Previous Article | Next Article 
Molecular and Cellular Biology, March 2003, p. 2162-2170, Vol. 23, No. 6
0270-7306/03/$08.00+0 DOI: 10.1128/MCB.23.6.2162-2170.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Cortactin Is a Component of Clathrin-Coated Pits and Participates in Receptor-Mediated Endocytosis
Hong Cao,1 James D. Orth,1 Jing Chen,1 Shaun G. Weller,1 John E. Heuser,2 and Mark A. McNiven1*
Department of Biochemistry and Molecular Biology, Mayo Clinic, Rochester, Minnesota 55905,1
Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, Missouri 631302
Received 7 June 2002/
Returned for modification 3 July 2002/
Accepted 6 December 2002

ABSTRACT
The actin cytoskeleton is believed to contribute to the formation
of clathrin-coated pits, although the specific components that
connect actin filaments with the endocytic machinery are unclear.
Cortactin is an F-actin-associated protein, localizes within
membrane ruffles in cultured cells, and is a direct binding
partner of the large GTPase dynamin. This direct interaction
with a component of the endocytic machinery suggests that cortactin
may participate in one or several endocytic processes. Therefore,
the goal of this study was to test whether cortactin associates
with clathrin-coated pits and participates in receptor-mediated
endocytosis. Morphological experiments with either anti-cortactin
antibodies or expressed red fluorescence protein-tagged cortactin
revealed a striking colocalization of cortactin and clathrin
puncta at the ventral plasma membrane. Consistent with these
observations, cells microinjected with these antibodies exhibited
a marked decrease in the uptake of labeled transferrin and low-density
lipoprotein while internalization of the fluid marker dextran
was unchanged. Cells expressing the cortactin Src homology three
domain also exhibited markedly reduced endocytosis. These findings
suggest that cortactin is an important component of the receptor-mediated
endocytic machinery, where, together with actin and dynamin,
it regulates the scission of clathrin pits from the plasma membrane.
Thus, cortactin provides a direct link between the dynamic actin
cytoskeleton and the membrane pinchase dynamin that supports
vesicle formation during receptor-mediated endocytosis.

INTRODUCTION
The actin cytoskeleton, with its associated proteins, has been
implicated in endocytic processes in both yeast and mammalian
cells (
5,
25,
41). How this cytoskeletal network might interact
with the endocytic machinery to regulate vesicle formation and
scission remains unclear. Recently, Pelkmans and colleagues
reported that actin and dynamin accumulated at simian virus
40-docked caveolae concomitant with internalization, thus demonstrating
that actin functions during the endocytic process (
24). Similarly,
Merrifield et al. demonstrated that clathrin, dynamin, and actin
are sequentially recruited to form clathrin pits, marked by
an accumulation of actin and movement of the vesicles away from
the plasma membrane (
20). Both of these studies demonstrated
an accumulation of dynamin and actin at the forming endocytic
membranes but did not directly link the endocytic and cytoskeletal
machineries. Recently, it was demonstrated that the actin-binding
protein cortactin associates directly with the large GTPase
dynamin (Dyn2) via their Src homology three (SH3) and proline-rich
domains (PRD), respectively (
19). As Dyn2 participates in the
liberation of clathrin-coated pits (CCPs) from the plasma membrane,
a potential link exists between the endocytic machinery and
the actin cytoskeleton through cortactin (
18).
Cortactin is an 80- and 85-kDa protein that localizes within membrane ruffles in cultured cells (19, 43) and was originally identified as a substrate for the protein tyrosine kinase pp60Src (21, 44). Importantly, cortactin contains an N-terminal acidic region that, through the three-amino-acid DDW motif, binds to the Arp2/3 complex, where it appears to regulate actin polymerization (36, 39, 40). Cortactin also contains tandem repeats that form F-actin-binding domains (41, 43) and an
-helical proline-rich region that includes tyrosine residues that are phosphorylated by c-Src (12, 13). These unique features make it likely that cortactin participates in numerous actin-dependent cytoskeletal processes. For example, the observations that cortactin is localized to cortical ruffles and that cells expressing high levels of cortactin have enhanced cell motility suggests that cortactin functions together with actin to promote cell motility (23, 43). However, recent studies have reported that cortactin associates with motile endosomes and have implicated this protein in actin nucleation as it may relate to vesicle transport, targeting, or fusion (14, 16, 22, 29). A recent study reporting a direct binding of Dyn2 and cortactin was one of the first to demonstrate a physical interaction between an actin-binding protein and a component of the endocytic machinery (19). Whether cortactin participates in endocytosis is currently undefined.
In this study we tested whether cortactin functions during the initial stages of receptor-mediated endocytosis (RME). Specifically, we asked whether cortactin, normally found at the cell cortex, might also associate with CCPs. Dyn2 mutants that alter RME were used to gain insight into the function and targeting of cortactin to CCPs. The role of cortactin in endocytosis was tested directly through microinjection of affinity-purified antibodies to distinct domains of cortactin, including the dynamin-binding SH3 domain, and by transient expression of the SH3 domain. Multiple endocytic pathways were tested, including the RME uptake of ligands including fluorescently tagged transferrin and low-density lipoprotein (LDL) or fluid (rhodamine or fluorescein isothiocyanate [FITC]-tagged dextran) by cultured epithelial cells. A striking colocalization of cortactin was observed with both clathrin and Dyn2 puncta on the cell surface by using two distinct cortactin antibodies and red fluorescence protein-tagged cortactin (cortactin-RFP). Further, when RME and clathrin organization was disrupted through the expression of Dyn2 mutant proteins, cortactin redistributed to localize with clathrin in large surface plaques. In support of these findings, microinjection of the same antibodies used for colocalization and expression of the cortactin SH3 domain resulted in a substantial inhibition of clathrin-mediated transferrin and LDL uptake while fluid uptake remained unaffected. These findings demonstrate a role for cortactin at the site of endocytic pit formation and scission.

MATERIALS AND METHODS
Antibodies, ligands, and stains.
An anticlathrin monoclonal antibody (X-22) was from the American
Type Culture Collection, Rockville, Md. The anti-kinesin (MC44)
antibody was raised against a peptide sequence representing
amino acids QKKLSGKLYLVDLAGSEKVSKTGAEGT. The anti-cortactin
AB3 antibody was raised against the peptide DKSAVGFDYQGKTEKHESQKDYSK,
present in the third F-actin-binding domain, and the anti-cortactin
C-Tyr antibody was raised against the peptide HYQAEDDTYDGYESDLGIT,
present in the C-terminal region of cortactin. The anti-cortactin
SH3 antibody was raised against the peptide YDYQAAGDDEISFDPDDVITNIEM,
present in the SH3 domain of cortactin. The cortactin antibodies
are specific, as confirmed by immunoblotting and immunofluorescence
analysis compared to a commercially available monoclonal cortactin
antibody 4F11 (Upstate Biotechnology, Lake Placid, N.Y.). Goat
anti-rabbit or goat anti-mouse secondary antibodies conjugated
to Alexa 488 or 594 were from Molecular Probes (Eugene, Oreg.).
Transferrin Alexa 488 or 594, DiI-LDL, and rhodamine- or FITC-dextran
(3,000 molecular weight) for immunocytochemical staining were
from Molecular Probes. All other chemicals and reagents, unless
otherwise stated, were from Sigma (St. Louis, Mo.).
Dynamin and cortactin cDNAs.
The Dyn2 (aa) K44A-GFP and Dyn2 (amino acid)
PRD-GFP plasmids were as described previously (3, 19). Oligonucleotide primers specific for cortactin were designed (MacVector or Oligo, version 6.51) and synthesized (Applied Biosystems model 394 DNA/RNA synthesizer) by using the cortactin cDNA sequence from GenBank (accession no. AF054619). Primers designed for cortactin are Cort 5' (ATGTGGAAAGCCTCTGCAGGCCATGCTGTG) and Cort 3', (CTACTGCCGCAGC TCCACATAG). Full-length cDNAs were amplified by using the XL PCR kit (Perkin Elmer, Branchburg, N.J.). The PCR cycle conditions were 94°C for 1 min and 62°C for 5 min for 28 cycles followed by 72°C for 7 min. The cortactin SH3 domain was amplified by using a PCR kit (Invitrogen, Carlsbad, Calif.). Primers designed for the cortactin SH3 domain were SH3-5' (ATGTATGACTACCAGGCTGCTGGCGATG) and the 3' primer Cort 3'. The cortactin full-length DNA template was used in the PCR; cycle conditions were as described above for 30 cycles. The PCR fragments were ligated into the eukaryotic expression vector pCR3.1 (Invitrogen). For subcloning, positive pCR3.1 subclones were subjected to PCR with 5' and 3' PCR primers for cortactin that introduced novel restriction enzyme sites (EcoRI and BamHI). Amplification products containing the EcoRI and BamHI restriction sites were digested and subcloned into the pDsRed-N1 (RFP) expression vector (Clontech, Palo Alto, Calif.). Restriction enzymes were from Promega (Madison, Wis.) and Life Technologies, Inc. (Invitrogen).
Cell culture and transfection.
Clone 9 cells, an epithelial cell line isolated from normal rat liver (ATCC CRL-1439), were maintained in Ham's F-12K medium supplemented with 10% fetal bovine serum (Invitrogen), 100 U of penicillin/ml, and 100 µg of streptomycin/ml in 5% CO2-95% air at 37°C. Cells were cultured in T-75 flasks (Fisher Scientific, Pittsburgh, Pa.) or on 22- by 22-mm glass coverslips for transfections and immunocytochemistry, respectively. Transfections were performed with the Lipofectamine Plus reagent kit (Invitrogen).
Immunofluorescence and confocal microscopy.
For immunofluorescence microscopy and confocal microscopy, cells were grown on coverslips for 1 to 2 days and prepared as described previously (2). Clone 9 cells were double stained with anti-cortactin (AB3) polyclonal antibody or anti-cortactin (C-Tyr) polyclonal antibody with clathrin (X-22) monoclonal antibody. Transiently transfected cortactin-RFP-expressing cells were also costained with clathrin (X-22). The anti-cortactin and anti-SH3 antibodies were used to identify the Cort SH3-pCR3.1-expressing cells. For the transferrin uptake experiments, the cells were permeabilized with 0.01% digitonin (Fluka, Ronkonkoma, N.Y.). Cells were viewed with an Axiovert 35 epifluorescence microscope (Carl Zeiss, Inc., Thornwood, N.Y.) equipped with a 100-W mercury lamp and a 100x objective lens (Zeiss Plan-Neofluar 1.30) and a confocal microscope (LSM-310 or 510; Carl Zeiss, Inc.) equipped with an argon-krypton laser and a 100x objective lens.
Electron microscopy.
Electron microscopy of replica coated, unroofed COS7 cells and labeling with anti-cortactin antibodies were performed as described previously by J. Heuser (9, 10).
Microinjection of anti-cortactin and kinesin antibodies and endocytic assays.
Clone 9 cells were microinjected with either buffer alone (10 mM KH2PO4 [pH 7.2] and 75 mM KCl) or buffer containing cortactin (AB3, 6.2 mg/ml), cortactin (C-Tyr, 9.4 mg/ml), or anti-kinesin (7.2 mg/ml) antibodies, respectively. Fixable rhodamine- or FITC-dextrans were included in the injectate to identify the injected cells. The cells recovered in 5% CO2-95% air at 37°C for 4 to 6 h prior to the endocytic assays (8).
Quantitation of transferrin, LDL, and dextran uptake in microinjected cells.
Images for quantitation were acquired by using a cooled charge-coupled device camera (Photometrics SenSys, Tuscon, Ariz.) driven by Metamorph (Universal Imaging, West Chester, Pa.). All images of microinjected cells were taken at full resolution (1,024 by 1,024 pixels) with the same acquisition settings (exposure time, 5 s; 12-bit grayscale). The percentage of cells demonstrating an inhibition of transferrin or dextran uptake was determined by visual inspection. The mean percentage of cells showing reduced internalization was determined from three separate experiments and at least 150 cells for each condition. Fluorescence intensity quantitation was performed with IPLab (Scanalytics, Inc., Fairfax, Va.). The area occupied by each cell was traced, and the mean fluorescence intensity per unit area was determined for at least 100 cells in each injection condition.

RESULTS
Cortactin localizes to CCPs in cultured cells.
As novel cortactin antibodies were generated for this study,
we first needed to demonstrate their specificity. Polyclonal
antibodies against cortactin peptides were raised to distinct
epitopes in cortactin, the third actin-binding motif (AB3) near
the center of the protein, and a C-terminal region adjacent
to the SH3 domain known to contain several Src-phosphorylated
tyrosines (C-Tyr) (Fig.
1a) (
12,
13). After purification and
concentration, these antibodies were characterized by using
multiple criteria and their specificities were compared to a
commercially available cortactin monoclonal antibody (see Materials
and Methods). First, immunoblotting of liver homogenate, cultured
rat hepatocyte (clone 9) lysate, and purified His
6-cortactin
protein demonstrated that all three antibodies specifically
detected the characteristic cortactin doublet at 80 and 85 kDa
(Fig.
1b). Next, we used these three antibodies to immunoprecipitate
cortactin from clone 9 lysate. Immunoblotting of the respective
immunoprecipitations with the monoclonal antibody revealed that
a substantial amount of cortactin was isolated (Fig.
1c). Importantly,
when these immunoprecipitations were subjected to Coomassie
blue staining (silver staining was also performed) (data not
shown), cortactin represented the overwhelming majority of the
protein present (Fig.
1d). These experiments demonstrated that
the three distinct antibody reagents used in this study are
specific for cortactin.
To define the localization and function of cortactin in cultured
clone cells, the purified cortactin antibodies were used for
indirect immunofluorescence staining (Fig.
2a and b). Both antibodies
gave nearly identical staining patterns, stained the cell cortex,
as reported previously (
19,
40,
43), and also labeled prominent,
punctate foci along the cell surface. Costaining of these cells
with monoclonal antibodies to the clathrin heavy chain, or Dyn2
(data not shown), demonstrated a striking, but not absolute,
colocalization of these proteins at plasma membrane puncta (Fig.
2a to b"). To further confirm these antibody localization results,
clone 9 cells expressing a cortactin-RFP fusion protein (Cort-B-pDsRed-N
1)
were fixed and stained with antibodies to clathrin (Fig.
2c to c") or Dyn2 (data not shown). As for the antibody-stained
cells, the expressed cortactin-RFP localized to the cell cortices
and in small puncta along the cell surface that stained positive
for both clathrin and Dyn2. A majority, but not all, of the
tagged cortactin protein associated with clathrin foci (Fig.
2c").
To visualize cortactin's localization at the ultrastructural
level and gain insight into its potential function at CCPs,
unroofed preparations of cultured COS7 cells were processed
for immuno-gold electron microscopy with the AB3 or C-Tyr cortactin
antibodies by using the methods of Heuser (
9,
10). This preparation
allows high-resolution imaging of immuno-gold complexes while
maintaining remarkable morphological preservation of coat and
cytoskeletal components along the cell cortex at the plasma
membrane. In support of the fluorescence microscopy images shown
in Fig.
2a to c", the immuno-gold electron microscopy wtih cortactin
antibodies revealed a strong labeling of both flat and highly
curved clathrin lattices (Fig.
2d to f). Interestingly, gold
particles appeared to be distributed randomly over the surface
of flat clathrin lattices, but this distribution became restricted
to a ring around the base of the clathrin coat as the pit invaginated
(Fig.
2d versus e and f). This circular distribution along the
base of protruding pits closely resembled that of Dyn2 as viewed
in the same preparation (data not shown). Importantly, the cortactin
antibodies also labeled actin filaments in these preparations
(Fig.
2d to e). Thus, two different purified antibodies directed
to distinct motifs in the cortactin protein, as well as cortactin-RFP,
showed significant localization, with CCPs at both the light
and ultrastructural levels. These morphological findings strongly
supported a potential role for cortactin in RME together with
actin and dynamin.
To further confirm that cortactin is a component of CCPs and to elucidate the role of cortactin together with Dyn2 at CCPs, we disrupted the normal punctate distribution of clathrin in cultured cells via expression of mutant Dyn2 proteins. The GTP-binding and hydrolysis-deficient Dyn2K44A is often used to block RME, and its expression is proposed to block pits at the intermediate stage of internalization, prior to final constriction of the vesicle neck (4, 11, 37). Dynamin that lacks the PRD, Dyn2
PRD, has a diffuse, largely cytoplasmic staining pattern, cannot bind to cortactin (19), and was recently shown not to target to CCPs, resulting in blocked RME (32). Dyn2
PRD is proposed to exert its dominant-negative effect by inappropriately targeting in cells and through oligomerization with endogenous dynamin (19, 32). Interestingly, when Dyn2K44A- or Dyn2
PRD-expressing cells (data not shown) were stained for cortactin and clathrin, the distribution of plasma membrane cortactin changed to become part of the large, abnormal clathrin aggregates (Fig. 3). The fact that cortactin localization changed along with CCP formation and distribution supports the morphological observations shown in Fig. 2, indicating that the actin-binding protein cortactin is part of the clathrin endocytic machinery.
Cortactin, including its SH3 domain, is important for efficient RME.
To directly test the role of cortactin in endocytosis, the same
affinity-purified antibodies used to show a localization of
cortactin to CCPs (Fig.
2) were microinjected into clone 9 cells.
First, we demonstrated that the injected cells did not display
any gross morphological defects compared to noninjected, buffer-injected,
or kinesin antibody-injected cells (Fig.
4 and data not shown).
This suggested that the cells were healthy in the context of
these experiments. Based on cortactin's localization to CCPs,
we expected that an antibody-mediated inhibition of cortactin
function could have profound effects on RME. To test if the
cortactin antibodies that colocalize with CCPs might affect
clathrin-mediated endocytosis of transferrin or LDL or fluid-phase
endocytosis of dextran, cells were injected with control solutions
(microinjection buffer alone or a kinesin antibody) or affinity-purified
cortactin antibodies. Injected cells recovered for 4 h prior
to incubation with fluorescent ligands. Subsequent to rinsing
and fixation, cells were scored in a blind fashion as normal
or significantly inhibited for endocytosis. While buffer alone
(data not shown) or the purified kinesin antibody had no effect
on transferrin uptake (Fig.
4a), both the cortactin AB3 and
C-Tyr antibodies exhibited a profound inhibitory effect on ligand
uptake (Fig.
4b and c). In over 80% (AB3-injected) and 70% (C-Tyr-injected)
of the cells counted, transferrin internalization appeared completely
ablated (Fig.
4e). Interestingly, while transferrin staining
in control cells was distributed as clustered small puncta near
the nucleus and plasma membrane, some cortactin antibody-injected
cells (20 to 30%) displayed a substantial, but not complete,
decrease in staining intensity at both locations (data not shown).
Thus, we elected to digitally quantify the mean fluorescence
intensity per unit area of internalized transferrin in these
inhibited cells. While microinjection of buffer alone or kinesin
antibody did not result in decreased transferrin intensity,
the cortactin antibody-injected cells that showed partial inhibition
were on average only 40% as intense as control, noninjected
cells (Fig.
4f). Consistent with the transferrin internalization
experiments, the RME of LDL was also affected. Microinjection
of the same cortactin antibodies resulted in a block of LDL
internalization in the majority of cells (Fig.
5a, a', and c).
Upon quantitation of the mean fluorescence intensity of LDL
in these cells, there was a 40 to 50% decrease in internalization
compared to control (Fig.
5d). These results, together with
the cells that appeared to be completely blocked in each condition,
indicated that the cortactin antibodies potently inhibited the
internalization of transferrin and LDL. In contrast, cortactin
antibody-injected cells showed no reduction in the ability to
internalize fluid markers, such as fluorescent dextran (Fig.
6).
In an attempt to further define how cortactin may mediate RME,
we transiently expressed the cortactin SH3 domain in cells.
We rationalized that the expressed SH3 domain could competitively
inhibit RME by interfering with the normal function of cortactin
and interactions with its binding partners, such as dynamin.
Mainly, expression of the SH3 domain produced cell phenotypes
strikingly similar to those observed in the antibody microinjection
experiments and significantly reduced the uptake of transferrin
(Fig.
4d, e, and g), and LDL (Fig.
5b, b', e, and f). Importantly,
expression of full-length cortactin in these same experiments
had no significant effects on RME (Fig.
4e and g and
5e and
f). These results suggested that the SH3 domain of cortactin
has an important role in linking cortactin and/or dynamin to
the functional endocytic complex.

DISCUSSION
In this study we demonstrate a structural and functional association
between the actin-binding protein cortactin and CCPs in cultured
epithelial cells. This study was initiated based on previously
published data that the SH3 domain of cortactin binds to the
proline-rich tail of Dyn2 (
19). While this earlier study demonstrated
a convincing codistribution of these proteins in peripheral
membrane ruffles, it was unclear if an association occurred
at the site of RME. Because dynamin functions during the endocytic
process, it prompted us to test if cortactin and Dyn2 interactions
are required to support invagination of the plasma membrane
and subsequent internalization of ligand. Several morphological
techniques demonstrated a convincing colocalization between
cortactin, Dyn2, and clathrin. The methods used in this study
included immunofluorescence cell staining with two polyclonal
antibodies made to distinct cortactin domains (Fig.
2), expression
of RFP-tagged cortactin protein (Fig.
2), and high-resolution
immuno-gold electron microscopy with the same antibodies (Fig.
2). All three of these methods were supportive of each other
and consistently localized cortactin to CCPs. Interestingly,
the electron micrographs showed that at initial steps of invagination,
cortactin localized throughout flat clathrin lattices. At later
stages, the cortactin was primarily located in a ring or collar
around the neck of the pit, with some occasionally remaining
at the bulb of the invaginating pit. This is not unlike what
we and others have observed for dynamin (
4,
33). Exactly why
some of the cortactin and Dyn2 remain associated with the bulb
of the pit is unclear, but perhaps part of this complex is a
remnant of the protein associated with the flat clathrin lattice
prior to curvature or is providing nucleation sites for actin
filaments to push the vesicle from the plasma membrane.
Consistent with the localization studies, the same antibody reagents exhibited a potent inhibitory effect on cell function. Both antibodies significantly inhibited RME of transferrin and LDL but not the uptake of fluid markers (Fig. 4, 5, and 6). As multiple laboratories have observed different requirements for dynamin in fluid-phase internalization (6, 16, 22), it was unclear if cortactin would be required in this process or not. One possibility is that cortactin's role in fluid-phase endocytosis is not during internalization but rather during postendocytic trafficking and movement via actin polymerization, as has been observed for both cortactin and Dyn2 (14, 16, 22). It is likely that cortactin is associated with actin microfilaments in close proximity to the clathrin lattice (Fig. 2d to f). Actin microfilaments are thought to function during early stages of pit invagination and to organize pit assemblies that aid in nascent vesicle fission from the plasma membrane (26, 28). Cortactin's proposed function as a protein that enhances microfilament nucleation via the Arp2/3 complex and stabilizes actin filaments and branches supports such a function for cortactin in RME. Further, recent data demonstrating cortactin's role together with Dyn2 in other actin-dependent membrane processes supports the hypothesis that cortactin and Dyn2 function together with actin to mediate vesicle formation. The action of such a complex could be coordinated by integration with a host of proteins. The Dyn2 polymer, along with cortactin, could form a complex meshwork comprised of multiple actin-binding proteins including profilin (42), Abp1 (15), syndapin (25), N-WASp (35); structural coat proteins such as amphiphysin (7), AP2 (38), and clathrin (34); and signaling molecules including PIP2 (17, 45), phospholipase C-
(31), and Src (1, 5). The cortactin SH3 domain expression experiments demonstrate that the SH3 domain of cortactin is important for RME. It is attractive to predict that cortactin's SH3 domain is binding to dynamin and other putative partners at the forming vesicle. As the injection of cortactin antibodies or expression of multiple truncated cortactin constructs did not inhibit the recruitment of Dyn2 to clathrin pits, it is likely that cortactin does not directly recruit Dyn2 to the pit. As there are multiple Dyn2-binding partners at the endocytic site (endophilin, intersectin, amphiphysin, Grb2, and AP2) (18), it is likely that the Dyn2-cortactin binding contributes to membrane deformation and actin assembly rather than direct recruitment.
Finally, dynamin is known to interact with other actin-associated proteins, including syndapin (27), profilin (42), and Abp1 (15). Abp1 was shown to regulate RME through actin and dynamin (15). Significantly, mammalian Abp1, unlike cortactin, lacks the acidic amino acid residues that mediate direct binding to the Arp2/3 complex (28). This is an important distinction that increases the inherent importance of the cortactin-Dyn2 interaction. Actin nucleation has been suggested to be important for RME, and the fact that cortactin stimulates actin nucleation and that this activity is affected by binding to dynamin (30) suggests that cortactin may serve a more direct role during RME, rather than functioning as a scaffolding molecule that links actin filaments and Dyn2. Interestingly, when cortactin's binding domain is removed from Dyn2 (Dyn2
PRD), there are alterations in associated actin organization, Dyn2 no longer localizes to CCPs and RME is inhibited (19, 22, 32). Based on this study, and others, an attractive model predicts that the SH3 domain of cortactin binds to the PRD of Dyn2 at the invaginating CCP. The direct interaction of these two proteins integrates dynamic actin filaments and the membrane fission machinery, possibly in a Src-sensitive manner. Thus, the actin filament-binding and nucleation activity of cortactin and the membrane-modeling activity of Dyn2 may function together during RME to mediate the final scission step of endocytosis. A simplified model depicting cortactin and dynamin and how they may integrate endocytic proteins at the invaginating pit is shown in Fig. 7. Future studies further defining how cortactin and Dyn2 mediate membrane invagination will provide important insights into the regulation of the endocytic process.

ACKNOWLEDGMENTS
We thank H. M. Thompson for critical reading of the manuscript.
This study was supported by funding to M.A.M. from the NIH and Mayo Foundation.

FOOTNOTES
* Corresponding author. Mailing address: Dept. of Biochemistry and Molecular Biology, 1721 Guggenheim Building, Mayo Clinic, Rochester, MN 55905. Phone: (507) 284-0683. Fax: (507) 284-0762. E-mail:
mcniven.mark{at}mayo.edu.


REFERENCES
1 - Ahn, S., S. Maudsley, L. M. Luttrell, R. J. Lefkowitz, and Y. Daaka. 1999. Src-mediated tyrosine phosphorylation of dynamin is required for beta2-adrenergic receptor internalization and mitogen-activated protein kinase signaling. J. Biol. Chem. 274:1185-1188.[Abstract/Free Full Text]
2 - Cao, H., F. Garcia, and M. McNiven. 1998. Differential distribution of dynamin isoforms in mammalian cells. Mol. Biol. Cell 9:2595-2609.[Abstract/Free Full Text]
3 - Cao, H., H. M. Thompson, E. W. Krueger, and M. A. McNiven. 2000. Disruption of Golgi structure and function in mammalian cells expressing a mutant dynamin. J. Cell Sci. 113:1993-2002.[Abstract]
4 - Damke, H., D. D. Binns, H. Ueda, S. L. Schmid, and T. Baba. 2001. Dynamin GTPase domain mutants block endocytic vesicle formation at morphologically distinct stages. Mol. Biol. Cell 12:2578-2589.[Abstract/Free Full Text]
5 - Foster-Barber, A., and J. M. Bishop. 1998. Src interacts with dynamin and synapsin in neuronal cells. Proc. Natl. Acad. Sci. USA 95:4673-4677.[Abstract/Free Full Text]
6 - Gold, E. S., D. M. Underhill, N. S. Morrissette, J. B. Guo, M. A. McNiven, and A. Aderem. 1999. Dynamin 2 is required for phagocytosis in macrophages. J. Exp. Med. 190:1849-1856.[Abstract/Free Full Text]
7 - Grabs, D., V. I. Slepnev, Z. Songyang, C. David, M. Lynch, L. C. Cantley, and P. De Camilli. 1997. The SH3 domain of amphiphysin binds the proline-rich domain of dynamin at a single site that defines a new SH3 binding consensus sequence. J. Biol. Chem. 272:13419-13425.[Abstract/Free Full Text]
8 - Henley, J. R., E. W. Krueger, B. J. Oswald, and M. A. McNiven. 1998. Dynamin-mediated internalization of caveolae. J. Cell Biol. 141:85-99.[Abstract/Free Full Text]
9 - Heuser, J. 1989. Changes in lysosome shape and distribution correlated with changes in cytoplasmic pH. J. Cell Biol. 108:855-864.[Abstract/Free Full Text]
10 - Heuser, J. E. 2000. Membrane traffic in anaglyph stereo. Traffic 1:35-37.[CrossRef][Medline]
11 - Hill, E., J. van der Kaay, C. P. Downes, and E. Smythe. 2001. The role of dynamin and its binding partners in coated pit invagination and scission. J. Cell Biol. 152:309-323.[Abstract/Free Full Text]
12 - Huang, C., J. Liu, C. C. Haudenschild, and X. Zhan. 1998. The role of tyrosine phosphorylation of cortactin in the locomotion of endothelial cells. J. Biol. Chem. 273:25770-25776.[Abstract/Free Full Text]
13 - Huang, C., N. Yansong, T. Wang, Y. Gao, C. C. Haudenschild, and X. Zhan. 1997. Down-regulation of the filamentous actin cross-linking activity of cortactin by Src-mediated tyrosine phosphorylation. J. Biol. Chem. 272:13911-13915.[Abstract/Free Full Text]
14 - Kaksonen, M., H. B. Peng, and H. Rauvala. 2000. Association of cortactin with dynamic actin in lamellipodia and on endosomal vesicles. J. Cell Sci. 113:4421-4426.[Abstract]
15 - Kessels, M. M., A. E. Y. Engqvist-Goldstein, D. G. Drubin, and B. Qualmann. 2001. Mammalian Abp1, a signal-responsive F-actin-binding protein, links the actin cytoskeleton to endocytosis via the GTPase dynamin. J. Cell Biol. 153:351-366.[Abstract/Free Full Text]
16 - Lee, E., and P. De Camilli. 2002. Dynamin at actin tails. Proc. Natl. Acad. Sci. USA 99:161-166.[Abstract/Free Full Text]
17 - Lin, H. C., B. Barylko, M. Achiriloaie, and J. P. Albanesi. 1997. Phosphatidylinositol (4,5)-biphosphate-dependent activation of dynamins I and II lacking the proline/arginine-rich domains. J. Biol. Chem. 272:25999-26004.[Abstract/Free Full Text]
18 - McNiven, M. A., H. Cao, K. R. Pitts, and Y. Yoon. 2000. Pinching in new places: multiple functions for the dynamin family. Trends Biochem. Sci. 25:115-120.[CrossRef][Medline]
19 - McNiven, M. A., L. Kim, E. W. Krueger, J. D. Orth, H. Cao, and T. W. Wong. 2000. Interactions between dynamin and the actin binding protein cortactin modulate cell shape. J. Cell Biol. 151:187-198.[Abstract/Free Full Text]
20 - Merrifield, C. J., M. E. Feldman, L. Wan, and W. Almers. 2002. Imaging actin and dynamin recruitment during invagination of single clathrin-coated pits. Nat. Cell Biol. 4:691-698.[CrossRef][Medline]
21 - Okamura, H., and M. D. Resh. 1995. p80/85 cortactin associates with the Src SH2 domain and colocalizes with v-Src in transformed cells. J. Biol. Chem. 270:26613-26618.[Abstract/Free Full Text]
22 - Orth, J. D., E. W. Krueger, H. Cao, and M. A. McNiven. 2002. The large GTPase dynamin regulates actin comet formation and movement in living cells. Proc. Natl. Acad. Sci. USA 99:167-172.[Abstract/Free Full Text]
23 - Patel, A. S., G. L. Schechter, W. J. Wasilenko, and K. D. Somers. 1998. Overexpression of EMS1/cortactin in NIH3T3 fibroblasts causes increased cell motility and invasion in vitro. Oncogene 16:3227-3232.[CrossRef][Medline]
24 - Pelkmans, L., D. Puntener, and A. Helenius. 2002. Local actin polymerization and dynamin recruitment in SV40-induced internalization of caveolae. Science 296:535-539.[Abstract/Free Full Text]
25 - Qualmann, B., and R. B. Kelly. 2000. Syndapin isoforms participate in receptor-mediated endocytosis and actin organization. J. Cell Biol. 148:1047-1061.[Abstract/Free Full Text]
26 - Qualmann, B., M. M. Kessels, and R. B. Kelly. 2000. Molecular links between endocytosis and the actin cytoskeleton. J. Cell Biol. 150:F111-F116.
27 - Qualmann, B., J. Roos, P. J. DiGregorio, and R. B. Kelly. 1999. Syndapin I, a synaptic dynamin-binding protein that associates with the neural Wiskott-Aldrich syndrome protein. Mol. Biol. Cell 10:501-513.[Abstract/Free Full Text]
28 - Schafer, D. A. 2002. Coupling actin dynamics and membrane dynamics during endocytosis. Curr. Opin. Cell Biol. 14:76-81.[CrossRef][Medline]
29 - Schafer, D. A., C. D'Souza-Schorey, and J. A. Cooper. 2000. Actin assembly at membranes controlled by ARF6. Traffic 1:892-903.[Medline]
30 - Schafer, D. A., S. A. Weed, D. Binns, A. V. Karginov, P. J. T., and J. A. Cooper. 2002. Dynamin 2 and cortactin regulate actin assembly and filament organization. Curr. Biol. 12:1852-1857.[CrossRef][Medline]
31 - Seedorf, K., G. Kostka, R. Lammers, P. Baskku, R. Daly, W. H. Burgess, A. M. van der Bliek, J. Schlessinger, and A. Ullrich. 1994. Dynamin binds to SH3 domains of phospholipase C
and GRB-2. J. Biol. Chem. 269:16009-16014.[Abstract/Free Full Text]
32 - Szaszak, M., Z. Gaborik, G. Turu, P. S. McPherson, A. J. L. Clark, K. J. Catt, and L. Hunyady. 2002. Role of the proline-rich domain of dynamin-2 and its interactions with Src homology 3 domains during endocytosis of the AT1 angiotensin receptor. J. Biol. Chem. 277:21650-21656.[Abstract/Free Full Text]
33 - Takei, K., P. S. McPherson, S. L. Schmid, and P. De Camilli. 1995. Tubular membrane invaginations coated by dynamin rings are induced by GTP-
S in nerve terminals. Nature 374:186-190.[CrossRef][Medline]
34 - Takei, K., V. I. Slepnev, V. Haucke, and P. De Camilli. 1999. Functional partnership between amphiphysin and dynamin in clathrin-mediated endocytosis. Nat. Cell Biol. 1:33-39.[CrossRef][Medline]
35 - Taunton, J., B. A. Rowning, M. L. Coughlin, M. Wu, R. T. Moon, T. J. Mitchison, and C. A. Larabell. 2000. Actin-dependent propulsion of endosomes and lysosomes by recruitment of N-WASP. J. Cell Biol. 148:519-530.[Abstract/Free Full Text]
36 - Uruno, T., J. Liu, P. Zhang, Y. Fan, C. Egile, R. Li, S. C. Mueller, and X. Zhan. 2001. Activation of Arp2/3 complex-mediated actin polymerization by cortactin. Nat. Cell Biol. 3:259-265.[CrossRef][Medline]
37 - van der Bliek, A. M., T. E. Redelmeier, H. Damke, E. J. Tisdale, E. M. Meyerowitz, and S. L. Schmid. 1993. Mutations in human dynamin block an intermediate stage in coated vesicle formation. J. Cell Biol. 122:553-563.[Abstract/Free Full Text]
38 - Wang, L. H., T. C. Sudhof, and R. G. Anderson. 1995. The appendage domain of alpha adaptin is a high affinity binding site for dynamin. J. Biol. Chem. 270:10079-10083.[Abstract/Free Full Text]
39 - Weaver, A. M., A. V. Karginov, A. W. Kinley, S. A. Weed, Y. Li, J. T. Parsons, and J. A. Cooper. 2001. Cortactin promotes and stabilizes Arp2/3-induced actin filament network formation. Curr. Biol. 11:370-374.[CrossRef][Medline]
40 - Weed, S. A., A. V. Karginov, D. A. Schafer, A. M. Weaver, A. W. Kinley, J. A. Cooper, and J. T. Parsons. 2000. Cortactin localization to sites of actin assembly in lamellipodia requires interactions with F-actin and the Arp2/3 complex. J. Cell Biol. 151:29-40.[Abstract/Free Full Text]
41 - Weed, S. A., and J. T. Parsons. 2001. Cortactin: coupling membrane dynamics to cortical actin assembly. Oncogene 20:6418-6434.[CrossRef][Medline]
42 - Witke, W., A. V. Podtelejnikov, A. Di Nardo, J. D. Sutherland, C. B. Gurniak, C. Dott, and M. Mann. 1998. In mouse brain profilin I and profilin II associate with regulators of the endocytic pathway and actin assembly. EMBO J. 17:967-976.[CrossRef][Medline]
43 - Wu, H., and J. T. Parsons. 1993. Cortactin, an 80/85-kilodalton pp60src substrate, is a filamentous actin-binding protein enriched in the cell cortex. J. Cell Biol. 120:1417-1426.[Abstract/Free Full Text]
44 - Wu, H., A. B. Reynolds, S. B. Kanner, R. R. Vines, and J. T. Parsons. 1991. Identification of a novel cytoskeleton-associated pp60src substrate. Mol. Cell. Biol. 11:5113-5124. arsid7952991
45 - Zheng, J., S. M. Cahill, M. A. Lemmon, D. Fushman, J. Schlessinger, and D. Cowburn. 1996. Identification of the binding site for acidic phospholipids on the PH domain of dynamin: implications for stimulation of GTPase activity. J. Mol. Biol. 255:14-21.[CrossRef][Medline]
Molecular and Cellular Biology, March 2003, p. 2162-2170, Vol. 23, No. 6
0270-7306/03/$08.00+0 DOI: 10.1128/MCB.23.6.2162-2170.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Coon, B. G., Mukherjee, D., Hanna, C. B., Riese, D. J. II, Lowe, M., Aguilar, R. C.
(2009). Lowe syndrome patient fibroblasts display Ocrl1-specific cell migration defects that cannot be rescued by the homologous Inpp5b phosphatase. Hum Mol Genet
18: 4478-4491
[Abstract]
[Full Text]
-
Mooren, O. L., Kotova, T. I., Moore, A. J., Schafer, D. A.
(2009). Dynamin2 GTPase and Cortactin Remodel Actin Filaments. J. Biol. Chem.
284: 23995-24005
[Abstract]
[Full Text]
-
Lai, F. P.L., Szczodrak, M., Oelkers, J. M., Ladwein, M., Acconcia, F., Benesch, S., Auinger, S., Faix, J., Small, J. V., Polo, S., Stradal, T. E.B., Rottner, K.
(2009). Cortactin Promotes Migration and Platelet-derived Growth Factor-induced Actin Reorganization by Signaling to Rho-GTPases. Mol. Biol. Cell
20: 3209-3223
[Abstract]
[Full Text]
-
Lapetina, S., Mader, C. C., Machida, K., Mayer, B. J., Koleske, A. J.
(2009). Arg interacts with cortactin to promote adhesion-dependent cell edge protrusion. JCB
185: 503-519
[Abstract]
[Full Text]
-
Barroso-Gonzalez, J., Machado, J.-D., Garcia-Exposito, L., Valenzuela-Fernandez, A.
(2009). Moesin Regulates the Trafficking of Nascent Clathrin-coated Vesicles. J. Biol. Chem.
284: 2419-2434
[Abstract]
[Full Text]
-
Salvarezza, S. B., Deborde, S., Schreiner, R., Campagne, F., Kessels, M. M., Qualmann, B., Caceres, A., Kreitzer, G., Rodriguez-Boulan, E.
(2009). LIM Kinase 1 and Cofilin Regulate Actin Filament Population Required for Dynamin-dependent Apical Carrier Fission from the Trans-Golgi Network. Mol. Biol. Cell
20: 438-451
[Abstract]
[Full Text]
-
Kruchten, A. E., Krueger, E. W., Wang, Y., McNiven, M. A.
(2008). Distinct phospho-forms of cortactin differentially regulate actin polymerization and focal adhesions. Am. J. Physiol. Cell Physiol.
295: C1113-C1122
[Abstract]
[Full Text]
-
Singh, V. P., McNiven, M. A.
(2008). Src-mediated Cortactin Phosphorylation Regulates Actin Localization and Injurious Blebbing in Acinar Cells. Mol. Biol. Cell
19: 2339-2347
[Abstract]
[Full Text]
-
Llado, A., Timpson, P., Vila de Muga, S., Moreto, J., Pol, A., Grewal, T., Daly, R. J., Enrich, C., Tebar, F.
(2008). Protein Kinase C{delta} and Calmodulin Regulate Epidermal Growth Factor Receptor Recycling from Early Endosomes through Arp2/3 Complex and Cortactin. Mol. Biol. Cell
19: 17-29
[Abstract]
[Full Text]
-
Cao, H., Chen, J., Awoniyi, M., Henley, J. R., McNiven, M. A.
(2007). Dynamin 2 mediates fluid-phase micropinocytosis in epithelial cells. J. Cell Sci.
120: 4167-4177
[Abstract]
[Full Text]
-
Williams, M. R., Markey, J. C., Doczi, M. A., Morielli, A. D.
(2007). An essential role for cortactin in the modulation of the potassium channel Kv1.2. Proc. Natl. Acad. Sci. USA
104: 17412-17417
[Abstract]
[Full Text]
-
Foraker, A. B., Ray, A., Da Silva, T. C., Bareford, L. M., Hillgren, K. M., Schmittgen, T. D., Swaan, P. W.
(2007). Dynamin 2 Regulates Riboflavin Endocytosis in Human Placental Trophoblasts. Mol. Pharmacol.
72: 553-562
[Abstract]
[Full Text]
-
Hybiske, K., Stephens, R. S.
(2007). Mechanisms of Chlamydia trachomatis Entry into Nonphagocytic Cells. Infect. Immun.
75: 3925-3934
[Abstract]
[Full Text]
-
Zhu, J., Yu, D., Zeng, X.-C., Zhou, K., Zhan, X.
(2007). Receptor-mediated Endocytosis Involves Tyrosine Phosphorylation of Cortactin. J. Biol. Chem.
282: 16086-16094
[Abstract]
[Full Text]
-
Traub, L. M., Lukacs, G. L.
(2007). Decoding ubiquitin sorting signals for clathrin-dependent endocytosis by CLASPs. J. Cell Sci.
120: 543-553
[Abstract]
[Full Text]
-
Toshima, J., Toshima, J. Y., Duncan, M. C., Cope, M. J. T.V., Sun, Y., Martin, A. C., Anderson, S., Yates, J. R. III, Mizuno, K., Drubin, D. G.
(2007). Negative Regulation of Yeast Eps15-like Arp2/3 Complex Activator, Pan1p, by the Hip1R-related Protein, Sla2p, during Endocytosis. Mol. Biol. Cell
18: 658-668
[Abstract]
[Full Text]
-
Lie, P. P Y, Xia, W., Wang, C. Q F, Mruk, D. D, Yan, H. H N, Wong, C.-h., Lee, W. M, Cheng, C Y.
(2006). Dynamin II interacts with the cadherin- and occludin-based protein complexes at the blood-testis barrier in adult rat testes. J Endocrinol
191: 571-586
[Abstract]
[Full Text]
-
Luo, C., Pan, H., Mines, M., Watson, K., Zhang, J., Fan, G.-H.
(2006). CXCL12 Induces Tyrosine Phosphorylation of Cortactin, Which Plays a Role in CXC Chemokine Receptor 4-mediated Extracellular Signal-regulated Kinase Activation and Chemotaxis. J. Biol. Chem.
281: 30081-30093
[Abstract]
[Full Text]
-
Cosen-Binker, L. I., Kapus, A.
(2006). Cortactin: The Gray Eminence of the Cytoskeleton.. Physiology
21: 352-361
[Abstract]
[Full Text]
-
Kim, S. H., Choi, H. J., Lee, K. W., Hong, N. H., Sung, B. H., Choi, K. Y., Kim, S.-M., Chang, S., Eom, S. H., Song, W. K.
(2006). Interaction of SPIN90 with syndapin is implicated in clathrin-mediated endocytic pathway in fibroblasts.. GENES CELLS
11: 1197-1211
[Abstract]
[Full Text]
-
McNiven, M. A., Thompson, H. M.
(2006). Vesicle formation at the plasma membrane and trans-Golgi network: the same but different.. Science
313: 1591-1594
[Abstract]
[Full Text]
-
Rothschild, B. L., Shim, A. H., Ammer, A. G., Kelley, L. C., Irby, K. B., Head, J. A., Chen, L., Varella-Garcia, M., Sacks, P. G., Frederick, B., Raben, D., Weed, S. A.
(2006). Cortactin Overexpression Regulates Actin-Related Protein 2/3 Complex Activity, Motility, and Invasion in Carcinomas with Chromosome 11q13 Amplification. Cancer Res.
66: 8017-8025
[Abstract]
[Full Text]
-
Oberndorfer, I., Schmid, D., Geisberger, R., Achatz-Straussberger, G., Crameri, R., Lamers, M., Achatz, G.
(2006). HS1-Associated Protein X-1 Interacts with Membrane-Bound IgE: Impact on Receptor-Mediated Internalization. J. Immunol.
177: 1139-1145
[Abstract]
[Full Text]
-
Kruchten, A. E., McNiven, M. A.
(2006). Dynamin as a mover and pincher during cell migration and invasion.. J. Cell Sci.
119: 1683-1690
[Abstract]
[Full Text]
-
Orth, J. D., Krueger, E. W., Weller, S. G., McNiven, M. A.
(2006). A novel endocytic mechanism of epidermal growth factor receptor sequestration and internalization.. Cancer Res.
66: 3603-3610
[Abstract]
[Full Text]
-
Tsujita, K., Suetsugu, S., Sasaki, N., Furutani, M., Oikawa, T., Takenawa, T.
(2006). Coordination between the actin cytoskeleton and membrane deformation by a novel membrane tubulation domain of PCH proteins is involved in endocytosis. JCB
172: 269-279
[Abstract]
[Full Text]
-
Kim, D. J., Kim, S. H., Lim, C. S., Choi, K. Y., Park, C. S., Sung, B. H., Yeo, M. G., Chang, S., Kim, J.-K., Song, W. K.
(2006). Interaction of SPIN90 with the Arp2/3 Complex Mediates Lamellipodia and Actin Comet Tail Formation. J. Biol. Chem.
281: 617-625
[Abstract]
[Full Text]
-
Hyman, T., Shmuel, M., Altschuler, Y.
(2006). Actin Is Required for Endocytosis at the Apical Surface of Madin-Darby Canine Kidney Cells where ARF6 and Clathrin Regulate the Actin Cytoskeleton. Mol. Biol. Cell
17: 427-437
[Abstract]
[Full Text]
-
Benesch, S., Polo, S., Lai, F. P. L., Anderson, K. I., Stradal, T. E. B., Wehland, J., Rottner, K.
(2005). N-WASP deficiency impairs EGF internalization and actin assembly at clathrin-coated pits. J. Cell Sci.
118: 3103-3115
[Abstract]
[Full Text]
-
Chan, W., Calderon, G., Swift, A. L., Moseley, J., Li, S., Hosoya, H., Arias, I. M., Ortiz, D. F.
(2005). Myosin II Regulatory Light Chain Is Required for Trafficking of Bile Salt Export Protein to the Apical Membrane in Madin-Darby Canine Kidney Cells. J. Biol. Chem.
280: 23741-23747
[Abstract]
[Full Text]
-
Zhan, Y., Tremblay, M. R., Melian, N., Carbonetto, S.
(2005). Evidence That Dystroglycan Is Associated with Dynamin and Regulates Endocytosis. J. Biol. Chem.
280: 18015-18024
[Abstract]
[Full Text]
-
Timpson, P., Lynch, D. K., Schramek, D., Walker, F., Daly, R. J.
(2005). Cortactin Overexpression Inhibits Ligand-Induced Down-regulation of the Epidermal Growth Factor Receptor. Cancer Res.
65: 3273-3280
[Abstract]
[Full Text]
-
Gray, N. W., Kruchten, A. E., Chen, J., McNiven, M. A.
(2005). A dynamin-3 spliced variant modulates the actin/cortactin-dependent morphogenesis of dendritic spines. J. Cell Sci.
118: 1279-1290
[Abstract]
[Full Text]
-
Chen, C.-Y., Brodsky, F. M.
(2005). Huntingtin-interacting Protein 1 (Hip1) and Hip1-related Protein (Hip1R) Bind the Conserved Sequence of Clathrin Light Chains and Thereby Influence Clathrin Assembly in Vitro and Actin Distribution in Vivo. J. Biol. Chem.
280: 6109-6117
[Abstract]
[Full Text]
-
Zhu, J., Zhou, K., Hao, J.-J., Liu, J., Smith, N., Zhan, X.
(2005). Regulation of cortactin/dynamin interaction by actin polymerization during the fission of clathrin-coated pits. J. Cell Sci.
118: 807-817
[Abstract]
[Full Text]
-
Sauvonnet, N., Dujeancourt, A., Dautry-Varsat, A.
(2005). Cortactin and dynamin are required for the clathrin-independent endocytosis of {gamma}c cytokine receptor. JCB
168: 155-163
[Abstract]
[Full Text]
-
Kowalski, J. R., Egile, C., Gil, S., Snapper, S. B., Li, R., Thomas, S. M.
(2005). Cortactin regulates cell migration through activation of N-WASP. J. Cell Sci.
118: 79-87
[Abstract]
[Full Text]
-
Shajahan, A. N., Tiruppathi, C., Smrcka, A. V., Malik, A. B., Minshall, R. D.
(2004). G{beta}{gamma} Activation of Src Induces Caveolae-mediated Endocytosis in Endothelial Cells. J. Biol. Chem.
279: 48055-48062
[Abstract]
[Full Text]
-
Nesti, E., Everill, B., Morielli, A. D.
(2004). Endocytosis as a Mechanism for Tyrosine Kinase-dependent Suppression of a Voltage-gated Potassium Channel. Mol. Biol. Cell
15: 4073-4088
[Abstract]
[Full Text]
-
Ortiz, D. F., Moseley, J., Calderon, G., Swift, A. L., Li, S., Arias, I. M.
(2004). Identification of HAX-1 as a Protein That Binds Bile Salt Export Protein and Regulates Its Abundance in the Apical Membrane of Madin-Darby Canine Kidney Cells. J. Biol. Chem.
279: 32761-32770
[Abstract]
[Full Text]
-
Kanzaki, M., Furukawa, M., Raab, W., Pessin, J. E.
(2004). Phosphatidylinositol 4,5-Bisphosphate Regulates Adipocyte Actin Dynamics and GLUT4 Vesicle Recycling. J. Biol. Chem.
279: 30622-30633
[Abstract]
[Full Text]
-
Smith, P. M., Cowan, A., White, B. A.
(2004). The Low-Density Lipoprotein Receptor Is Regulated by Estrogen and Forms a Functional Complex with the Estrogen-Regulated Protein Ezrin in Pituitary GH3 Somatolactotropes. Endocrinology
145: 3075-3083
[Abstract]
[Full Text]
-
Engqvist-Goldstein, A. E. Y., Zhang, C. X., Carreno, S., Barroso, C., Heuser, J. E., Drubin, D. G.
(2004). RNAi-mediated Hip1R Silencing Results in Stable Association between the Endocytic Machinery and the Actin Assembly Machinery. Mol. Biol. Cell
15: 1666-1679
[Abstract]
[Full Text]
-
Hommelgaard, A. M., Lerdrup, M., van Deurs, B.
(2004). Association with Membrane Protrusions Makes ErbB2 an Internalization-resistant Receptor. Mol. Biol. Cell
15: 1557-1567
[Abstract]
[Full Text]
-
Lynch, D. K., Winata, S. C., Lyons, R. J., Hughes, W. E., Lehrbach, G. M., Wasinger, V., Corthals, G., Cordwell, S., Daly, R. J.
(2003). A Cortactin-CD2-associated Protein (CD2AP) Complex Provides a Novel Link between Epidermal Growth Factor Receptor Endocytosis and the Actin Cytoskeleton. J. Biol. Chem.
278: 21805-21813
[Abstract]
[Full Text]