pcDNA3-expressing cells without versus with E2; +, P < 0.05 for cells incubated with pcDNA3 plus E2 versus the same condition plus 10 µM PD 98059, or versus cells cotransfected with ER ${alpha}$ S522A. (B) cdk4 activity is significantly downregulated by ER ${alpha}$ S522A in MCF-7 cells. Cells were transfected with pcDNA3 or the mutant ER and exposed to 10 nM E2 for 6 h. cdk4 kinase was immunoprecipitated, and an in vitro assay of activity was accomplished by using Rb protein as a substrate. Bar graph data are from three experiments combined. (C) E2-stimulation of p38ß activity in endothelial cells is inhibited by ER ${alpha}$ S522A. Transfected endothelial cells were incubated with E2 for 20 min, and p38ß activity was determined against the substrate protein ATF-1. Data are from three experiments.

We then determined the effect of E2 signaling on cdk4 activity.We found that E2 stimulated the important phosphorylation ofthe retinoblastoma (Rb) protein by this kinase 2.5-fold (Fig.6B). Inactivation of Rb results from its phosphorylation mainlyby cyclin D1-cdk4 and possibly by cyclin E-cdk2 and allows G₁/Sprogression in many cell types (39). Expression of S522A resultedin a 70% decrease in the ability of E2 to activate cdk4 activity.The results indicate that signaling from the membrane ER isimportant for a G₁ event that is essential to breast cancercell cycle progression.

We also assessed G₁/S progression, determined by thymidine incorporationinto DNA. It has previously been shown in MCF-7 or ER-expressingCHO cells that E2 stimulation of DNA synthesis is partly regulatedthrough the ERK signaling pathway (5, 32). We found here thatE2 caused a 70% increase in thymidine incorporation into DNA,a marker of the S phase. Two-thirds of this increase was blockedby PD98059. Thus, E2 utilizes several mechanisms to stimulateG₁/S progression, but ERK activation is the most important.Upon expression of ER ${alpha}$ S522A, E2-induced thymidine incorporationwas significantly reduced, by 50%. Thus, expression of the mutantER ${alpha}$ affirms the participation of the membrane steroid receptorin this event.

It would be important to know if the dominant-negative effectof the S522A mutant ER ${alpha}$ extended to other cells. It was previouslyshown that E2 activates p38ß MAP kinase in endothelialcells through endogenous membrane ER and that this leads tothe angiogenic and cell survival effects of E2 in these cells(33). Here, we report that E2 activation of p38ß inendothelial cells is 60% reduced when ER ${alpha}$ S522A is expressed(Fig. 6C). Thus, this mutant ER may be a useful tool for determiningthe contributions of the membrane ER ${alpha}$ to various cell-signalingand biological functions.

Mechanisms of ER ${alpha}$ S522A inhibition of endogenous ER function. How might ER ${alpha}$ S522A inhibit endogenous ER function? One possibilityto explain the dominant-negative effect of ER ${alpha}$ S522A is thatit might heterodimerize with wt ER. Dimerization is necessaryfor ER to transactivate genes (43), and heterodimerization betweenER ${alpha}$ and ERß has been reported to inhibit ER ${alpha}$ function(29). Since the S522A mutant does not translocate effectivelyto the PM, it could potentially bind and sequester the endogenousreceptor, thus interfering with its signaling function. To assesspossible heterodimerization, we expressed GFP-tagged ER ${alpha}$ S522Aand His-tagged wt ER ${alpha}$ in CHO cells and performed pulldown studies.After lysis, the cell extracts were immunoprecipitated and blottedwith anti-GFP and anti-His antibodies, in both orders. AfterE2 treatment of cells where either or both tagged forms of thereceptor were expressed, we found evidence for homodimerizationand heterodimerization of wt and mutant ER ${alpha}$ (Fig. 7A). As specificitycontrols, the fourth lanes show a lack of ER when His-taggedwt ER ${alpha}$ is expressed and immunoprecipitated but blotting is donewith an antibody to GFP (Fig. 7A, left), and when GFP-taggedER ${alpha}$ S522A is expressed but blotting is done with an antibodyto His (Fig. 7A, right). Furthermore, S522A mutant ER ${alpha}$ was ascapable as wt ER ${alpha}$ of dimerizing to wt ER ${alpha}$ (Fig. 7A, left). Thesedata indicate that ER ${alpha}$ S522A can bind to wt ER ${alpha}$ , thereby potentiallysequestering or otherwise limiting endogenous receptor signalingfrom the membrane.

View larger version (153K):
[in this window]
[in a new window]
FIG. 7. (A) Homo- and heterodimerization of wt and ER ${alpha}$ S522A after expression in CHO cells. Doubly or singly transfected cells were first exposed to 10 nM E2 for 10 min and then lysed, and the lysate underwent immunoprecipitation (IP) with an antibody to His or GFP, as indicated, eventually followed by blotting with an antibody to GFP (left) or to His (right). Proteins were separated by SDS-PAGE under nonreducing conditions (native gel). Molecular weight markers indicate the different sizes of the GFP-tagged wt ER ${alpha}$ and His-tagged ER ${alpha}$ S522A homodimers and the intermediate size of the heterodimer. (B) Expression of S522A prevents wt ER ${alpha}$ localization at the membrane. CHO cells were transfected with equal amounts of plasmids encoding GFP-tagged wt ER ${alpha}$ plus His-tagged wt ER ${alpha}$ (10 µg of total DNA/100-mm-diameter dish) or with GFP-tagged wt ER ${alpha}$ plus His-tagged ER ${alpha}$ S522A. Localization of receptors was determined by confocal microscopy. (C) wt and S522A mutant ER ${alpha}$ equally associate with Ras, Raf, or Src at the membrane. (Left) CHO cells were transfected to express either receptor, and after normalization, equal receptor protein aliquots were confirmed by Western blotting. Equal protein aliquots were used for immunoblots to determine wt or mutant ER ${alpha}$ association with Ras or Raf. The study was carried out in the presence of 10 nM E2 for 10 min and was repeated. Immunoprecipitation with no antibody (ab) or an irrelevant antibody to the endothelin-1 peptide did not yield a protein band. (Right) MCF-7 cells were transfected with His-tagged ER ${alpha}$ S522A (lanes 2 and 3) or with His-tagged pcDNA3 (lane 1) and were incubated or not with 10 nM E2 for 10 min. The cells were lysed and immunoprecipitated for ER ${alpha}$ (lane 1) or for His (lanes 2 and 3), then immunoblotted for Src. Expression of His-tagged pcDNA3 did not coprecipitate Src (data not shown).

To further examine this mechanism, we determined the membranelocalization of wt ER ${alpha}$ in CHO cells transfected to express equalamounts of either (i) GFP-tagged wt ER ${alpha}$ plus His-tagged wt ER ${alpha}$ or (ii) GFP-tagged wt ER ${alpha}$ plus His-tagged ER ${alpha}$ S522A. As seen inFig. 7B, expression of ER ${alpha}$ S522A substantially decreased themembrane localization of GFP-tagged wt ER ${alpha}$ . By contrast, nuclearreceptor expression was not different. Thus, ER ${alpha}$ S522A inefficientlytranslocates to the cell surface and also prevents wt ER ${alpha}$ PMlocalization after heterodimerization. These results providea mechanism for the dominant-negative action of the mutant ER ${alpha}$ ,but other effects are tenable.

Membrane wt ER ${alpha}$ and S522A mutant ER ${alpha}$ bind equally to signaling molecules. It is also important to consider that mutation of serine 522to alanine might disturb the inherent ability of membrane ERto associate with important signaling molecules. This couldcontribute to the differential signaling from the membrane bywt versus S522A mutant ER ${alpha}$ . To investigate this, we transfectedCHO cells to express either wt or S522A mutant ER ${alpha}$ . We immunoprecipitatedthe ER from membrane preparations and then normalized the proteinsfor equivalent amounts of receptor(s), as indicated by Westernblotting (Fig. 7C). We then took separate (normalized) aliquotsof immunoprecipitated wt ER ${alpha}$ or ER ${alpha}$ S522A and immunoblotted thealiquots for Ras or Raf. We found that the two receptors associatedequally with the Ras or Raf signaling molecules in the presenceof the steroid (Fig. 7C, left). Control immunoprecipitationswithout an antibody or with an irrelevant antibody to endothelin-1(ET-1) did not bring down a Ras or Raf protein band. Especiallyimportant is the association of ER with Src, which has beenreported to bind to tyrosine 537 of ER ${alpha}$ (24). We examined theeffect of expression of ER ${alpha}$ S522A on subsequent Src associationwith ER in MCF-7 cells. As seen in Fig. 7C (right), endogenousER ${alpha}$ associated with Src comparably to the S522A mutant receptor,and this was unaffected by E2. This suggests that there is noalteration of association with important signaling moleculesby ER ${alpha}$ S522A that can account for the differences in signalingfrom the membrane. Thus, we believe that it is primarily themembrane receptor number that determines the differences insignaling.

DISCUSSION

Top

Discussion

The presence of a PM ER in human cells that enacts signal transductionand thereby contributes to the cellular effects of E2 is increasinglyaccepted (14, 33, 34, 40, 49). E2 signaling through PI 3-kinasein vivo rescues muscle from ischemia-reperfusion injury (40),while activation of ERK prevents breast cancer (34) or osteoblast(14) cell death. Recently, Marquez and Pietras have shown thatadministration of antibodies to ER ${alpha}$ in nude mice blocked thegrowth of human breast cancer xenografts (23). This probablyresulted from inhibition by the antibodies of membrane ER signalingto ERK and PI 3-kinase. Spatially, the receptor appears to belocalized primarily but not exclusively to caveolar fractionsof the PM (6, 13). In this confined area, ER potentially interactwith a variety of signaling molecules that must localize tothe PM for activation. The PM ER acts as a G protein-coupledreceptor, directly (31, 50) or indirectly (10), leading to activationof multiple signaling pathways. This results in cAMP generation(4), PLC and inositol triphosphate (IP3) activation (16, 41),and the stimulation of cascades leading to enhanced activityof ERK, JNK, and p38 MAP kinases (23, 32, 33). The importanceof these nongenomic mechanisms of estrogen action is analogousto that of the actions of steroids in plants. In Arabidopsisspp., brassinosteroids mediate plant cell developmental growthand fertility (22), and cell action results from steroid bindingto a transmembrane, tyrosine kinase receptor protein (44). Thus,steroid action at the cell surface is an ancient function conservedfrom plants to humans, further indicating its importance.

One important issue with regard to the cell surface ER thatwe addressed here is the structural requirements for a populationof ER to translocate to the PM. We found that ER are not posttranslationallylipidated, as occurs with other PM-localized proteins. Rather,we identified serine 522 as important for membrane translocation.Compared to expression of wt mouse ER ${alpha}$ , mutation of this serineto alanine resulted in 62% fewer receptors expressed at themembrane, with little influence on receptor affinity for ligand.However, there was no appreciable effect on the nuclear receptornumbers, affinity, and function (transactivation of an ERE-luciferasereporter). Furthermore, expression of the S522A mutant receptorwas markedly less efficient in supporting E2-induced ERK activation,cAMP generation, and stimulation of IP3 than wt receptor expression.Presumably, reduced signaling resulted from a decreased numberof receptors available at the membrane. Supporting this, wedid not find a loss of association at the membrane between S522Amutant ER ${alpha}$ and signaling molecules, compared to that for wt ER ${alpha}$ .However, this receptor can serve as a dominant-negative proteinfor wt ER when expressed in MCF-7 cells, and therefore additionalmechanisms of abolishing signal transduction may be relevant(see below). Supporting the specificity of our results, we foundthat substitution of alanine for serine at residues 10 and 582of the mouse ER ${alpha}$ had no effect on either E2 binding to the membraneor signaling by E2, when these mutants were compared to wt ER ${alpha}$ .

How does ER ${alpha}$ localize to the membrane, and how does S522 contribute?It was recently determined that caveolin 1 protein facilitatesthe translocation of ER to the PM and that the two endogenousproteins physically bind in both the cytosol and the PM (31).The scaffolding domain of caveolin 1 (amino acids 82 to 101)is essential for this protein to move from the cytosol to themembrane (3, 27), and we determined that the scaffolding domainfacilitates ER movement to the PM. An important question, then,is whether serine 522 is necessary for the association of ER ${alpha}$ and caveolin 1. We report here that in the cytoplasm, the physicalassociation between these two proteins was 60% decreased bythe mutation of serine 522. In contrast, association of caveolinwith S10- or S582-mutated ER ${alpha}$ was comparable to that with wtER (data not shown). It has recently been shown that residues1 to 282 of ER ${alpha}$ bind to caveolin 1 (37). However, Lu et al. recentlyshowed that caveolin 1 associates with the androgen receptorthrough both N-terminal (A/B domain) and E domain elements (20).We found that an A/B domain deletion mutant ER ${alpha}$ localizes tothe membrane and supports E2 signaling to ERK equivalently towt ER ${alpha}$ . Thus, the interaction between caveolin and the N terminusof ER may not be functionally important for the membrane ER.

What supports the relevance of S522A for ER action at the membrane?Kousteni et al. showed that by targeting only the E domain ofER ${alpha}$ to the PM but not to the nucleus, E2 could rescue cells fromapoptotic death (14). It was recently demonstrated that theE domain (and here the full-length ER) is sufficient to conveyrobust ERK activation in response to E2 when targeted to thePM (31). These overall findings suggest that the E domain isgenerally important for ER ${alpha}$ actions originating at the membrane.Identification of serine 522 provides a novel insight into thespecific structural requirements for membrane localization,steroid action, and cell biological functions of E2. We suggestthat similar examination of the role of the ligand binding domainsof the progesterone, androgen, and other steroid receptors iswarranted.

To establish the roles of the membrane ER in cell biology, severalapproaches could be taken. Targeting of ER to only one compartmentin the cell may suggest a specific function for a pool of theendogenous receptor. Another approach is to devise specificagonists or antagonists for the membrane ER, reagents that donot enter the cell to bind the nuclear receptor. Several ERagonists have recently been described that dissociate some membranesignaling from transcriptional activity (14). However, ER signalingthrough the membrane receptor stimulates gene transcription(9, 46), and thus, these two functions may not always reflectmembrane versus nuclear receptor action. A third approach isto express mutant sex steroid receptors that specifically interferewith endogenous ER actions at the membrane. We show here inMCF-7, ZR-75-1, and endothelial cells that ER ${alpha}$ S522A is capableof significantly preventing E2 signaling from the endogenousmembrane receptor. We propose that this could result from preventingendogenous ER localization at the membrane. Since the dimerizationmotifs for ER ${alpha}$ do not involve serine 522, we reasoned that wtand mutant ER could heterodimerize and thus sequester wt ERfrom localizing fully at the PM. Supporting this, we provideevidence of heterodimerization between the mutant and wt ER ${alpha}$ and a loss of membrane wt ER ${alpha}$ when both receptors are coexpressed.

In MCF-7 or ZR-75-1 breast cancer cells, expression of ER ${alpha}$ S522Ainterfered with endogenous ER function. Expression of ER ${alpha}$ S522Ainhibited E2-induced ERK activation, cyclin D1 production, cdk4activity, and G₁/S progression. Many of these actions of E2require signaling from the membrane to kinases such as ERK.Furthermore, the utility of this approach was shown in a secondcell type, where membrane E2-ER signaling to p38ßMAP kinase (33) was significantly prevented by expression ofER ${alpha}$ S522A. The strong inhibition of cyclin D1 protein in MCF-7cells by ER ${alpha}$ S522A expression and the linkage to modulation ofERK activity suggests an important therapeutic interventionin breast cancer. In vitro, E2 induction of cyclin D1 overcomesthe tamoxifen-induced G₁/S cell cycle block (47). Also, tamoxifensensitivity can be restored through p27 function, resultingfrom ERK downregulation (8). In this respect, limiting endogenousmembrane ER signaling to ERK (19) and cyclin D1 may be therapeuticallydesirable, as suggested by our use of the S522A mutant ER ${alpha}$ . Ithas also been recently reported that specifically cyclin D1is essential to the development of rodent breast cancer, resultingfrom Ras or Neu oncogene signaling (51). Cyclin D1 has severalimportant functions, but arguably the most important is theregulation of the inactivating phosphorylation of the Rb proteinby cdk4, allowing E2F release and the subsequent transcriptionof genes that drive cell cycle progression in breast cancer(39). Our demonstration that ER ${alpha}$ S522A significantly limits theseevents both points out therapeutic targets and reveals the importanceof E2 signaling from the membrane. The ultimate goal of hormonereplacement after the menopause is to activate specific, desirableeffects of sex steroids (osteoblast survival) without invokingunwanted actions (breast cancer proliferation). This strategywill be best served by defining the array of discrete actionsof E2 that result from binding at membrane and nuclear ER invarious target cells. Expression of ER ${alpha}$ S522A may be very usefulin this regard.

ACKNOWLEDGMENTS

This work was supported by grants from the Research Serviceof the Department of Veterans Affairs, the Avon Products BreastCancer Research Foundation, the Department of Defense BreastCancer Research Program (grant BC990915), and the NIH (HL-59890)(to E.R.L.).

We thank M. Lisanti for caveolin plasmids.

FOOTNOTES

* Corresponding author. Mailing address: Medical Service (111-I), Long Beach VA Medical Center, 5901 E. 7th St., Long Beach, CA 90822. Phone: (562) 826-5748. Fax: (562) 826-5515. E-mail: ellis.levin{at}med.va.gov.

REFERENCES

Top