This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Laffitte, B. A.
Right arrow Articles by Tontonoz, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Laffitte, B. A.
Right arrow Articles by Tontonoz, P.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, March 2003, p. 2182-2191, Vol. 23, No. 6
0270-7306/03/$08.00+0     DOI: 10.1128/MCB.23.6.2182-2191.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

The Phospholipid Transfer Protein Gene Is a Liver X Receptor Target Expressed by Macrophages in Atherosclerotic Lesions

Bryan A. Laffitte,1 Sean B. Joseph,2 Mingyi Chen,2 Antonio Castrillo,1 Joyce Repa,3 Damien Wilpitz,1 David Mangelsdorf,1,3 and Peter Tontonoz1,2*

Howard Hughes Medical Institute,1 Department of Pathology and Laboratory Medicine, University of California, Los Angeles, California 90095-1662,2 Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, Texas 75390-90503

Received 14 August 2002/ Returned for modification 14 October 2002/ Accepted 9 December 2002


arrow
ABSTRACT
 
The liver X receptors (LXRs) are members of the nuclear receptor superfamily that are activated by oxysterols. In response to ligand binding, LXRs regulate a variety of genes involved in the catabolism, transport, and uptake of cholesterol and its metabolites. Here we demonstrate that LXRs also regulate plasma lipoprotein metabolism through control of the phospholipid transfer protein (PLTP) gene. LXR ligands induce the expression of PLTP in cultured HepG2 cells and mouse liver in vivo in a coordinate manner with known LXR target genes. Moreover, plasma phospholipid transfer activity is increased in mice treated with the synthetic LXR ligand GW3965. Unexpectedly, PLTP expression was also highly inducible by LXR in macrophages, a cell type not previously recognized to express this enzyme. The ability of synthetic and oxysterol ligands to regulate PLTP mRNA in macrophages and liver is lost in animals lacking both LXR{alpha} and LXRß, confirming the critical role of these receptors. We further demonstrate that the PLTP promoter contains a high-affinity LXR response element that is bound by LXR/RXR heterodimers in vitro and is activated by LXR/RXR in transient-transfection studies. Finally, immunohistochemistry studies reveal that PLTP is highly expressed by macrophages within human atherosclerotic lesions, suggesting a potential role for this enzyme in lipid-loaded macrophages. These studies outline a novel pathway whereby LXR and its ligands may modulate lipoprotein metabolism.


arrow
INTRODUCTION
 
Atherosclerosis is the leading cause of morbidity and mortality in most industrialized countries. The development of atherosclerosis is a complex process involving lipoproteins and cells present in the artery wall, including endothelial cells, macrophages, and smooth muscle cells (9, 26). The best-established risk factor for atherosclerosis is elevated levels of low-density lipoprotein (LDL) or intermediate-density lipoprotein in the plasma. These lipoproteins, along with very-low-density lipoprotein (VLDL) and chylomicrons, are thought to increase the formation of atherosclerotic lesions and are considered proatherogenic. In contrast, high-density lipoproteins (HDL) are inversely associated with risk of atherosclerosis and are considered antiatherogenic. Therefore, an understanding of the regulation of lipoprotein metabolism may assist in the development of new therapies in the treatment of atherosclerosis.

HDL displays several antiatherogenic activities. Among these is the ability of HDL to shuttle cholesterol from peripheral tissues to the liver in the so-called reverse cholesterol transport pathway (34). HDL is a heterogenous population of particles that differ in size, composition, and the ability to perform specific functions. For example, large, spherical HDL particles (called {alpha}-HDL) effectively deliver cholesteryl esters to the liver. In contrast, small discoidal lipid-poor HDL particles (called pre-ß-HDL) are effective acceptors of cholesterol from peripheral tissues. Therefore, plasma proteins that assist in the remodeling of HDL are important to the proper functioning of HDL.

One key modulator of HDL levels, size, and composition is the phospholipid transfer protein (PLTP) (10, 40). PLTP assists in the formation of pre-ß-HDL and {alpha}-HDL by transferring phospholipids and cholesterol from VLDL and chylomicrons to HDL during lipolysis by lipoprotein lipase. This activity is clearly demonstrated in PLTP-deficient mice, which lack phospholipid transfer activity from VLDL to HDL, display massive reductions in HDL phospholipid and HDL cholesterol levels, and, on a high-fat diet, show increases in VLDL and LDL levels (15). Furthermore, both in vitro and in vivo studies have demonstrated that PLTP acts directly on mature HDL, causing formation of larger {alpha}-HDL and smaller pre-ß-HDL particles (11, 13-15, 24, 37, 39). Mice expressing moderate levels of human transgenes for both PLTP and apolipoprotein AI (ApoAI) have increased levels of pre-ß-HDL and {alpha}-HDL (14). However, when PLTP is massively overexpressed, HDL cholesterol levels are decreased due to increased hepatic uptake of HDL cholesterol esters and phospholipids (1, 7, 8). These mice, despite lower HDL cholesterol levels, also displayed marked increases in pre-ß-HDL (11, 39). These findings support a central role for PLTP in HDL metabolism and suggest that PLTP may increase reverse cholesterol transport.

Nuclear receptors are a class of transcription factors that regulate gene expression in response to ligand binding. These receptors typically bind to lipid ligands and regulate the expression of genes that control various aspects of the metabolism of the ligand. The liver X receptor (LXR) subfamily of nuclear receptors are bound and transcriptionally activated by oxidized forms of cholesterol (oxysterols) (12, 23). In response to ligand binding, LXRs regulate genes involved in the uptake, catabolism, and transport of excess cholesterol and oxysterols in the body (22, 25, 32). Thus, LXRs act as molecular sensors of cholesterol levels and respond by inducing processes that reduce cholesterol levels. In peripheral cells such as macrophages, LXRs increase cholesterol efflux by inducing expression of ATP-binding cassette A1 (ABCA1), ABCG1, and ApoE (5, 21, 33, 41, 42). In the intestine, LXR agonists decrease cholesterol absorption through induction of ABCA1, ABCG5, and ABCG8 (2, 30, 33). In murine (but not human) liver, LXRs increase the catabolism of cholesterol by increasing bile acid synthesis through induction of the CYP7A1 gene (23, 29).

Here we demonstrate an additional role of LXRs in the control of plasma HDL metabolism. We show that oxysterol and synthetic LXR ligands regulate expression of the PLTP gene in liver and macrophages in an LXR-dependent manner and that synthetic LXR ligands induce plasma PLTP enzyme activity in mice. Surprisingly, PLTP is highly expressed by macrophages in human atherosclerotic lesions, suggesting an unrecognized role for PLTP in this context. These findings suggest that LXRs may regulate reverse cholesterol transport through multiple mechanisms, including induction of cholesterol efflux, cholesterol catabolism, and lipoprotein remodeling.


arrow
MATERIALS AND METHODS
 
Reagents and plasmids. pCMX expression plasmids for LXR{alpha}, LXRß, and retinoid X receptor {alpha} (RXR{alpha}) have been described (21). pCMX-VP16-LXR{alpha} and pCMX-VP16-LXRß were gifts from Ron Evans (Salk Institute). GW3965 and T0901317 were kindly provided by Jon Collins and Tim Willson (GlaxoSmithKline). LG268 was kindly provided by Rich Heyman (Ligand Pharmaceuticals). Ligands were dissolved in ethanol or dimethyl sulfoxide (DMSO) prior to use in cell culture. Reporter plasmids containing two copies of a PLTP direct repeat (DR4; see below) elements (pTK-2xDR4B-Luc) were generated by ligating two copies of oligonucleotides corresponding to sequences from the human PLTP promoter into the BamHI site of pTK-Luciferase. For PLTP DR4A and DR4B, the oligonucleotides used were gatcggtgTGACCCacca TGCCCAgcct and gatcccttTGAACTctag TAACCTtcct, respectively (sense strand only; half-sites shown in capitals).

Cell culture and transfections. THP-1 and wild-type (WT) Macs cells were cultured in RPMI medium containing 10% fetal bovine serum (FBS). HepG2 cells were grown in minimal essential medium (MEM) containing 10% FBS. Peritoneal macrophages were obtained from thioglycolate-injected mice as described elsewhere (41) and cultured in Dulbecco's MEM (DMEM) containing 10% FBS. For ligand treatments, cells were cultured in RPMI medium or DMEM, supplemented with 5% lipoprotein-deficient serum (LPDS) (Intracel) and receptor ligands for 24 h unless otherwise indicated. In some experiments, cells were sterol depleted by the inclusion of 5 µM simvastatin and 100 µM mevalonic acid during the treatment period. Transient transfections of HepG2 cells were performed in triplicate in 48-well plates. Cells were transfected with reporter plasmid (100 ng/well), receptor plasmids (5 to 50 ng/well), pCMV-ß-galactosidase (50 ng/well), and pTKCIII (to a total of 205 ng/well) with the MBS mammalian transfection kit (Stratagene). Following transfection, cells were incubated in MEM containing 10% LPDS and the appropriate ligands or vehicle control for 24 h. Luciferase activity was normalized to ß-galactosidase activity.

RNA and protein analysis. Total RNA was isolated by using the Trizol reagent (Life Technologies, Inc.). Northern analysis was performed as described elsewhere (41) using radiolabeled cDNA probes. Blots were normalized using cDNA probes to 36B4 and quantitated by PhosphorImager (Molecular Dynamics) analysis. Real-time quantitative PCR assays were performed with an Applied Biosystems 7700 sequence detector. Briefly, 1 µg of total RNA was reverse transcribed with random hexamers by using a TaqMan reverse transcription reagent kit (Applied Biosystems) according to the manufacturer's protocol. Each amplification mixture (20 µl) contained 20 ng of cDNA, 500 nM forward primer, 500 nM reverse primer, 100 nM dually labeled fluorogenic probe (Applied Biosystems), and 12.5 µl of universal PCR master mix. PCR thermocycling parameters were 50°C for 2 min, 95°C for 10 min, and 40 cycles of 95°C for 15 s and 60°C for 1 min. All samples were analyzed for 36B4 (human or mouse) expression in parallel in the same run for normalization. Quantitative expression values were extrapolated from separate standard curves for 36ß4 or the indicated gene generated with 10-fold dilutions of cDNA (in duplicate). Each sample was normalized to 36ß4, and then replicates were averaged and the relative (-fold) induction was determined. Probe and primer sequences are available upon request. For Western blots, total cell lysates were separated by polyacrylamide gel electrophoresis, transferred to membranes, and blotted for PLTP by using an anti-PLTP polyclonal antibody (Cardiovascular Targets, Inc., New York, N.Y.). Equal loading and transfer of proteins were verified by blotting for ß-actin.

Gel shift assays. In vitro-translated RXR{alpha} and LXR{alpha} were generated from pCMX-RXR{alpha} and pCMX-hLXR{alpha} plasmids using the TNT quick coupled transcription-translation system (Promega). Gel shift assays were performed as described elsewhere (20) using in vitro-translated proteins and the following oligonucleotides (only one strand shown): PLTP DR4A, GATCGGTGTGACCC ACCATGCCCAGCCT; PLTP DR4B, GATCCCTTTGAACTCTAGTAACCT TCCT; hLXR{alpha} DR4C, GATCGCTGAGGTTACTGCTGGTCATTCA; CYP7A1 LXRE, CCTTTGGTCACTCAAGTTCAAGTG.

Animals and diets. ApoE knockout mice on a C57BL6 background or C57BL6 WT mice were maintained on a normal chow diet. Six-week-old male C57BL6 WT mice or 8-month old ApoE-/- mice were treated with GW3965 by gavage for 5 days at 30 mg/kg of mouse weight. LXR WT and LXR double-knockout (DKO) animals were treated with LG268 (30 mg/kg) solubilized in 0.9% carboxy methylcellulose, 9% PEG-400, and 0.05% Tween 80 or T1317 (50 mg/kg) in 1% methylcellulose and 1% Tween 80 for 10 days. Following euthanization, blood was collected from the abdominal vena cava and tissues were harvested for RNA with the Trizol reagent. All animal experiments were approved by the Institution Animal Care and Research Advisory Committees of the University of Southwestern Medical Center and the University of California, Los Angeles.

PLTP activity assay. Plasma PLTP activity was measured by using a fluorescence-based assay (Cardiovascular Targets, Inc.). Briefly, 3 µl of mouse plasma was incubated with donor and acceptor particles. The donor contains a fluorescent phospholipid that is in the quenched state when associated with the donor. PLTP-mediated transfer of the phospholipid to the acceptor results in increased fluorescence intensity. A PLTP-neutralizing antibody (Cardiovascular Targets, Inc.) was used where indicated.

Immunohistochemistry. A segment of human left coronary artery containing atherosclerotic plaques was harvested from a patient at autopsy, snap-frozen, and stored at -80°C. After fixing for 5 min in cold acetone, frozen sections (6 µm) were processed for immunohistochemical staining. For PLTP staining, frozen sections were incubated with purified rabbit anti-human PLTP polyclonal antibody (Cardiovascular Targets, Inc.), followed by biotinylated goat anti-rabbit immunoglobulin G IgG (Dako). Following incubation with an avidin-biotin peroxidase conjugate, samples were visualized with 3,3'-diaminobenzidine (Vector Laboratories). CD68 staining was performed with an anti-human CD68 monoclonal antibody (Dako), followed by incubation with alkaline phosphatase-conjugated anti-mouse IgG (Vector Laboratories) and visualization with vector red alkaline phosphatase substrate solution. Staining with nonimmune rabbit IgG (Dako) served as a negative control.

DNA microarray analysis. Thioglycolate-elicited peritoneal macrophages were obtained as described above, and cells were cultured in DMEM supplemented with 10% LPDS (Intracel), 5 µM simvastatin, and 100 µM mevalonic acid in the presence or absence of T1317 (10 µM) for 48 h. Total RNA was isolated by using the Trizol reagent and further purified with an RNeasy total RNA isolation kit (Qiagen). Total RNA (10 µg) was reverse transcribed by using a T7-(dT)24 primer (Genset Corp.) and the Superscript Choice system (Life Technologies). The resulting cDNA was used to generate biotin-labeled cRNA with a bioarray high-yield transcript labeling kit (Enzo). Fragmentation of cRNA was performed at 94°C using 40 mM Tris-acetate (pH 8.1), 100 mM potassium acetate, and 30 mM magnesium acetate. Samples were hybridized to Affymetrix murine U74Av2 microarrays and visualized by the PAN Facility at Stanford University. The results of the microarrays were analyzed with GeneChip Analysis Suite software (Affymetrix).


arrow
RESULTS
 
As part of a systematic effort to identify LXR target genes in macrophages, we performed DNA microarray experiments on mouse macrophages treated with LXR ligands. Thioglycolate-elicited peritoneal macrophages were incubated in the presence or absence of the synthetic, high-affinity LXR agonist T1317 (5 µM) for 24 h. Total RNA isolated from these cells was used to generate biotinylated cRNA probes for hybridization to Affymetrix murine U74Av2 microarrays. Analysis of the results of the microarrays revealed upregulation of several known LXR target genes by T1317 treatment, including ABCA1 (79-fold), ABCG1 (3.0-fold), fatty acid synthase (FAS) (5.0-fold), SREBP-1 (3.4-fold), lipoprotein lipase (5.0-fold) and ApoCI (38-fold) (Table 1). In addition, the microarrays showed a 4.7-fold induction of PLTP mRNA by T1317 (Table 1). This was unexpected, as PLTP has not been reported previously to be expressed in macrophages. We confirmed the results of the microarrays by performing Northern blotting on RNA derived from peritoneal macrophages treated with a variety of LXR agonists. As shown in Fig. 1A, synthetic LXR ligands (T1317 and GW3965) or naturally occurring ligands [20(S)- and 22(R)-hydroxycholesterol (OHC)] induced expression of PLTP over treatment with vehicle alone. LXR is known to function as a permissive heterodimer with RXR, and the LXR/RXR heterodimer can be activated by either LXR or RXR ligands. Addition of RXR ligands also increased PLTP expression in peritoneal macrophages, particularly in combination with an LXR agonist (Fig. 1A). Importantly, 22(S)-OHC, which does not activate LXR, did not induce PLTP expression. The induction of PLTP by LXR ligands paralleled the induction of known LXR target genes such as the ApoE and ABCA1 genes (Fig. 1A and data not shown). To determine if LXR ligands could also induce PLTP expression in other cell types, we treated differentiated THP-1 cells, HepG2 cells, or primary human hepatocytes with LXR and RXR agonists (Fig. 1B to D). In each of these cell types, LXR ligands increased expression of PLTP mRNA, suggesting that LXR may regulate PLTP expression in multiple cell types and physiologic contexts.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Results of Affymetrix murine U74Av2 microarraysa




View larger version (69K):
[in this window]
[in a new window]
 
FIG. 1. Induction of PLTP mRNA levels by LXR ligands in various cell types. (A and B) Naturally occurring and synthetic LXR and RXR agonists induce PLTP expression in murine and human macrophages. (A) Thioglycolate-elicited peritoneal macrophages were isolated from C57BL6 mice and incubated in RPMI medium containing 5% LPDS with vehicle only (DMSO), 5 µM 20(S)-OHC, 5 µM 22(R)-OHC, 5 µM 22(S)-OHC, 1 µM T1317, 1 µM GW3965, and/or 50 nM LG268 for 24 h. (B) THP-1 cells were differentiated for 24 h with tetradecanoyl phorbol acetate (40 ng/ml) and then incubated in RPMI with 5% LPDS and the indicated ligands as described above. PLTP mRNA levels were determined by real-time quantitative PCR (TaqMan assays; see Materials and Methods) and normalized by dividing by 36B4 levels. PLTP mRNA levels are presented as expression relative to the level in the presence of vehicle alone (DMSO), which was arbitrarily set to 1.0. (C and D) LXR ligands regulate PLTP expression in human hepatocytes. HepG2 cells or primary human hepatocytes were incubated in medium containing 10% LPDS and T1317 (1 µM) or GW3965 (1 µM) for 24 h. PLTP, FAS, LXR{alpha}, and 36B4 mRNA levels were monitored by Northern blotting (C) or TaqMan assays (D).

To determine if PLTP mRNA levels could be regulated by LXR ligands in vivo, we treated C57BL6 mice with vehicle or the synthetic LXR agonist GW3965 for 5 days (five mice per group). As shown in Fig. 2A, GW3965 induced PLTP expression in a variety of tissues, including liver, intestine, and adipose tissue (P < 0.01). As a positive control, levels of ABCA1 mRNA were quantitated in the same samples (Fig. 2B). As expected, LXR ligand treatment increased ABCA1 levels in the intestine and adipose tissue but not in the liver (18). We further investigated whether plasma PLTP activity was altered by GW3965 in these mice. Indeed, mice treated with GW3965 showed approximately a twofold increase in phospholipid transfer activity compared to vehicle-treated animals (P < 0.01) (Fig. 2C). This activity was inhibited by the addition of a PLTP-neutralizing antibody by more than 60%, confirming the specificity of the assay (data not shown). These findings demonstrate that LXR agonists induce both PLTP mRNA expression and enzymatic activity in vivo.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 2. LXR ligands regulate PLTP mRNA expression and plasma activity in vivo. (A and B) Expression of PLTP mRNA is increased in mice treated with a synthetic LXR ligand. C57BL6 mice (five per group) were given the LXR ligand GW3965 (30 mg/kg) or vehicle only (0.5% methylcellulose) by gavage for 5 days. Tissues were harvested for RNA, and PLTP and ABCA1 levels were determined by TaqMan assays. The PLTP mRNA levels in vehicle-treated mice were arbitrarily set to 1.0 (**, P < 0.05; *, P < 0.01). (C) Plasma PLTP activity is increased in mice treated with a synthetic LXR ligand. C57BL6 mice were treated as described above, and plasma was isolated from the abdominal vena cava following euthanasia. PLTP activity was determined using a fluorescence-based PLTP assay (see Materials and Methods). Each point represents the average results from five mice plus the standard error; each assay was performed in triplicate.

It was recently demonstrated that GW3965 is capable of inducing LXR target gene expression in atherosclerotic aortas (18). We therefore investigated whether PLTP might also be regulated by LXR in this context. ApoE-/- mice 8 months of age were treated with vehicle or GW3965 for 3 days. At this age, ApoE-/- mice exhibit extensive atherosclerosis. Atherosclerotic aortas from these mice were isolated and used to prepare total RNA as described in Material and Methods. Real-time quantitative PCR (TaqMan) analysis demonstrated increased expression of PLTP mRNA in mice treated with LXR ligand compared to vehicle alone (P < 0.05) (Fig. 3A). The induction of PLTP in this experiment was comparable to that of the established LXR target ABCA1. Importantly, expression of the macrophage-specific marker CD68 was not significantly different between samples, indicating that increased PLTP levels were not due to increased numbers of macrophages in the aortas of GW3965-treated animals. Expression of LXR{alpha} mRNA was also not different between the two groups. To further localize the expression of PLTP to atherosclerotic lesions, we performed immunohistochemical staining for PLTP on sections from human atherosclerotic lesions. As shown in Fig. 3C, anti-PLTP antibody showed strong staining within the atherosclerotic lesions. By contrast, no macrophage staining was observed with control nonspecific antibody (Fig. 3B). Moreover, this expression was found to be particularly strong in regions containing large numbers of CD68-positive macrophages (Fig. 3D and F). Expression of PLTP antigen in macrophage-rich regions of the lesion was further confirmed with dual staining (Fig. 3E and G). PLTP expression within lesions was more diffuse than that observed for CD68, consistent with the fact that it is a secreted protein. Taken together, these results demonstrate that PLTP is expressed by macrophages within atherosclerotic lesions and can be regulated by LXR in that context.




View larger version (189K):
[in this window]
[in a new window]
 
FIG. 3. Expression and regulation of PLTP in atherosclerotic lesions. (A) LXR ligands induce PLTP expression within atherosclerotic lesions. ApoE-/- mice were given 10 mg of GW3965 per kg or vehicle alone by gavage for 5 days. Atherosclerotic aorta was harvested for RNA, and PLTP, ABCA1, LXR{alpha}, and CD68 levels were determined by TaqMan assay. Values were normalized to expression of 36B4 and are the averages for three mice ± standard errors (*, P < 0.05; **, P < 0.01). (B to G) Localization of PLTP to macrophage-rich regions within human atherosclerotic lesions. Frozen sections of human atherosclerotic lesions were stained with control IgG (B), anti-PLTP polyclonal antibody (brown) (C), macrophage-specific anti-CD68 monoclonal antibody (red) (D and F), or both anti-PLTP and anti-CD68 (E and G). PLTP staining is prominent in macrophage-rich areas of the atherosclerotic lesion. Objective magnification, x5 (B and C), x20 (D and E), and x40 (F and G).

To determine if PLTP regulation by LXR was direct, we examined the human PLTP promoter. LXR/RXR heterodimers are known to bind to direct repeats of a hexanucleotide repeat spaced by 4 bp (DR4). No apparent LXR response element (LXRE, or DR4) was found within the previously published sequence of approximately 1,400 bp (National Center for Biotechnology Information accession no. U38950). However, the human genomic sequence of the PLTP gene was recently assembled as part of the human genome project. We analyzed the sequence of chromosome 20q12-13.1 (National Center for Biotechnology Information accession no. AL008726), including the PLTP gene, for LXREs and found two potential binding sites (DR4A and DR4B) within 3,000 bp of the PLTP transcriptional start site (Fig. 4). DR4A, located at -1570 bp relative to the start site, was unable to bind LXR/RXR in an electrophoretic mobility shift assay (EMSA) (Fig. 5A). However, DR4B, located at -2737 bp, effectively bound LXR/RXR with apparently higher affinity than the previously described LXRE from the human LXR{alpha} gene (Fig. 5A and B). We also analyzed the murine PLTP gene by searching the Celera database (mCG17532). Both human and murine PLTP DR4 sequences show significant similarity to other known LXREs (Fig. 4B).



View larger version (39K):
[in this window]
[in a new window]
 
FIG. 4. Potential LXREs in the human PLTP promoter. (A) Schematic representation of the human PLTP promoter. The locations of possible LXREs (DR4A and DR4B) are indicated with distance from the transcriptional start site (+1). The location of the FXR response element (FXRE) is also shown. (B) Alignment of potential PLTP LXREs with other known LXR binding sites. The sequence of each hexanucleotide repeat is boxed and shown in capital letters, and the direction is noted with an arrow. The potential LXRE sequences in the human and mouse PLTP genes have not been proven.



View larger version (56K):
[in this window]
[in a new window]
 
FIG. 5. The PLTP promoter contains a high-affinity LXRE. (A and B) LXR/RXR heterodimers bind to DR4 from the human PLTP promoter region. (A) EMSAs were performed with 32P-, end-labeled oligonucleotides corresponding to the DR4A or DR4B sequences from the human PLTP promoter or the LXRE from the human LXR{alpha} promoter. Equivalent amounts of labeled oligonucleotides were added in each lane. In vitro-translated LXR{alpha} and/or RXR proteins or unprogrammed lysate was added. (B) Competitive EMSAs were performed as described above with in vitro-translated LXR{alpha} and RXR proteins and 32P-, end-labeled PLTP DR4B oligonucleotides. Unlabeled oligonucleotides were added to the binding reaction mixture as competitors at the indicated molar excess. (C) LXR activates the natural human PLTP promoter. A promoter-reporter plasmid containing the human PLTP promoter (-2763 to +92) was cotransfected into HepG2 cells with expression vectors for LXR{alpha} and ß-galactosidase. Following transfection, cells were incubated for 24 h in MEM containing 5% LPDS with or without 5 µM GW3965. Luciferase values were normalized for transfection efficiency by using ß-galactosidase activity. (D) PLTP DR4B confers responsiveness to LXR. Promoter-reporter plasmid pTK-2xDR4B-Luc or the empty vector pTK-Luc was cotransfected with expression vectors for LXR{alpha}, VP16-LXR{alpha}, or VP16-LXRß and ß-galactosidase as described above.

We next investigated the ability of LXR to regulate the human PLTP-proximal promoter. HepG2 cells were transiently transfected with expression vectors for LXR and RXR along with a luciferase reporter containing sequences from -2763 bp to +92 bp of the PLTP promoter. Following transfection, cells were treated for 24 h with vehicle or GW3965. As shown in Fig. 5C, the PLTP promoter was strongly activated by LXR/RXR in a ligand-dependent manner. We further tested whether DR4B isolated from the human PLTP promoter could act as a functional LXRE by placing two copies of this sequence upstream of a minimal thymidine kinase promoter and a luciferase reporter gene. When cotransfected with LXR{alpha} and RXR{alpha} expression vectors, the pTK-2xDR4B-Luc reporter was activated approximately ninefold by the LXR agonist GW3965, whereas the empty vector pTK-Luc was not responsive (Fig. 5D). Furthermore, cotransfection of expression vectors encoding constitutively active VP16-LXR fusion proteins (VP-LXR{alpha} or VP-LXRß) resulted in marked activation of the pTK-2xDR4B-Luc reporter (Fig. 5D). These results demonstrate the presence of a functional LXRE within the promoter region of the human PLTP gene.

It has been shown that overexpression of LXR{alpha} can potentiate expression of LXR target genes to ligand activation (41). Therefore, we generated LXR{alpha}-overexpressing cells by infecting RAW murine macrophages with a retrovirus encoding LXR{alpha} (RAW-LXR{alpha} cells). Cells infected with the empty vector served as a control. RAW-LXR{alpha} or RAW control cells were exposed to increasing concentrations of the LXR ligand 20(S)-OHC, and PLTP mRNA levels were monitored by TaqMan assays. As we have previously shown for LXR target ABCA1 and ABCG1 genes, overexpression of LXR{alpha} resulted in a shift of the dose-response curve to the left (Fig. 6). Thus, PLTP mRNA levels were induced in RAW-LXR{alpha} cells at lower concentrations of 20(S)-OHC than RAW control cells (Fig. 6).



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 6. Retroviral expression of LXR{alpha} potentiates PLTP expression. RAW264.7 murine macrophages were infected with an empty retroviral vector (control) or an LXR{alpha}-encoding vector (+ LXR{alpha}). Cells were incubated in medium containing 10% LPDS with increasing concentrations of 20(S)-OHC. PLTP and 36B4 levels were determined by TaqMan assay. PLTP mRNA levels were normalized to 36B4, and the normalized level of the untreated RAW control was arbitrarily set to 1.0.

The requirement for LXR in the induction of PLTP mRNA was further examined by using LXR knockout mice. As expected, in peritoneal macrophages derived from WT mice, LXR (22R-OHC or T1317) and/or RXR (LG268) ligands increased PLTP mRNA levels (Fig. 7A and B). Loss of either LXR{alpha} or LXRß modestly reduced the induction of PLTP by 22R-OHC but had no significant effect on activation by T1317. However, the induction of PLTP by LXR and RXR ligands was completely abolished in macrophages lacking both LXR{alpha} and LXRß (LXR DKO) (Fig. 7A and B). We also investigated PLTP expression in WT and DKO macrophages. As shown in Fig. 7C, treatment with an LXR agonist resulted in an induction in PLTP expression as measured by Western blotting with anti-PLTP antibody. Moreover, expression of PLTP was markedly reduced in macrophages lacking LXRs and was not inducible by an LXR agonist.



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 7. LXR-dependent regulation of PLTP expression in macrophages. (A and B) Thioglycolate-elicited peritoneal macrophages were isolated from WT, LXR{alpha} -/-, LXRß-/-, or LXR DKO mice, as described above. Macrophages were treated with 22(R)-OHC (5 µM), LG268 (50 nM), T1317 (2 µM), or vehicle (DMSO) only for 24 h in RPMI medium containing 10% LPDS. PLTP mRNA levels were monitored by TaqMan assay as described above. Values are normalized to ribosomal protein 36B4 mRNA levels and presented as relative mRNA levels, with the PLTP mRNA level in WT macrophages treated with DMSO only arbitrarily set to 1.0. (C) Induction of PLTP levels by LXR agonists is LXR dependent. Murine thioglycolate-elicited peritoneal macrophages isolated from WT or LXR DKO mice were incubated in RPMI medium containing 10% LPDS and vehicle (DMSO) only, T1317 (2 µM), or GW3965 (2 µM) for 24 h. Total cell lysates were separated by polyacrylamide gel electrophoresis, transferred to membranes, and blotted for PLTP with an anti-PLTP polyclonal antibody (Cardiovascular Targets, Inc.). Equal loading and transfer of proteins were verified by blotting for ß-actin.

Finally, to test if LXR was required for induction of PLTP in vivo, WT or LXR DKO mice were treated with vehicle, LG268 (30 mg/kg), or T1317 (50 mg/kg) for 10 days. PLTP mRNA levels were induced by T1317 in the liver of WT but not LXR DKO mice (Fig. 8B). Similar results were observed for the known LXR target genes, including those for Cyp7A1 and lipoprotein lipase (Fig. 8A and data not shown). Furthermore, the basal levels of PLTP were reduced in LXR DKO mice compared to WT mice (Fig. 8B). RXR ligands also induced hepatic PLTP expression, and this was reduced in mice lacking LXRs (Fig. 8B). The modest activation of PLTP mRNA levels by the RXR ligand (LG268) is likely due to activation of PLTP by additional RXR heterodimers, including farnesoid X receptor (FXR)/RXR or peroxisome proliferator-activated receptor {alpha} (PPAR{alpha})/RXR, that have been reported (3, 20) to activate PLTP. These finding definitively establish a role for LXRs in the regulation of PLTP mRNA levels in vivo.



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 8. In vivo regulation of PLTP mRNA levels depends on LXR expression. (A and B) WT or LXR DKO mice were fed 0.2% cholesterol diets containing vehicle only, LG268 (30 mg/kg), or T1317 (50 mg/kg) for 10 days. Total RNA was isolated from liver and expression of hepatic PLTP mRNA (A) and hepatic Cyp7a (B) was monitored by Northern blotting. Blots were quantitated by phosphorimaging and normalized to ß-actin levels.


arrow
DISCUSSION
 
The nuclear oxysterol receptors LXR{alpha} and LXRß are key regulators of various aspects of cholesterol metabolism. The LXRs have been shown to regulate cholesterol absorption in the intestine, cholesterol catabolism in the liver, and cholesterol efflux from peripheral tissues. We show here that LXRs regulate expression of PLTP mRNA levels in response to LXR ligands in a variety of tissues, including intestine, liver, and fat. We demonstrate that both LXR and RXR ligands regulate PLTP levels in a variety of cell types and tissues in a coordinate fashion with other known LXR target genes. Furthermore, PLTP activity was increased in the plasma of mice treated with a synthetic LXR ligand. Regulation of PLTP by LXR ligands was abolished in LXR-deficient animals or cells, demonstrating a critical role for LXR in the regulation of PLTP. These findings identify an additional role for LXRs in the control of lipoprotein metabolism.

The LXRs have been implicated in the control of HDL metabolism through regulation of the cholesterol-phospholipid transporter ABCA1 (22, 25, 32). Loss-of-function mutations of ABCA1 result in extremely low HDL levels in both humans and mice (28). Short-term administration of synthetic LXR ligands to animals results in induction of ABCA1 and increases in plasma HDL cholesterol and phospholipid levels (17, 35). At the same, short-term treatment with LXR ligands also dramatically raises plasma triglyceride levels (17, 35). The mechanism for this effect is likely to involve the transcriptional induction of genes critical for lipogenesis, including SREBP-1c and FAS (17, 31, 35, 43). A complete understanding of the mechanisms underlying LXR effects on systemic lipid levels will be required if LXR agonists are to be optimized as therapeutic agents.

The present work suggests that LXR agonists may also modulate lipid metabolism through control of PLTP expression. The role of PLTP in mammalian physiology is complex and the subject of ongoing research, and the implications of the PLTP-LXR connection are not yet clear. PLTP has been identified as a key modulator of HDL metabolism, and studies have also suggested a role in reverse cholesterol transport (10, 40). The importance of PLTP in HDL metabolism was clearly demonstrated by the massive decrease in HDL levels in mice lacking PLTP (15). In addition, PLTP has recently been shown to regulate VLDL secretion from the liver. PLTP-deficient mice were shown to have decreased levels of VLDL and LDL when placed on an ApoE-deficient or ApoB-transgenic background (16). Therefore, the previously reported actions of LXR agonists on HDL and VLDL levels are consistent with the known roles for PLTP in lipoprotein metabolism. In particular, it seems likely that the ability of LXR agonists to raise plasma VLDL and triglyceride levels may involve PLTP.

Despite the importance of PLTP in various aspects of lipoprotein metabolism, relatively little is known about the mechanisms controlling its expression. In addition to LXR, PLTP expression is regulated by other nuclear receptor RXR heterodimers, including PPAR{alpha}/RXR and FXR/RXR. In mice, treatment with PPAR{alpha} ligands such as fibrates results in increased HDL size through induction of hepatic PLTP mRNA and plasma PLTP activity (3). This increase in HDL size by fibrate treatment was completely abolished in PLTP-deficient mice, and the induction of PLTP mRNA and activity was dramatically reduced in PPAR{alpha}-deficient animals (3). However, no positive response element for PPAR{alpha} has been identified in the PLTP promoter. PLTP mRNA expression is also regulated by ligands of FXR (bile acids) in both human and rat hepatocytes, and overexpression of FXR increases this response (20). Hepatic PLTP levels are induced in mice fed a diet high in the bile acid cholate, and this effect is lost in FXR-deficient animals (19). The promoter of the human PLTP gene contains a functional FXR response element and is therefore likely to be a direct target of FXR (20, 38). In the present study we show that treatment of mice with the RXR ligand (LG268) results in increased expression of hepatic PLTP mRNA. This increase is reduced, but not abolished, in LXR-deficient mice, consistent with a role for LXR in the control of hepatic PLTP expression. The residual activation by RXR ligands in LXR-deficient liver is likely to be due to the activity of FXR/RXR or PPAR/RXR heterodimers.

It was recently reported that pharmacological activation of LXR inhibits the formation of atherosclerotic lesions in two mouse models (18). Chronic LXR ligand administration reduced lesions by about 50% in both LDL receptor-/- and ApoE-/- mice, despite relatively minor changes in plasma lipoprotein levels. It has further been shown that transplantation of LXR-deficient bone marrow into LDL receptor-/- and ApoE-/- mice results in substantially increased lesion formation compared to controls (36). These findings demonstrate that bone marrow-derived cells, such as macrophages, are involved in the antiatherogenic activities of LXRs in mice. Therefore, understanding gene expression changes within atherosclerotic lesions in response to LXR ligands may provide additional clues as to the prevention of atherosclerosis. Previous work has shown that LXRs regulate cholesterol efflux from macrophages at least in part through the induction of ABC transporter proteins, including those for ABCA1 and possibly ABCG1 (6, 33, 41). LXRs have also been shown to regulate the expression of apolipoproteins, including ApoE, ApoCI, ApoCII, and ApoCIV, in macrophages (21, 27). Each of these lipoproteins can serve as a cholesterol acceptor within the artery wall. In the present work, we show that PLTP is also highly expressed by macrophages within atherosclerotic lesions and is inducible by LXR. The physiologic role PLTP in this context and its connection to atherosclerosis remain to be elucidated. It will be interesting to examine the role of macrophage expression of PLTP by using bone marrow transplants from PLTP-deficient mice or tissue-specific knockouts of PLTP.


arrow
ADDENDUM
 
During the preparation of this article, Cao and colleagues reported the regulation of PLTP levels by an LXR agonist (T1317) in vivo (4).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Howard Hughes Medical Institute, UCLA School of Medicine, Box 951662, Los Angeles, CA 90095-1662. Phone: (310) 206-4546. Fax: (310) 267-0382. E-mail: ptontonoz{at}mednet.ucla.edu. Back


arrow
REFERENCES
 
    1
  1. Albers, J. J., A. Y. Tu, B. Paigen, H. Chen, M. C. Cheung, and S. M. Marcovina. 1996. Transgenic mice expressing human phospholipid transfer protein have increased HDL/non-HDL cholesterol ratio. Int. J. Clin. Lab. Res. 26:262-267.[Medline]
  2. 2
  3. Berge, K. E., H. Tian, G. A. Graf, L. Yu, N. V. Grishin, J. Schultz, P. Kwiterovich, B. Shan, R. Barnes, and H. H. Hobbs. 2000. Accumulation of dietary cholesterol in sitosterolemia caused by mutations in adjacent ABC transporters. Science 290:1771-1775.[Abstract/Free Full Text]
  4. 3
  5. Bouly, M., D. Masson, B. Gross, X. C. Jiang, C. Fievet, G. Castro, A. R. Tall, J. C. Fruchart, B. Staels, L. Lagrost, and G. Luc. 2001. Induction of the phospholipid transfer protein gene accounts for the high density lipoprotein enlargement in mice treated with fenofibrate. J. Biol. Chem. 276:25841-25847.[Abstract/Free Full Text]
  6. 4
  7. Cao, G., T. P. Beyer, X. P. Yang, R. J. Schmidt, Y. Zhang, W. R. Bensch, R. F. Kauffman, H. Gao, T. P. Ryan, Y. Liang, P. I. Eacho, and X. C. Jiang. 2002. Phospholipid transfer protein is regulated by liver X receptors in vivo. J. Biol. Chem. 277:39561-39565.[Abstract/Free Full Text]
  8. 5
  9. Chawla, A., W. A. Boisvert, C. H. Lee, B. A. Laffitte, Y. Barak, S. B. Joseph, D. Liao, L. Nagy, P. A. Edwards, L. K. Curtiss, R. M. Evans, and P. Tontonoz. 2001. A PPAR gamma-LXR-ABCA1 pathway in macrophages is involved in cholesterol efflux and atherogenesis. Mol. Cell 7:161-171.[CrossRef][Medline]
  10. 6
  11. Claudel, T., M. D. Leibowitz, C. Fievet, A. Tailleux, B. Wagner, J. J. Repa, G. Torpier, J. M. Lobaccaro, J. R. Paterniti, D. J. Mangelsdorf, R. A. Heyman, and J. Auwerx. 2001. Reduction of atherosclerosis in apolipoprotein E knockout mice by activation of the retinoid X receptor. Proc. Natl. Acad. Sci. USA 98:2610-2615.[Abstract/Free Full Text]
  12. 7
  13. Ehnholm, S., K. W. van Dijk, B. van 't Hof, A. van der Zee, V. M. Olkkonen, M. Jauhiainen, M. Hofker, L. Havekes, and C. Ehnholm. 1998. Adenovirus mediated overexpression of human phospholipid transfer protein alters plasma HDL levels in mice. J. Lipid Res. 39:1248-1253.[Abstract/Free Full Text]
  14. 8
  15. Foger, B., S. Santamarina-Fojo, R. D. Shamburek, C. L. Parrot, G. D. Talley, and H. B. Brewer, Jr. 1997. Plasma phospholipid transfer protein. Adenovirus-mediated overexpression in mice leads to decreased plasma high density lipoprotein (HDL) and enhanced hepatic uptake of phospholipids and cholesteryl esters from HDL. J. Biol. Chem. 272:27393-27400.[Abstract/Free Full Text]
  16. 9
  17. Glass, C. K., and J. L. Witztum. 2001. Atherosclerosis: the road ahead. Cell 104:503-516.[CrossRef][Medline]
  18. 10
  19. Huuskonen, J., and C. Ehnholm. 2000. Phospholipid transfer protein in lipid metabolism. Curr. Opin. Lipidol. 11:285-289.[CrossRef][Medline]
  20. 11
  21. Jaari, S., K. W. van Dijk, V. M. Olkkonen, A. van der Zee, J. Metso, L. Havekes, M. Jauhiainen, and C. Ehnholm. 2001. Dynamic changes in mouse lipoproteins induced by transiently expressed human phospholipid transfer protein (PLTP): importance of PLTP in prebeta-HDL generation. Comp. Biochem. Physiol. B 128:781-792.[CrossRef][Medline]
  22. 12
  23. Janowski, B. A., P. J. Willy, T. R. Devi, J. R. Falck, and D. J. Mangelsdorf. 1996. An oxysterol signalling pathway mediated by the nuclear receptor LXR{alpha}. Nature 383:728-731.[CrossRef][Medline]
  24. 13
  25. Jauhiainen, M., J. Metso, R. Pahlman, S. Blomqvist, A. van Tol, and C. Ehnholm. 1993. Human plasma phospholipid transfer protein causes high density lipoprotein conversion. J. Biol. Chem. 268:4032-4036.[Abstract/Free Full Text]
  26. 14
  27. Jiang, X., O. L. Francone, C. Bruce, R. Milne, J. Mar, A. Walsh, J. L. Breslow, and A. R. Tall. 1996. Increased prebeta-high density lipoprotein, apolipoprotein AI, and phospholipid in mice expressing the human phospholipid transfer protein and human apolipoprotein AI transgenes. J. Clin. Investig. 98:2373-2380.[Medline]
  28. 15
  29. Jiang, X. C., C. Bruce, J. Mar, M. Lin, Y. Ji, O. L. Francone, and A. R. Tall. 1999. Targeted mutation of plasma phospholipid transfer protein gene markedly reduces high-density lipoprotein levels. J. Clin. Investig. 103:907-914.[Medline]
  30. 16
  31. Jiang, X. C., S. Qin, C. Qiao, K. Kawano, M. Lin, A. Skold, X. Xiao, and A. R. Tall. 2001. Apolipoprotein B secretion and atherosclerosis are decreased in mice with phospholipid-transfer protein deficiency. Nat. Med. 7:847-852.[CrossRef][Medline]
  32. 17
  33. Joseph, S. B., B. A. Laffitte, P. H. Patel, M. A. Watson, K. E. Matsukuma, R. Walczak, J. L. Collins, T. F. Osborne, and P. Tontonoz. 2002. Direct and indirect mechanisms for regulation of fatty acid synthase gene expression by liver X receptors. J. Biol. Chem. 277:11019-11025.[Abstract/Free Full Text]
  34. 18
  35. Joseph, S. B., E. McKilligin, L. Pei, M. A. Watson, A. R. Collins, B. A. Laffitte, M. Chen, G. Noh, J. Goodman, G. N. Hagger, J. Tran, T. K. Tippin, X. Wang, A. J. Lusis, W. A. Hsueh, R. E. Law, J. L. Collins, T. M. Willson, and P. Tontonoz. 2002. Synthetic LXR ligand inhibits the development of atherosclerosis in mice. Proc. Natl. Acad. Sci. USA 99:7604-7609.[Abstract/Free Full Text]
  36. 19
  37. Kast, H. R., C. M. Nguyen, C. J. Sinal, S. A. Jones, B. A. Laffitte, K. Reue, F. J. Gonzalez, T. M. Willson, and P. A. Edwards. 2001. Farnesoid X-activated receptor induces apolipoprotein C-II transcription: a molecular mechanism linking plasma triglyceride levels to bile acids. Mol. Endocrinol. 15:1720-1728.[Abstract/Free Full Text]
  38. 20
  39. Laffitte, B. A., H. R. Kast, C. M. Nguyen, A. M. Zavacki, D. D. Moore, and P. A. Edwards. 2000. Identification of the DNA binding specificity and potential target genes for the farnesoid X-activated receptor. J. Biol. Chem. 275:10638-10647.[Abstract/Free Full Text]
  40. 21
  41. Laffitte, B. A., J. J. Repa, S. B. Joseph, D. C. Wilpitz, H. R. Kast, D. J. Mangelsdorf, and P. Tontonoz. 2001. LXRs control lipid-inducible expression of the apolipoprotein E gene in macrophages and adipocytes. Proc. Natl. Acad. Sci. USA 98:507-512.[Abstract/Free Full Text]
  42. 22
  43. Laffitte, B. A., and P. Tontonoz. 2002. Orphan nuclear receptors find a home in the arterial wall. Curr. Atheroscler. Rep. 4:213-221.[Medline]
  44. 23
  45. Lehmann, J. M., S. A. Kliewer, L. B. Moore, T. A. Smith-Oliver, B. B. Oliver, J. L. Su, S. S. Sundseth, D. A. Winegar, D. E. Blanchard, T. A. Spencer, and T. M. Willson. 1997. Activation of the nuclear receptor LXR by oxysterols defines a new hormone response pathway. J. Biol. Chem. 272:3137-3140.[Abstract/Free Full Text]
  46. 24
  47. Lie, J., R. de Crom, M. Jauhiainen, T. van Gent, R. van Haperen, L. Scheek, H. Jansen, C. Ehnholm, and A. van Tol. 2001. Evaluation of phospholipid transfer protein and cholesteryl ester transfer protein as contributors to the generation of pre beta-high-density lipoproteins. Biochem. J. 360:379-385.[CrossRef][Medline]
  48. 25
  49. Lu, T. T., J. J. Repa, and D. J. Mangelsdorf. 2001. Orphan nuclear receptors as eLiXiRs and FiXeRs of sterol metabolism. J. Biol. Chem. 276:37735-37738.[Free Full Text]
  50. 26
  51. Lusis, A. J. 2000. Atherosclerosis. Nature 407:233-241.[CrossRef][Medline]
  52. 27
  53. Mak, P. A., B. A. Laffitte, C. Desrumaux, S. B. Joseph, L. K. Curtiss, D. J. Mangelsdorf, P. Tontonoz, and P. A. Edwards. 2002. Regulated expression of the apolipoprotein E/C-I/C-IV/C-II gene cluster in murine and human macrophages: a critical role for the nuclear liver X receptors {alpha} and ß. J. Biol. Chem. 277:31900-31908.[Abstract/Free Full Text]
  54. 28
  55. Oram, J. F. 2002. Molecular basis of cholesterol homeostasis: lessons from Tangier disease and ABCA1. Trends Mol. Med. 8:168-173.[CrossRef][Medline]
  56. 29
  57. Peet, D. J., S. D. Turley, W. Ma, B. A. Janowski, J. M. Lobaccaro, R. E. Hammer, and D. J. Mangelsdorf. 1998. Cholesterol and bile acid metabolism are impaired in mice lacking the nuclear oxysterol receptor LXR{alpha}. Cell 93:693-704.[CrossRef][Medline]
  58. 30
  59. Repa, J. J., K. E. Berge, C. Pomajzl, J. A. Richardson, H. Hobbs, and D. J. Mangelsdorf. 2002. Regulation of ATP-binding cassette sterol transporters ABCG5 and ABCG8 by the liver X receptors alpha and beta. J. Biol. Chem. 277:18793-18800.[Abstract/Free Full Text]
  60. 31
  61. Repa, J. J., G. Liang, J. Ou, Y. Bashmakov, J. M. Lobaccaro, I. Shimomura, B. Shan, M. S. Brown, J. L. Goldstein, and D. J. Mangelsdorf. 2000. Regulation of mouse sterol regulatory element-binding protein-1c gene (SREBP-1c) by oxysterol receptors, LXR{alpha} and LXRß. Genes Dev. 14:2819-2830.[Abstract/Free Full Text]
  62. 32
  63. Repa, J. J., and D. J. Mangelsdorf. 2000. The role of orphan nuclear receptors in the regulation of cholesterol homeostasis. Annu. Rev. Cell Dev. Biol. 16:459-481.[CrossRef][Medline]
  64. 33
  65. Repa, J. J., S. D. Turley, J. A. Lobaccaro, J. Medina, L. Li, K. Lustig, B. Shan, R. A. Heyman, J. M. Dietschy, and D. J. Mangelsdorf. 2000. Regulation of absorption and ABC1-mediated efflux of cholesterol by RXR heterodimers. Science 289:1524-1529.[Abstract/Free Full Text]
  66. 34
  67. Rye, K. A., M. A. Clay, and P. J. Barter. 1999. Remodelling of high density lipoproteins by plasma factors. Atherosclerosis 145:227-238.[CrossRef][Medline]
  68. 35
  69. Schultz, J. R., H. Tu, A. Luk, J. J. Repa, J. C. Medina, L. Li, S. Schwendner, S. Wang, M. Thoolen, D. J. Mangelsdorf, K. D. Lustig, and B. Shan. 2000. Role of LXRs in control of lipogenesis. Genes Dev. 14:2831-2838.[Abstract/Free Full Text]
  70. 36
  71. Tangirala, R., E. Bischoff, S. B. Joseph, B. Wagner, R. Walczak, B. A. Laffitte, C. L. Daige, D. Thomas, R. A. Heyman, D. J. Mangelsdorf, X. Wang, A. J. Lusis, P. Tontonoz, and I. Schulman. 2002. Identification of liver X receptors as macrophage inhibitors of atherosclerosis. Proc. Natl. Acad. Sci. USA 99:11896-11901.[Abstract/Free Full Text]
  72. 37
  73. Tu, A. Y., H. I. Nishida, and T. Nishida. 1993. High density lipoprotein conversion mediated by human plasma phospholipid transfer protein. J. Biol. Chem. 268:23098-23105.[Abstract/Free Full Text]
  74. 38
  75. Urizar, N. L., D. H. Dowhan, and D. D. Moore. 2000. The farnesoid X-activated receptor mediates bile acid activation of phospholipid transfer protein gene expression. J. Biol. Chem. 275:39313-39317.[Abstract/Free Full Text]
  76. 39
  77. van Haperen, R., A. van Tol, P. Vermeulen, M. Jauhiainen, T. van Gent, P. van den Berg, S. Ehnholm, F. Grosveld, A. van der Kamp, and R. de Crom. 2000. Human plasma phospholipid transfer protein increases the antiatherogenic potential of high density lipoproteins in transgenic mice. Arterioscler. Thromb. Vasc. Biol. 20:1082-1088.[Abstract/Free Full Text]
  78. 40
  79. van Tol, A. 2002. Phospholipid transfer protein. Curr. Opin. Lipidol. 13:135-139.[CrossRef][Medline]
  80. 41
  81. Venkateswaran, A., B. A. Laffitte, S. B. Joseph, P. A. Mak, D. C. Wilpitz, P. A. Edwards, and P. Tontonoz. 2000. Control of cellular cholesterol efflux by the nuclear oxysterol receptor LXR{alpha}. Proc. Natl. Acad. Sci. USA 97:12097-12102.[Abstract/Free Full Text]
  82. 42
  83. Venkateswaran, A., J. J. Repa, J. M. Lobaccaro, A. Bronson, D. J. Mangelsdorf, and P. A. Edwards. 2000. Human white/murine ABC8 mRNA levels are highly induced in lipid-loaded macrophages. A transcriptional role for specific oxysterols. J. Biol. Chem. 275:14700-14707.[Abstract/Free Full Text]
  84. 43
  85. Yoshikawa, T., H. Shimano, M. Amemiya-Kudo, N. Yahagi, A. H. Hasty, T. Matsuzaka, H. Okazaki, Y. Tamura, Y. Iizuka, K. Ohashi, J. Osuga, K. Harada, T. Gotoda, S. Kimura, S. Ishibashi, and N. Yamada. 2001. Identification of liver X receptor-retinoid X receptor as an activator of the sterol regulatory element-binding protein 1c gene promoter. Mol. Cell. Biol. 21:2991-3000.[Abstract/Free Full Text]


Molecular and Cellular Biology, March 2003, p. 2182-2191, Vol. 23, No. 6
0270-7306/03/$08.00+0     DOI: 10.1128/MCB.23.6.2182-2191.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Wu, S., Yin, R., Ernest, R., Li, Y., Zhelyabovska, O., Luo, J., Yang, Y., Yang, Q. (2009). Liver X receptors are negative regulators of cardiac hypertrophy via suppressing NF-{kappa}B signalling. Cardiovasc Res 0: cvp180v2-cvp180 [Abstract] [Full Text]  
  • Gabbi, C., Warner, M., Gustafsson, J.-A. (2009). Minireview: Liver X Receptor {beta}: Emerging Roles in Physiology and Diseases. Mol. Endocrinol. 23: 129-136 [Abstract] [Full Text]  
  • Mukherjee, R., Locke, K. T., Miao, B., Meyers, D., Monshizadegan, H., Zhang, R., Search, D., Grimm, D., Flynn, M., O'Malley, K. M., Zhang, L., Li, J., Shi, Y., Kennedy, L. J., Blanar, M., Cheng, P. T., Tino, J., Srivastava, R. A. (2008). Novel Peroxisome Proliferator-Activated Receptor {alpha} Agonists Lower Low-Density Lipoprotein and Triglycerides, Raise High-Density Lipoprotein, and Synergistically Increase Cholesterol Excretion with a Liver X Receptor Agonist. J. Pharmacol. Exp. Ther. 327: 716-726 [Abstract] [Full Text]  
  • Hime, N. J., Black, A. S., Bulgrien, J. J., Curtiss, L. K. (2008). Leukocyte-derived hepatic lipase increases HDL and decreases en face aortic atherosclerosis in LDLr-/- mice expressing CETP. J. Lipid Res. 49: 2113-2123 [Abstract] [Full Text]  
  • Rigamonti, E., Chinetti-Gbaguidi, G., Staels, B. (2008). Regulation of Macrophage Functions by PPAR-{alpha}, PPAR-{gamma}, and LXRs in Mice and Men. Arterioscler. Thromb. Vasc. Bio. 28: 1050-1059 [Abstract] [Full Text]  
  • Oram, J. F., Wolfbauer, G., Tang, C., Davidson, W. S., Albers, J. J. (2008). An Amphipathic Helical Region of the N-terminal Barrel of Phospholipid Transfer Protein Is Critical for ABCA1-dependent Cholesterol Efflux. J. Biol. Chem. 283: 11541-11549 [Abstract] [Full Text]  
  • Torra, I. P., Ismaili, N., Feig, J. E., Xu, C.-F., Cavasotto, C., Pancratov, R., Rogatsky, I., Neubert, T. A., Fisher, E. A., Garabedian, M. J. (2008). Phosphorylation of Liver X Receptor {alpha} Selectively Regulates Target Gene Expression in Macrophages. Mol. Cell. Biol. 28: 2626-2636 [Abstract] [Full Text]  
  • Smoak, K., Madenspacher, J., Jeyaseelan, S., Williams, B., Dixon, D., Poch, K. R., Nick, J. A., Worthen, G. S., Fessler, M. B. (2008). Effects of Liver X Receptor Agonist Treatment on Pulmonary Inflammation and Host Defense. J. Immunol. 180: 3305-3312 [Abstract] [Full Text]  
  • Stayrook, K. R., Rogers, P. M., Savkur, R. S., Wang, Y., Su, C., Varga, G., Bu, X., Wei, T., Nagpal, S., Liu, X. S., Burris, T. P. (2008). Regulation of Human 3{alpha}-Hydroxysteroid Dehydrogenase (AKR1C4) Expression by the Liver X Receptor {alpha}. Mol. Pharmacol. 73: 607-612 [Abstract] [Full Text]  
  • Valenta, D. T., Bulgrien, J. J., Bonnet, D. J., Curtiss, L. K. (2008). Macrophage PLTP is atheroprotective in LDLr-deficient mice with systemic PLTP deficiency. J. Lipid Res. 49: 24-32 [Abstract] [Full Text]  
  • Ogier, N., Klein, A., Deckert, V., Athias, A., Bessede, G., Le Guern, N., Lagrost, L., Desrumaux, C. (2007). Cholesterol Accumulation Is Increased in Macrophages of Phospholipid Transfer Protein-Deficient Mice: Normalization by Dietary Alpha-Tocopherol Supplementation. Arterioscler. Thromb. Vasc. Bio. 27: 2407-2412 [Abstract] [Full Text]  
  • Vikstedt, R., Ye, D., Metso, J., Hildebrand, R. B., Van Berkel, T. J.C., Ehnholm, C., Jauhiainen, M., Van Eck, M. (2007). Macrophage Phospholipid Transfer Protein Contributes Significantly to Total Plasma Phospholipid Transfer Activity and Its Deficiency Leads to Diminished Atherosclerotic Lesion Development. Arterioscler. Thromb. Vasc. Bio. 27: 578-586 [Abstract] [Full Text]  
  • Liu, R., Hojjati, M. R., Devlin, C. M., Hansen, I. H., Jiang, X.-C. (2007). Macrophage Phospholipid Transfer Protein Deficiency and ApoE Secretion: Impact on Mouse Plasma Cholesterol Levels and Atherosclerosis. Arterioscler. Thromb. Vasc. Bio. 27: 190-196 [Abstract] [Full Text]  
  • Moore, D. D., Kato, S., Xie, W., Mangelsdorf, D. J., Schmidt, D. R., Xiao, R., Kliewer, S. A. (2006). International Union of Pharmacology. LXII. The NR1H and NR1I Receptors: Constitutive Androstane Receptor, Pregnene X Receptor, Farnesoid X Receptor {alpha}, Farnesoid X Receptor beta, Liver X Receptor {alpha}, Liver X Receptor beta, and Vitamin D Receptor. Pharmacol. Rev. 58: 742-759 [Abstract] [Full Text]  
  • Marathe, C., Bradley, M. N., Hong, C., Lopez, F., de Galarreta, C. M. R., Tontonoz, P., Castrillo, A. (2006). The Arginase II Gene Is an Anti-inflammatory Target of Liver X Receptor in Macrophages. J. Biol. Chem. 281: 32197-32206 [Abstract] [Full Text]  
  • Ranalletta, M., Wang, N., Han, S., Yvan-Charvet, L., Welch, C., Tall, A. R. (2006). Decreased Atherosclerosis in Low-Density Lipoprotein Receptor Knockout Mice Transplanted With Abcg1-/- Bone Marrow. Arterioscler. Thromb. Vasc. Bio. 26: 2308-2315 [Abstract] [Full Text]  
  • Lee-Rueckert, M., Vikstedt, R., Metso, J., Ehnholm, C., Kovanen, P. T., Jauhiainen, M. (2006). Absence of endogenous phospholipid transfer protein impairs ABCA1-dependent efflux of cholesterol from macrophage foam cells. J. Lipid Res. 47: 1725-1732 [Abstract] [Full Text]  
  • Valenta, D. T., Ogier, N., Bradshaw, G., Black, A. S., Bonnet, D. J., Lagrost, L., Curtiss, L. K., Desrumaux, C. M. (2006). Atheroprotective Potential of Macrophage-Derived Phospholipid Transfer Protein in Low-Density Lipoprotein Receptor-Deficient Mice Is Overcome by Apolipoprotein AI Overexpression. Arterioscler. Thromb. Vasc. Bio. 26: 1572-1578 [Abstract] [Full Text]  
  • Curtiss, L. K., Valenta, D. T., Hime, N. J., Rye, K.-A. (2006). What Is So Special About Apolipoprotein AI in Reverse Cholesterol Transport?. Arterioscler. Thromb. Vasc. Bio. 26: 12-19 [Abstract] [Full Text]  
  • Chen, M., Beaven, S., Tontonoz, P. (2005). Identification and characterization of two alternatively spliced transcript variants of human liver X receptor alpha. J. Lipid Res. 46: 2570-2579 [Abstract] [Full Text]  
  • Oram, J. F., Heinecke, J. W. (2005). ATP-Binding Cassette Transporter A1: A Cell Cholesterol Exporter That Protects Against Cardiovascular Disease. Physiol. Rev. 85: 1343-1372 [Abstract] [Full Text]  
  • Koldamova, R. P., Lefterov, I. M., Staufenbiel, M., Wolfe, D., Huang, S., Glorioso, J. C., Walter, M., Roth, M. G., Lazo, J. S. (2005). The Liver X Receptor Ligand T0901317 Decreases Amyloid {beta} Production in Vitro and in a Mouse Model of Alzheimer's Disease. J. Biol. Chem. 280: 4079-4088 [Abstract] [Full Text]  
  • Janis, M. T., Siggins, S., Tahvanainen, E., Vikstedt, R., Silander, K., Metso, J., Aromaa, A., Taskinen, M.-R., Olkkonen, V. M., Jauhiainen, M., Ehnholm, C. (2004). Active and low-active forms of serum phospholipid transfer protein in a normal Finnish population sample. J. Lipid Res. 45: 2303-2309 [Abstract] [Full Text]  
  • Szanto, A., Benko, S., Szatmari, I., Balint, B. L., Furtos, I., Ruhl, R., Molnar, S., Csiba, L., Garuti, R., Calandra, S., Larsson, H., Diczfalusy, U., Nagy, L. (2004). Transcriptional Regulation of Human CYP27 Integrates Retinoid, Peroxisome Proliferator-Activated Receptor, and Liver X Receptor Signaling in Macrophages. Mol. Cell. Biol. 24: 8154-8166 [Abstract] [Full Text]  
  • Miao, B., Zondlo, S., Gibbs, S., Cromley, D., Hosagrahara, V. P., Kirchgessner, T. G., Billheimer, J., Mukherjee, R. (2004). Raising HDL cholesterol without inducing hepatic steatosis and hypertriglyceridemia by a selective LXR modulator. J. Lipid Res. 45: 1410-1417 [Abstract] [Full Text]  
  • Beyer, T. P., Schmidt, R. J., Foxworthy, P., Zhang, Y., Dai, J., Bensch, W. R., Kauffman, R. F., Gao, H., Ryan, T. P., Jiang, X.-C., Karathanasis, S. K., Eacho, P. I., Cao, G. (2004). Coadministration of a Liver X Receptor Agonist and a Peroxisome Proliferator Activator Receptor-{alpha} Agonist in Mice: Effects of Nuclear Receptor Interplay on High-Density Lipoprotein and Triglyceride Metabolism in Vivo. J. Pharmacol. Exp. Ther. 309: 861-868 [Abstract] [Full Text]  
  • Ricote, M., Valledor, A. F., Glass, C. K. (2004). Decoding Transcriptional Programs Regulated by PPARs and LXRs in the Macrophage: Effects on Lipid Homeostasis, Inflammation, and Atherosclerosis. Arterioscler. Thromb. Vasc. Bio. 24: 230-239 [Abstract] [Full Text]  
  • Korstanje, R., Albers, J. J., Wolfbauer, G., Li, R., Tu, A.-Y., Churchill, G. A., Paigen, B. J. (2004). Quantitative Trait Locus Mapping of Genes That Regulate Phospholipid Transfer Activity in SM/J and NZB/BlNJ Inbred Mice. Arterioscler. Thromb. Vasc. Bio. 24: 155-160 [Abstract] [Full Text]  
  • Oram, J. F., Wolfbauer, G., Vaughan, A. M., Tang, C., Albers, J. J. (2003). Phospholipid Transfer Protein Interacts with and Stabilizes ATP-binding Cassette Transporter A1 and Enhances Cholesterol Efflux from Cells. J. Biol. Chem. 278: 52379-52385 [Abstract] [Full Text]  
  • Pawar, A., Botolin, D., Mangelsdorf, D. J., Jump, D. B. (2003). The Role of Liver X Receptor-{alpha} in the Fatty Acid Regulation of Hepatic Gene Expression. J. Biol. Chem. 278: 40736-40743 [Abstract] [Full Text]  
  • Jonkers, I. J. A. M., Smelt, A. H. M., Hattori, H., Scheek, L. M., van Gent, T., de Man, F. H. A. F., van der Laarse, A., van Tol, A. (2003). Decreased PLTP mass but elevated PLTP activity linked to insulin resistance in HTG: effects of bezafibrate therapy. J. Lipid Res. 44: 1462-1469 [Abstract] [Full Text]  
  • Tontonoz, P., Mangelsdorf, D. J. (2003). Liver X Receptor Signaling Pathways in Cardiovascular Disease. Mol. Endocrinol. 17: 985-993 [Abstract] [Full Text]  
  • Laffitte, B. A., Chao, L. C., Li, J., Walczak, R., Hummasti, S., Joseph, S. B., Castrillo, A., Wilpitz, D. C., Mangelsdorf, D. J., Collins, J. L., Saez, E., Tontonoz, P. (2003). Activation of liver X receptor improves glucose tolerance through coordinate regulation of glucose metabolism in liver and adipose tissue. Proc. Natl. Acad. Sci. USA 100: 5419-5424 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Laffitte, B. A.
Right arrow Articles by Tontonoz, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Laffitte, B. A.
Right arrow Articles by Tontonoz, P.