Previous Article | Next Article ![]()
Molecular and Cellular Biology, March 2003, p. 1961-1967, Vol. 23, No. 6
0270-7306/03/$08.00+0 DOI: 10.1128/MCB.23.6.1961-1967.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
-Actin Genes
Center for Cancer Research,1 Department of Biology,2 McGovern Institute for Brain Research, Massachusetts Institute of Technology, Cambridge, Massachusetts3
Received 23 July 2002/ Returned for modification 4 September 2002/ Accepted 19 December 2002
| ABSTRACT |
|---|
|
|
|---|
-actin genes have been used to study the association of Pol II with different regions of transcribed genes (promoter-proximal compared to distal regions) and the phosphorylation status of its CTD. For both genes, Pol II is more concentrated in the promoter-proximal regions than in the interior regions. Moreover, different phosphorylation forms of Pol II are associated with distinct regions. Ser-5 phosphorylation of Pol II is concentrated near the promoter, while Ser-2 phosphorylation is observed throughout the gene. These results suggest that the accumulation of paused Pol II in promoter-proximal regions may be a common feature of gene regulation in mammalian cells. | INTRODUCTION |
|---|
|
|
|---|
Studies with Saccharomyces cerevisiae using the chromatin immunoprecipitation (chromatin IP) assay have demonstrated that Pol II is uniformly associated with a transcribed gene from the promoter to the 3' end of the gene (14, 29). However, different phosphorylated forms of Pol II are associated with the gene at different stages of transcription. In the promoter-proximal region, the Ser-5-phosphorylated form is predominant. During elongation, Ser-5 is dephosphorylated while Ser-2 becomes phosphorylated (14). It was proposed that different phosphorylation forms of the Pol II CTD function at different stages of transcription to recruit appropriate factors, including the capping enzyme, elongation factors, and termination factors, to transcription sites. Indeed, recruitment of capping enzyme to the newly made transcripts is dependent on Ser-5 phosphorylation (5, 14, 21, 27, 29). The catalytic activity of the mammalian guanylyltransferase is stimulated by the phosphorylated CTD at Ser-5 (11). Moreover, other RNA processing events, such as splicing and polyadenylation, have been shown to be coupled to transcription via phosphorylation of CTD. The phosphorylated form of CTD has been demonstrated to stimulate splicing, while the hypophosphorylated form inhibits splicing. Furthermore, the phosphorylated form of CTD, but not the hypophosphorylated form, interacts with the splicing factors known as SR proteins (7, 9, 10, 22).
One basis of transcriptional regulation in higher eukaryotes is promoter-proximal pausing of Pol II. Escape of the paused Pol II is thought to represent a rate-limiting step in transcription (16, 17, 28, 33, 37). An increasing number of genes have been shown to be regulated by promoter-proximal pausing of Pol II. These genes include the Drosophila hsp70 and hsp26 genes, as well as the mammalian c-Myc and c-Fos genes (2, 6, 16, 23, 25, 33, 34). Studies of the Drosophila hsp70 heat shock gene promoter have demonstrated that promoter-proximal pausing of Pol II occurs after elongating 20 to 50 nucleotides downstream from the transcription initiation site (19). Using KMnO4 footprinting and nuclear run-on assays, Krumm and colleagues have shown that Pol II pauses in the promoter-proximal region of the Myc gene in both proliferating and differentiating cells (15, 16). However, there is a higher density of Pol II complexes engaged in elongation in the coding region in proliferating cells than in resting cells (16).
We have performed chromatin IP assays to address the distribution of different phosphorylated forms of Pol II along two endogenous genes, those encoding dihydrofolate reductase (DHFR) and
-actin, in mammalian cells. For both genes, Pol II is more concentrated in the promoter-proximal regions than in the interior regions. There is a distinct difference in the distribution of different phosphorylated forms of Pol II. Ser-5 phosphorylation of Pol II is concentrated near the promoter. Interestingly, Ser-2 phosphorylation of Pol II is found throughout the gene.
| MATERIALS AND METHODS |
|---|
|
|
|---|
80% confluent cells on a 10-cm plate were incubated with 10 ml of 1% formaldehyde in phosphate-buffered saline for 10 min at 37°C. Cross-linking reactions were stopped by addition of glycine to a final concentration of 0.125 M. Cells were then washed with phosphate-buffered saline and pelleted in an Eppendorf tube. One milliliter of buffer A (5 mM PIPES [pH 8.0], 85 mM KCl, 0.5% NP-40) was added to the cells and incubated for 20 min on ice. After spinning, the isolated nuclei were lysed in 200 µl of lysis buffer (1% sodium dodecyl sulfate [SDS], 10 mM EDTA, 50 mM Tris-HCl [pH 8.0]) for 10 min on ice. The 200 µl of lysate was diluted with immunoprecipitation buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl [pH 8.0], 167 mM NaCl) to a final volume of 2 ml and then subjected to sonication to obtain DNA fragments averaging approximately 200 to 500 bp in length. One-tenth of the total chromatin solution was used in each chromatin IP. Chromatin solutions were precleared and incubated with various antibodies prebound to protein A-Sepharose CL-4B beads or anti-mouse-immunoglobulin M-coupled protein A beads (H5 and H14 antibodies). The beads were washed five times in the following buffers: TSE-150 (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl [pH 8.0], 150 mM NaCl), TSE-500 (like TSE-150 but with 500 mM NaCl), buffer III (0.25 M LiCl, 1% NP-40, 1% deoxycholate, 1 mM EDTA, 10 mM Tris-HCl [pH 8.0]), and 2x Tris-EDTA buffer. Immunocomplexes were eluted from the beads with elution buffer (1% SDS and 0.5% NaHCO3) for 30 min at 65°C. The protein-DNA complex was then treated with proteinase K followed by reverse cross-linking at 65°C overnight. DNA was extracted with phenol-chloroform and precipitated with ethanol. Antibodies were obtained from the indicated sources: anti-capping enzyme, S. Shuman, Sloan-Kettering Institute; N20, Santa Cruz Biotechnology; C21, Santa Cruz Biotechnology; 8WG16, Covance; H5, Covance; H14, Covance; and p62, Santa Cruz Biotechnology. PCR analyses. Chromatin-immunoprecipitated DNA was subjected to PCR. For each chromatin IP, the resulting DNA was used as a template for PCRs with the set of primers along a gene. One-fortieth of the chromatin immunoprecipitate was added to a 20-µl reaction mixture containing 0.15 mM MgCl2, 2.5 mM deoxynucleoside triphosphates, and 1 U of Hotstar DNA polymerase. After denaturation at 95°C for 15 min, 30 cycles of PCR were performed; each cycle consisted of 1 min at 95°C, 45 s at 60°C, and 45 s at 72°C. Under these conditions, PCR product yield depended linearly on the amount of genomic DNA added to each reaction mixture. PCR products were analyzed on 2% agarose gels by ethidium bromide staining. PCRs using chromatin DNA before immunoprecipitation (input DNA) was performed for control of PCR amplification efficiency.
Real-time PCR using the Sybr green reagent was performed for quantification of DNA. Twenty microliters of reaction mixture containing 10 µl of 2x PCR mix (Applied Biosystems), primers, and genomic DNA were incubated in an ABI cycler. The PCR products were detected with the Sybr green reagent, which increases in fluorescent efficiency when intercalated into double-stranded DNA. Data were analyzed by SDS application (Applied Biosystems). For adjustment of amplification efficiency of each primer set, PCR signal intensities from chromatin-immunoprecipitated DNA were normalized to those from the input genomic DNA and expressed as a percentage of the input. Relative levels of Pol II association with regions along a gene were further determined by comparison of the normalized PCR signal intensities to that at the promoter region.
Primer sequences.
The following primer sequences correspond to those illustrated in Fig. 1, 2, and 4 to 6: DHFR-1-forward, ACCTGGTCGGCTGCACCT; DHFR-1-reverse, TTGCCCTGCCATGTCTCG; DHFR-2-forward, AACAGAATCTGGTGATTATGGG; DHFR-2-reverse, TACTGATCTCCACTATGAGACATG; DHFR-3-forward, GTTCTATAGTCACTGCATCTTAGTC; DHFR-3-reverse, TGCTAATTCTGGTTGTTCAGTAAG; DHFR-4-forward, GAGTATGTTTCTGTCTTAGATTGG; DHFR-4-reverse, ATGAGAACCTGCTCGCTGAC; DHFR-5-forward, TTGTTTCAGGGACAGGGTCTT; and DHFR-5-reverse, CTGTGGTGGGAAGATGGCT. The
-actin primers are as follows: Act-1-forward, GGAAAGATCGCCATATATGGAC; Act-1-reverse, TCACCGGCAGAGAAACGCGAC; Act-2-forward, GCTGTTCCAGGCTCTGTTCC; Act-2-reverse, ATGCTCACACGCCACAACATGC; Act-3-forward, GTGACACAGCATCACTAAGG; Act-3-reverse, ACAGCACCGTGTTGGCGT; Act-4-forward, TCTGTCAGGGTTGGAAAGTC; Act-4-reverse, AAATGCAAACCGCTTCCAAC; Act-5-forward, TGTGGATCGCTAGGAGTGGA; and Act-5-reverse, TGACAAGGCTGCAGAGCAAT.
|
|
|
|
|
-32P]UTP, followed by incubation at 30°C for 30 min. DNase I (25 U) and CaCl2 (final concentration, 10 mM) were then added to the mixture and incubated for 15 min at 30°C. The reactions were deproteinized with 80 µg of proteinase K in 1% SDS at 37°C for 2 h. The transcripts were phenol extracted, ethanol precipitated, and DNase I treated. The RNAs were then partially hydrolyzed in 0.2 M NaOH for 10 min on ice, and the reaction was quenched by the addition of HEPES buffer (pH 7.0) to a final concentration of 0.2 M. The transcripts were then ethanol precipitated and resuspended in 1 ml of hybridization buffer (10 mM Tris-HCl [pH 7.5], 0.1% SDS, 0.4 M NaCl, 10 mM EDTA, 2x Denhardt's reagent, 50 µg of salmon sperm DNA per ml, and 100 µg of tRNA per ml). Slot blot membranes were hybridized with the probe for 40 h at 65°C followed by washing in 2x SSC (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate) at 65°C for 1 h, 2x SSC with 10 µg of RNase A per ml at 37°C for 30 min, and 2x SSC with 0.5% SDS at 65°C for 1 h. The membrane was exposed with a phosphorimage screen. | RESULTS |
|---|
|
|
|---|
-actin gene has additionally been tested. For each gene tested, four PCR primer sets sampling the 5' end, the coding region, and the 3' untranslated region (UTR) were designed. Each primer set amplifies a PCR fragment approximately 120 to 150 nucleotides in length. In addition, a set of primers amplifying a nontranscribed intergenic region was used as an internal background control. As an initial test, we performed chromatin IP assays using an antibody against mammalian guanylyltransferase, a subunit of the capping enzyme. This enzyme has been clearly documented to catalyze cap formation at the 5' end of a transcript (30); therefore, we anticipated that antisera to this protein would immunoprecipitate segments from the 5' end of a gene when used in chromatin IP analysis. Indeed, this was observed; the PCR product from the 5' end of a gene was preferentially amplified (Fig. 1C). In contrast, little or no signal was detected in control experiments with either no antibody or a nonspecific antibody (Fig. 1C). Similarly, little or no signal was observed in the intergenic region (Fig. 1C, lane 5). The above results suggest that these experimental conditions can be used to measure the relative levels of different proteins across genes.
Accumulation of RNA Pol II at the promoter of the DHFR gene. Three different Pol II antibodies were used to examine the distribution of Pol II across the DHFR gene. 8WG16 is a Pol II antibody which preferentially recognizes the hypophosphorylated form of the CTD. N20 and C21 are antibodies against the N-terminal and C-terminal regions, respectively, of the large subunit of Pol II. These antibodies bind Pol II in a phosphorylation-independent manner, i.e., they recognize Pol II with either the hyperphosphorylated or the hypophosphorylated CTD. Figure 2A shows that the 8WG16 epitope specifically immunoprecipitated DNA from the promoter regions much more efficiently than from either the coding regions or the 3' end, which agrees with the findings that the hypophosphorylated form of Pol II is concentrated at the promoter (23). Interestingly, the N20 and C21 antibodies generated the same cross-linking pattern; that is, these epitopes immunoprecipitated DNA much more efficiently from the promoter regions than from the coding regions or the 3' end (Fig. 2A). In all three cases, little cross-linking occurred at the intergenic region (Fig. 2A, lane 5). In addition, cross-linking signals were not observed when a nonspecific antibody was used (data not shown). These results suggest that the density of Pol II in the 5'-proximal region of the DHFR gene is much higher than that in other downstream regions.
To determine relative levels of Pol II association between regions, real-time PCR analysis was performed, where multiple PCRs can be compared in the linear range of amplification even if these reactions acquire very different kinetics. As shown in Fig. 2B, the levels of Pol II association with different regions were compared to that at the promoter region. We observed that Pol II, recognized by either the 8WG16 or the N20 and C21 antibodies, is enriched at the promoter at least eightfold compared to the density in the coding region of the DHFR gene. This suggests that a significant fraction of Pol II is paused at the promoter region, perhaps with short nascent transcripts. Comparison of the quantitative levels of Pol II associated with the coding region to that of the intergenic background revealed no significant difference. Thus, the eightfold Pol II enrichment is a minimal estimate. The lack of detection of Pol II associated with the intergenic region is probably due to the low level of transcription of the DHFR gene (see below).
To further verify the high levels of occupancy of Pol II near the promoter and test whether they were engaged in elongation, we carried out a nuclear run-on assay under high-salt conditions, where the transcriptional engaged Pol II elongates for a short distance in the presence of a limiting, labeled nucleotide triphosphate. The elongating Pol II density at a particular region is then measured as a readout of newly synthesized transcripts from that region. This is a direct indication of the amounts of transcriptional engaged Pol II along the gene. We tested the level of run-on transcription at four different regions across the DHFR gene, similar to the chromatin IP experiments (Fig. 3). We observed that RNA produced by Pol II elongation hybridized primarily to the 5'-proximal region of the DHFR gene. Other regions of the gene showed little detectable signals. Quantification of these results indicated that the elongating Pol II was at least eightfold more concentrated near the 5'-proximal region than the internal regions.
Different phosphorylated forms of RNA Pol II associated with different regions of the DHFR gene. The RNA Pol II CTD repeat sequence YSPTSPS can be phosphorylated at Ser-2 and Ser-5. In yeast, Ser-5-phosphorylated Pol II is concentrated in the promoter-proximal region, while Ser-2-phosphorylated Pol II is associated with the coding region but not the promoter-proximal region (14). This suggested a dynamic change of serine phosphorylation of the Pol II CTD at the promoter-proximal region. In order to determine the distribution of Ser-2- and Ser-5-phosphorylated Pol II along the DHFR gene, chromatin IP assays were performed with antibodies H5 and H14, which recognize CTD repeats phosphorylated at Ser-2 and Ser-5, respectively (24). Consistent with the results in yeast, the H14 epitope (Ser-5 phosphorylation) cross-linked more strongly to the promoter-proximal region than to the coding region or 3' UTR of the DHFR gene (Fig. 4). Real-time PCR analysis revealed that at least 90% of the Ser-5-phosphorylated form is concentrated near the promoter. In contrast, the H5 epitope (Ser-2 phosphorylation) cross-linked to regions both near the promoter and in the coding regions (Fig. 4). In this case, about 50% of the Pol II which interacted with this monoclonal antibody was distributed across the coding regions. This suggests that phosphorylation of Pol II at the Ser-2 position occurs while the polymerase is promoter-proximal and remains during elongation. This unique occurrence of Ser-2 phosphorylation on the DHFR gene may indicate an additional step of transcriptional regulation of Pol II at the promoter-proximal region in mammalian cells. Furthermore, the distinct distribution across the DHFR gene of different Pol II phosphorylation forms is consistent with a dynamic change in CTD phosphorylation during elongation.
Distribution of the Pol II kinase TFIIH. The phosphorylation status of the CTD is thought to reflect the kinases associated with RNA Pol II, TFIIH (Ser-5) and P-TEFb (Ser-2). To test whether the distinct pattern of CTD phosphorylation corresponded to the binding of the kinase complex, we performed the chromatin IP assay with antisera to p62, a TFIIH subunit. The results indicate that p62 associates only with the DHFR gene near the promoter (Fig. 5), which overlaps with the distribution of Ser-5 phosphorylation of Pol II, and this is consistent with the TFIIH kinase activity being responsible for phosphorylation at Ser-5 (14, 29). Attempts to localize the distribution of Cdk9 and cyclin T of P-TEFb failed, probably due to the quality of the antibodies. A low background level signal was detected across the gene with these antisera.
|
Conservation of Pol II distribution on the
-actin gene.
To examine the generality of the distribution of Pol II on a transcribed gene, we also analyzed the
-actin gene. This gene is 3.5 kb in length and is constitutively expressed. It is significantly different from the DHFR gene, which is much longer (36 kb) and highly regulated through the cell cycle. The densities of Pol II on these genes were considerably different as well. Calculations using the number of DHFR mRNAs per cell and their half life (6 h [18]) revealed that, on average, only
0.003 of the distal regions of the sonicated DHFR gene (
500 nucleotides) is associated with Pol II. The estimated Pol II density on the
-actin gene is approximately 10- to 100-fold higher than that of the DHFR gene. Four primer sets were designed corresponding to the promoter, coding region, and 3' UTR of the
-actin gene (Fig. 6A). Each primer set amplifies a fragment of approximately 120 bp. Another set of primers which amplifies an intergenic region was included as a control. Antibodies against both the N and C termini of the large subunit of Pol II (N20 and C21, respectively) and indicated that the Pol II was associated predominantly near the promoter. The density of Pol II near the promoter was sixfold higher than that in the coding region (Fig. 6). This distribution is consistent with the results obtained with DHFR as a reporter gene. We also examined the association of different phosphorylated forms of Pol II along the
-actin gene. Consistent with the DHFR gene, Ser-2 phosphorylation of Pol II, recognized by the H5 antibody, was distributed relatively uniformly across the gene. In contrast, Ser-5 phosphorylation, recognized by the H14 antibody, was enriched near the promoter (Fig. 6). The phosphorylated Ser-5 signal from the coding regions of the
-actin gene amounts to approximately 40% of the signal from the promoter-proximal region. This is significantly lower than the equivalent sum of 60 to 70% for the phosphorylated Ser-2 signal, which is consistent with an enrichment of the Ser-5-phosphorylated Pol II near the promoter. Less than 10% of the promoter-proximal Ser-5 phosphorylation from the DHFR gene is found associated with all internal sites of this gene, indicating a stronger bias towards accumulation of Ser-5-phosphorylated form at the promoter-proximal region than for the
-actin gene. This difference can probably be explained by differences in promoter specificity, in that different promoter structures may regulate transcription and its coupling to RNA processing by finely regulating the degrees of Pol II phosphorylation at Ser-2 and Ser-5 sites.
| DISCUSSION |
|---|
|
|
|---|
-actin genes than at regions interior to the genes. The distribution of Pol II along the gene differs for different phosphorylated forms. Pol II phosphorylated specifically at Ser-5 is more concentrated near the promoter while Pol II with Ser-2 phosphorylation is distributed throughout the gene. The density along the gene of elongating Pol II was examined by a run-on assay. Elongating Pol II was concentrated at least eightfold more near the promoter, suggesting that many of the transcriptional complexes were paused. These results suggest a dynamic change of Pol II phosphorylation during transcription and potential regulation at the stage of elongation in mammals.
The predominant promoter-proximal accumulation of Pol II along the DHFR and
-actin genes is in stark contrast with observations made in the yeast system, in which Pol II is uniformly associated with both promoter and coding regions (14, 29). This promoter specific association of mammalian Pol II may reflect a greater role for regulation of Pol II elongation in mammalian cells than in yeast.
The resolution of the chromatin IP assay is approximately 200 to 500 bp, the length of the chromatin fragments produced by sonication. Thus, Pol II could be preferentially associated with the promoter in a preinitiated stage or as a paused elongation complex. Conventional models suggest that preinitiated Pol II would have a hypophosphorylated CTD, in contrast to the elongating Pol II, which would have a hyperphosphorylated CTD with either Ser-2 or Ser-5 phosphorylation. This is also the case for both the DHFR and
-actin genes. In each case, there is a strong enrichment of the hypophosphorylated Pol II with the promoter region compared to internal regions. Preinitiation complexes containing Pol II in mammalian cells have been recently described. In the case of the interferon-ß gene, a complex containing Pol II strongly binds the promoter but initiation does not occur until subsequent association with a SWI/SNF complex and the binding of the TFIID complex (1). However, a significant fraction of the Pol II concentrated near the promoter of the DHFR gene has undergone initiation and is paused during elongation. This is indicated in this study by the increased level of Pol II phosphorylated on Ser-5 in the promoter-proximal region compared to the internal regions. This conclusion is also strongly supported by the high density of promoter-proximal elongating Pol II on the DHFR gene, as detected by the run-on assay.
Studies of the heat shock genes of Drosophila melanogaster by Lis and coworkers (20) have shown that Pol II can be paused 20 to 40 nucleotides downstream from the transcription start site. Even under induced conditions for these heat shock genes, where they are actively transcribed, promoter-proximal Pol II pausing is still evident, suggesting that pausing can be the rate-limiting step during the process of transcription (19). In mammalian cells, the pausing and concentration of Pol II in the promoter-proximal region of genes is common as well (15, 16). The typical fate of such paused Pol II complexes is not clear. They could either be released and rapidly elongate into regions further downstream or terminate transcription with dissociation from the gene. In either case, others have speculated that modification of Pol II at the pause site releases the Pol II for elongation (15, 19).
Regulatory factors that may possibly switch the paused Pol II to the elongation-competent Pol II complex include P-TEFb and 5,6-dichlorobenzimidazole-riboside (DRB) sensitivity-inducing factor (DSIF). P-TEFb consists of Cdk9 and cyclin T, is a positive regulator of elongation of transcription, and is thought to phosphorylate the CTD at Ser-2. The transcription elongation inhibitor DRB preferentially inhibits this kinase activity. DSIF, which includes the Spt4 and Spt5 proteins, was originally purified as an activity which binds Pol II at a preinitiation stage and necessitates the activity of P-TEFb for initiation, thus rendering transcription in vitro and sensitivity to DRB (35, 36). Subsequent studies have suggested that P-TEFb and Spt5 may be important for controlling the efficiency of elongation of Pol II across the gene (2, 12, 20). In this case, P-TEFb is conjectured to phosphorylate the CTD and/or serines in a repetitive region of Spt5, regulating elongation of the polymerase (13).
Recent results from studies of c-Myc regulation of the CAD gene are consistent with the above model (6). Increased binding of c-Myc to sequences immediately downstream of the initiation site of this gene, which occurs during the transition from the G0 to the S phase of the cell cycle, correlates with increases in the number of elongating Pol II molecules through the 3' end of the gene and not the number paused near the promoter, which remains high during both stages. Furthermore, these studies show that tethering P-TEFb to this promoter-proximal region in the absence of c-Myc stimulates transcription of the CAD gene (6).
Other models for regulation of Pol II elongation are suggested by recent studies of the
-1-antitrypsin promoter (32). In this case, phosphorylated Pol II is associated with the promoter region hours before transcription can be detected at sites downstream. However, unlike the CAD gene example above, the critical transition to activation of transcription correlated with association of the hBrm factor and displacement of a positioned nucleosome. Thus, regulation at the stage of release of paused Pol II can probably occur by a variety of mechanisms.
Ser-2-phosphorylated Pol II is associated with both the promoter and coding regions of the DHFR and
-actin genes. In contrast, Ser-5 phosphorylation is observed and highly enriched only in the promoter-proximal region of the DHFR and
-actin genes, respectively. These observations were consistent with the results from studies of the
-1-antitrypsin gene (32). Ser-5 phosphorylation is thought to be critical for conversion of the preinitiation complex to an elongation complex and is probably due to the activity of Cdk7 as part of the TFIIH complex. We therefore examined the distribution along the gene of the TFIIH complex. p62, a TFIIH subunit, is primarily associated with the DHFR gene in the promoter-proximal region, completely overlapping the distribution of Ser-5 phosphorylation of Pol II. This is consistent with the proposal that the TFIIH kinase activity is responsible for phosphorylation at Ser-5. Similar results regarding TFIIH have previously been obtained with yeast. This basal transcription factor also phosphorylates Ser-5 of the Pol II CTD in yeast, and both Ser-5 phosphorylation and TFIIH are associated only with promoter-proximal Pol II. These events are correlated with the timing of the capping enzyme recruitment to the nascent transcripts: the capping enzyme is recruited by the Ser-5 phosphorylation of the CTD at the promoter, and its guanylyltransferase enzymatic activity is stimulated by the Ser-5 phosphorylation, suggesting the regulatory role of CTD phosphorylation in the promoter region (11).
Both these and previous results indicate that regulation at the stage of paused Pol II is a common feature of gene expression in mammalian cells. Various mechanisms could control such regulation of elongation, but the most common is probably differential phosphorylation by TFIIH and P-TEFb and dephosphorylation of Pol II.
| ACKNOWLEDGMENTS |
|---|
This work was supported by U.S. Public Health Service grant PO1-CA42063 to P.A.S. and partially supported by Cancer Center Support (core) grant P30-CA14051 from the National Institutes of Health. C. Cheng is a recipient of the Damon Runyon-Walter Winchell Foundation fellowship.
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
2. Andrulis, E. D., E. Guzman, P. Doring, J. Werner, and J. T. Lis. 2000. High-resolution localization of Drosophila Spt5 and Spt6 at heat shock genes in vivo: roles in promoter proximal pausing and transcription elongation. Genes Dev. 14:2635-2649.
3. Carey, M., and S. T. Smale. 1999. Protocol 3.1, nuclear run-on assay, p. 87. In M. Carey and S. T. Smale (ed.), Transcriptional regulation in eukaryotes. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
4. Cho, E. J., M. S. Kobor, M. Kim, J. Greenblatt, and S. Buratowski. 2001. Opposing effects of Ctk1 kinase and Fcp1 phosphatase at Ser 2 of the RNA polymerase II C-terminal domain. Genes Dev. 15:3319-3329.
5. Cho, E. J., T. Takagi, C. R. Moore, and S. Buratowski. 1997. mRNA capping enzyme is recruited to the transcription complex by phosphorylation of the RNA polymerase II carboxy-terminal domain. Genes Dev. 11:3319-3326.
6. Eberhardy, S. R., and P. J. Farnham. 2001. c-Myc mediates activation of the cad promoter via a post-RNA polymerase II recruitment mechanism. J. Biol. Chem. 276:48562-48571.
7. Fong, N., and D. L. Bentley. 2001. Capping, splicing, and 3' processing are independently stimulated by RNA polymerase II: different functions for different segments of the CTD. Genes Dev. 15:1783-1795.
8. Gilbert, S. L., and P. A. Sharp. 1999. Promoter-specific hypoacetylation of X-inactivated genes. Proc. Natl. Acad. Sci. USA 96:13825-13830.
9. Hirose, Y., and J. L. Manley. 1998. RNA polymerase II is an essential mRNA polyadenylation factor. Nature 395:93-96.[CrossRef][Medline]
10. Hirose, Y., R. Tacke, and J. L. Manley. 1999. Phosphorylated RNA polymerase II stimulates pre-mRNA splicing. Genes Dev. 13:1234-1239.
11. Ho, C. K., and S. Shuman. 1999. Distinct roles for CTD Ser-2 and Ser-5 phosphorylation in the recruitment and allosteric activation of mammalian mRNA capping enzyme. Mol. Cell 3:405-411.[CrossRef][Medline]
12. Kaplan, C. D., J. R. Morris, C. Wu, and F. Winston. 2000. Spt5 and Spt6 are associated with active transcription and have characteristics of general elongation factors in D. melanogaster. Genes Dev. 14:2623-2634.
13. Kim, J. B., and P. A. Sharp. 2001. Positive transcription elongation factor B phosphorylates hSPT5 and RNA polymerase II carboxyl-terminal domain independently of cyclin-dependent kinase-activating kinase. J. Biol. Chem. 276:12317-12323.
14. Komarnitsky, P., E. J. Cho, and S. Buratowski. 2000. Different phosphorylated forms of RNA polymerase II and associated mRNA processing factors during transcription. Genes Dev. 14:2452-2460.
15. Krumm, A., L. B. Hickey, and M. Groudine. 1995. Promoter-proximal pausing of RNA polymerase II defines a general rate-limiting step after transcription initiation. Genes Dev. 9:559-572.
16. Krumm, A., T. Meulia, M. Brunvand, and M. Groudine. 1992. The block to transcriptional elongation within the human c-myc gene is determined in the promoter-proximal region. Genes Dev. 6:2201-2213.
17. Laspia, M. F., A. P. Rice, and M. B. Mathews. 1989. HIV-1 Tat protein increases transcriptional initiation and stabilizes elongation. Cell 59:283-292.[CrossRef][Medline]
18. Leys, E. J., G. F. Crouse, and R. E. Kellems. 1984. Dihydrofolate reductase gene expression in cultured mouse cells is regulated by transcript stabilization in the nucleus. J. Cell Biol. 99:180-187.
19. Lis, J. 1998. Promoter-associated pausing in promoter architecture and postinitiation transcriptional regulation. Cold Spring Harbor Symp. Quant. Biol. 63:347-356.
20. Lis, J. T., P. Mason, J. Peng, D. H. Price, and J. Werner. 2000. P-TEFb kinase recruitment and function at heat shock loci. Genes Dev. 14:792-803.
21. McCracken, S., N. Fong, K. Yankulov, S. Ballantyne, G. Pan, J. Greenblatt, S. D. Patterson, M. Wickens, and D. L. Bentley. 1997. The C-terminal domain of RNA polymerase II couples mRNA processing to transcription. Nature 385:357-361.[CrossRef][Medline]
22. Misteli, T., and D. L. Spector. 1999. RNA polymerase II targets pre-mRNA splicing factors to transcription sites in vivo. Mol. Cell 3:697-705.[CrossRef][Medline]
23. O'Brien, T., S. Hardin, A. Greenleaf, and J. T. Lis. 1994. Phosphorylation of RNA polymerase II C-terminal domain and transcriptional elongation. Nature 370:75-77.[CrossRef][Medline]
24. Patturajan, M., R. J. Schulte, B. M. Sefton, R. Berezney, M. Vincent, O. Bensaude, S. L. Warren, and J. L. Corden. 1998. Growth-related changes in phosphorylation of yeast RNA polymerase II. J. Biol. Chem. 273:4689-4694.
25. Plet, A., D. Eick, and J. M. Blanchard. 1995. Elongation and premature termination of transcripts initiated from c-fos and c-myc promoters show dissimilar patterns. Oncogene 10:319-328.[Medline]
26. Price, D. H. 2000. P-TEFb, a cyclin-dependent kinase controlling elongation by RNA polymerase II. Mol. Cell. Biol. 20:2629-2634.
27. Rodriguez, C. R., E. J. Cho, M. C. Keogh, C. L. Moore, A. L. Greenleaf, and S. Buratowski. 2000. Kin28, the TFIIH-associated carboxy-terminal domain kinase, facilitates the recruitment of mRNA processing machinery to RNA polymerase II. Mol. Cell. Biol. 20:104-112.
28. Rougvie, A. E., and J. T. Lis. 1990. Postinitiation transcriptional control in Drosophila melanogaster. Mol. Cell. Biol. 10:6041-6045.
29. Schroeder, S. C., B. Schwer, S. Shuman, and D. Bentley. 2000. Dynamic association of capping enzymes with transcribing RNA polymerase II. Genes Dev. 14:2435-2440.
30. Shuman, S. 1995. Capping enzyme in eukaryotic mRNA synthesis. Prog. Nucleic Acid Res. Mol. Biol. 50:101-129.
31. Singer, M. J., L. D. Mesner, C. L. Friedman, B. J. Trask, and J. L. Hamlin. 2000. Amplification of the human dihydrofolate reductase gene via double minutes is initiated by chromosome breaks. Proc. Natl. Acad. Sci. USA 97:7921-7926.
32. Soutoglou, E., and I. Talianidis. 2002. Coordination of PIC assembly and chromatin remodeling during differentiation-induced gene activation. Science 295:1901-1904.
33. Strobl, L. J., and D. Eick. 1992. Hold back of RNA polymerase II at the transcription start site mediates down-regulation of c-myc in vivo. EMBO J. 11:3307-3314.[Medline]
34. Tang, H., Y. Liu, L. Madabusi, and D. S. Gilmour. 2000. Promoter-proximal pausing on the hsp70 promoter in Drosophila melanogaster depends on the upstream regulator. Mol. Cell. Biol. 20:2569-2580.
35. Wada, T., T. Takagi, Y. Yamaguchi, A. Ferdous, T. Imai, S. Hirose, S. Sugimoto, K. Yano, G. A. Hartzog, F. Winston, S. Buratowski, and H. Handa. 1998. DSIF, a novel transcription elongation factor that regulates RNA polymerase II processivity, is composed of human Spt4 and Spt5 homologs. Genes Dev. 12:343-356.
36. Wada, T., T. Takagi, Y. Yamaguchi, D. Watanabe, and H. Handa. 1998. Evidence that P-TEFb alleviates the negative effect of DSIF on RNA polymerase II-dependent transcription in vitro. EMBO J. 17:7395-7403.[CrossRef][Medline]
37. Yankulov, K., J. Blau, T. Purton, S. Roberts, and D. L. Bentley. 1994. Transcriptional elongation by RNA polymerase II is stimulated by transactivators. Cell 77:749-759.[CrossRef][Medline]
38. Zhang, J., and J. L. Corden. 1991. Identification of phosphorylation sites in the repetitive carboxyl-terminal domain of the mouse RNA polymerase II largest subunit. J. Biol. Chem. 266:2290-2296.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|