Glucose Utilization Is Essential for Hypoxia-Inducible Factor 1{alpha}-Dependent Phosphorylation of c-Jun

Hypoxia and anoxia are important microenvironmental stressesthat contribute to pathological events such as solid-tumor development.We have been investigating the effects of hypoxia and anoxiaon expression of the proto-oncogene c-jun and the regulationof c-Jun/AP-1 transcription factors. In earlier work using geneticallymanipulated mouse embryo fibroblasts (mEFs), we found a functionalrelationship among c-jun expression, c-Jun N-terminal phosphorylation,and the presence of hypoxia-inducible factor 1 ${alpha}$ (HIF-1 ${alpha}$ ), theoxygen-regulated subunit of the HIF-1 transcription factor.Both the induction of c-jun mRNA expression and c-Jun N-terminalphosphorylation in cells exposed to hypoxia or anoxia were foundto be dependent on the presence of HIF-1 ${alpha}$ , but this was not thecase in cells exposed to less-severe hypoxia. Here we describenew findings concerning HIF-1-dependent c-Jun N-terminal phosphorylationin cells exposed to hypoxia or anoxia. Specifically, we reportthat hypoxia-inducible c-Jun N-terminal kinase (JNK) activity,which involves JNKs or stress-activated protein kinases (SAPKs),is dependent on enhanced glucose utilization mediated by HIF-1.These results suggest a model in which hypoxia-inducible JNKactivity is connected to oxygen sensing through increased glucoseabsorption and/or glycolytic activity regulated by the HIF-1system. We also found that basal threonine and tyrosine phosphorylation(within the TEY motif) of extracellular signal-regulated kinases1 and 2 (ERK1/2) and the corresponding ERK1/2 activity weredefective in hypoxic HIF-1 ${alpha}$ -null mEFs but not in wild-type mEFs,independently of glucose uptake. Therefore, the activities ofboth JNKs/SAPKs and ERK1/2 are sensitive to HIF-1-dependentprocesses in cells exposed to hypoxia or anoxia.

INTRODUCTION

Top

Introduction

The c-Jun protein is a subunit of AP-1 transcription factors,pleiotropic regulators that influence the proliferation, survival,and differentiation of both normal and transformed cells (reviewedin references 34, 52, and 63). We have been investigating theresponse of c-Jun/AP-1 to low-oxygen conditions (hypoxia andanoxia), particularly those present within the microenvironmentsof solid tumors (3, 27-29). The transcriptional and posttranscriptionalactivation of c-Jun/AP-1 by hypoxic or anoxic stress has beenreported for various normal and transformed cells (2, 3, 5,36, 45, 60, 64, 65), indicating that it is generally sensitiveto changes in ambient oxygen concentration. Recently we demonstratedthat phosphorylation of c-Jun within its N-terminal region incells exposed to hypoxia or anoxia is dependent on the presenceof hypoxia-inducible factor 1 (HIF-1) (27), the principal transcriptionalregulator of hypoxia-responsive gene expression in mammaliancells (recently reviewed in references 19, 51, and 61). In general,we found that the pattern of hypoxia-inducible c-Jun N-terminalphosphorylation is biphasic, consisting of early HIF-1-independentand late HIF-1-dependent components (27). The functional relationshipdemonstrated between c-Jun/AP-1 and HIF-1 in hypoxic cells (2,27) suggests a high level of organization—a network ensuringthat hypoxic or anoxic signals are interpreted appropriatelyin a particular cell or tissue. Little is known, however, ofthe pathways responsible for the activation of c-Jun/AP-1 byhypoxic signals.

Protein kinases that directly or indirectly modulate c-Jun/AP-1activity in vivo include members of the mitogen-activated proteinkinase (MAPK) family (c-Jun N-terminal kinases [JNKs]/stress-activatedprotein kinases [SAPKs] and extracellular signal-regulated kinases1 and 2 [ERK1/2]), glycogen synthase kinase 3 (GSK3), caseinkinase II (CKII), and c-Abl (6, 26, 30, 31, 41). It has beenestablished that phosphorylation of the c-Jun N-terminal region(e.g., by JNKs/SAPKs) is important for its transactivation functionin an AP-1 complex, whereas phosphorylation of the C-terminalregion (e.g., by GSK3 or CKII) inhibits the specific DNA bindingfunction of c-Jun (26, 41). Both GSK3 and CKII have been reportedto be sensitive to hypoxia (11, 23), although we have not beenable to detect changes in their activities in cells exposedto the low oxygen conditions normally used in our studies (pO₂, $<=$ 0.1%). To further investigate the mechanism of HIF-1-dependentN-terminal phosphorylation of c-Jun in cells exposed to hypoxiaor anoxia, we compared the phosphorylation of the c-Jun N-terminalregion in normoxic and hypoxic cultures of wild-type (wt) andHIF-1 ${alpha}$ -null mouse embryo fibroblasts (mEFs). In addition, weinvestigated whether hypoxia-inducible c-Jun phosphorylationis dependent on the presence of factors within the extracellularmedium of hypoxic cultures. Here we describe the major findingthat glucose utilization mediated by HIF-1 activity is a criticalfactor determining the N-terminal phosphorylation response ofc-Jun to hypoxia or anoxia.

MATERIALS AND METHODS

Top

Materials and Methods

Materials. A glutathione S-transferase (GST) fusion protein containingthe c-Jun N-terminal region [GST-c-Jun(1-141)] was expressedin Escherichia coli from a pGEX-2T plasmid [GST-c-Jun(1-141)-pGEX-2T]and purified from lysates by capture on glutathione-Sepharose4B beads (Amersham Biosciences), as described in detail in reference29. Mutated versions of the GST-c-Jun(1-141) protein describedbelow were purified by the same protocol. Where needed, freeGST-c-Jun(1-141) protein was prepared by elution from the beadswith a glutathione (GSH) solution (10 mM GSH, 25 mM Tris-HCl[pH 7.5], 1 mM EDTA, 1 mM dithiothreitol [DTT], 5% glycerol)followed by dialysis at 4°C in a buffer containing 10 mMMgCl₂, 50 mM Tris-HCl (pH 7.5), 5 mM NaF, and 1 mM Na₃VO₄. Site-specificmutations were made in GST-c-Jun(1-141)-pGEX-2T by using a QuikChangesite-directed mutagenesis kit (Invitrogen) according to thesupplier's instructions. The following primers were used toproduce mutations in c-Jun N-terminal phosphorylation sitesfrom this template (mutated bases are underlined): for S63A,5'-CTCGGACCTCCTCACCGCGCCCGACGTGGGGCT-3' (forward) and 5'-AGCCCCACGTCGGGCGCGGTGAGGAGGTCCGAG-3'(reverse); for T9193A, 5'-CACATCACCACCGCGCCAGCCCCCACCCAGTTC-3'(forward) and 5'-GAACTGGGTGGGGGCTGGCGCGGTGGTGATGTG-3' (reverse).The S63 S73A mutation was prepared similarly by using the S63Amutant as a template and the following primers for constructingan S73A mutation: 5'-TGCTCAAGCTGGCGGCGCCCGAGCTGGAG-3' (forward)and 5'-CTCCAGCTCGGGCGCCGCCAGCTTGAGCA-3' (reverse). All changesto GST-c-Jun(1-141)-pGEX-2T were confirmed by conventional DNAsequencing using commercially available primers for pGEX-2Tplasmids (Amersham Biosciences).

The following antibodies were obtained from commercial sources:a rabbit polyclonal anti-JNK1/SAPK ${gamma}$ antibody (JNK1 [FL]; immunizingantigen, full-length recombinant human JNK1; cross-reactivewith mouse JNK1/SAPK ${gamma}$ , JNK2/SAPK ${alpha}$ , and JNK3/SAPKß; SantaCruz Biotechnology), a monoclonal anti-JNK2 antibody (JNK2 [D-2];immunizing antigen, full-length recombinant human JNK2; cross-reactivewith mouse JNK1 to -3; Santa Cruz Biotechnology), a rabbit polyclonalanti-ERK1/2 antibody (ERK1/2-CT; immunizing antigen, C-terminalamino acids of rat ERK2; cross-reactive with mouse ERK1/2; UpstateCell Signaling Solutions), a rabbit polyclonal anti-p38 MAPKantibody (C-20; immunizing antigen, C-terminal amino acids ofmouse p38 MAPK; Santa Cruz Biotechnology), a monoclonal anti-phospho-ERK1/2antibody (immunizing antigen, a synthetic peptide containingamino acids of human ERK1/2 phosphorylated on Thr202 and Tyr204;cross-reactive with phosphorylated mouse ERK1/2; catalog no.9106S; New England Biolabs), a monoclonal anti-phospho-p38 MAPKantibody (immunizing antigen, a synthetic peptide containingamino acids of human p38 MAPK phosphorylated on Thr180 and Tyr182;cross-reactive with phosphorylated mouse p38 MAPK; catalog no.9211S; New England Biolabs), a monoclonal anti-phospho-c-Junantibody (KM-1; immunizing antigen, amino acids 56 to 69 ofhuman c-Jun; recognizes c-Jun phosphorylated on Ser63; SantaCruz Biotechnology), a rabbit polyclonal anti-c-Jun antibody(H79; immunizing antigen, amino acids 1 to 79 of human c-Jun;Santa Cruz Biotechnology), and a rabbit polyclonal anti-GLUT1antibody (AB1340; immunizing antigen, C-terminal amino acidsof mouse/rat GLUT1; Chemicon International).

The following reagents were obtained from commercial sources:JNK inhibitor I (L)-Form (Calbiochem), recombinant human epidermalgrowth factor (EGF) (Gibco Invitrogen), 2-deoxy-D-[2,6-³H]glucose(53.0 Ci/mmol, 1.0 mCi/ml; Amersham Biosciences), PD 98059,a selective pharmacological inhibitor of the ERK1/2 pathway(1) (Calbiochem), and myelin basic protein (Upstate Cell SignalingSolutions). The photolabile cross-linking agent for glucosereceptors, Bio-LC-ATB-BGPA {4,4'-O-[2-[2-[2-[2-[2-[6-(biotinylamino)hexanolyl]-amino]-ethoxy]-ethoxy]-ethoxy]-4-(1-azi-2,2,2-trifluoroethylbenzoyl]amino-1,3-propanediyl]-bis-D-glucose},was a kind gift from Geoffrey Holman (University of Bath, Bath,United Kingdom).

Cell culture and hypoxia-anoxia protocols. The origin and culture of immortalized, wt, and HIF-1 ${alpha}$ -null mEFshave been described in detail elsewhere (27). Briefly, cellswere usually plated in 60- or 100-mm-diameter plastic culturedishes (400 to 500 cells/mm²) in Dulbecco's modified Eagle medium(DMEM) containing 10% fetal bovine serum (FBS; Sigma) and 25mM HEPES buffer (pH 7.4) (DMEMH-10% FBS). Thus, both bicarbonateand HEPES buffers regulated extracellular pH. Hypoxia or anoxiaexperiments (called hypoxia here) were performed according toa standard protocol in which cells were incubated under an air-5%CO₂ atmosphere at 37°C overnight and then placed in aluminumgas-exchange chambers maintained at 37°C (27). The chamberscontaining the cells were then placed in a 37°C circulatingwater bath, and the original atmosphere was repeatedly exchangedwith 5% CO₂-95% N₂ by using a manifold equipped with a vacuumpump and a gas cylinder. Atmospheric pO₂ values of approximately1 to $<=$ 0.01% (relative to air at a pO₂ of ${approx}$ 21%) can be achievedinside the chambers by using this system. For example, atmosphericpO₂ values of approximately 1 and 0.01% can be achieved at 0.5and 2 h, respectively, following the initiation of hypoxia.We have determined that after 2 h of hypoxia, atmospheric pO₂is less than or equal to 0.01% (the studies described here wereall performed at a pO₂ of $<=$ 0.01%). Alternatively, cells wereincubated on a warm surface maintained at 37°C inside ananaerobic glove box (Bactron X; Sheldon Manufacturing Inc.,Cornelius, Oreg.) maintained at 5% CO₂-95% N₂. Atmospheric oxygenlevels in both the chambers and the glove box have been measuredand calibrated by using a polarographic oxygen electrode (OxygenSensors, Inc., Norristown, Pa.).

Following various hypoxic exposures, the chambers were openedin the anaerobic glove box to prepare cell lysates without significantreoxygenation. For studies involving glucose stress, cells werecultured in normal or glucose-free DMEMH-10% FBS and incubatedin air-5%CO₂ or exposed to hypoxia for 8 h (glucose-free mediumwas added immediately before the hypoxic exposure). Then a degassedglucose solution (0.2 mg/ml in sterile water) was added to dishesof normoxic and hypoxic cells to a standard concentration (4.5g of glucose/liter, or 25 mM), and the cells were incubatedat 37°C for 1 h before being harvested for immunoblot analysis.All manipulations of hypoxic cells were performed in the anaerobicglove box.

JNK assays. Pulldown or affinity kinase assays of JNK activity in cell lysateswere performed by using GST-c-Jun(1-141) as a substrate (29).Briefly, dishes of normoxic and hypoxic cells were placed onice in air or on Super Ice cold packs in the anaerobic glovebox, and the medium was removed. Each dish was washed with ice-coldphosphate-buffered saline (PBS), and then 250 µl of ice-coldlysis buffer (LB; 50 mM Tris-HCl [pH 7.4], 250 mM NaCl, 15 mMNa₄P₂O₇, 50 mM NaF, 0.5% NP-40, 1 mM Na₃VO₄, 25 mM ß-glycerophosphate,100 nM okadaic acid, 1 mM DTT, 1x Protease Inhibitor CocktailSet III [PIC III; Calbiochem]) was added (solutions were degassedbefore protein was harvested from hypoxic cells). Cells in eachdish were disrupted by scraping with a plastic spatula, andcell lysates were transferred to microcentrifuge tubes. Lysateswere spun at 9,000 x g for 5 min at 4°C, and the proteinconcentrations of the supernatants were determined by a bicinchoninicacid (BCA) assay (Pierce Biotechnology). Protein concentrationswere normalized with LB.

Pulldown kinase assays were performed by first adding 20-µlsuspensions of glutathione-Sepharose 4B beads with adsorbednormal or mutated GST-c-Jun(1-141) protein in PBST (20 mM sodiumphosphate [pH 7], 150 mM NaCl, 1% Triton X-100, 100 µMNa₃VO₄, 50 mM NaF, 1 mM benzamidine hydrochloride, 1x PIC III)to tubes of supernatants each containing 100 to 200 µgof total cell protein. Then 20 µl of freshly preparedkinase buffer (KB; 25 mM HEPES [pH 7.4], 25 mM MgCl₂, 1 mM Na₃VO₄,25 mM ß-glycerophosphate, 100 nM okadaic acid, 1xPIC III, 2 mM DTT) containing normal and radioactively labeledATP (20 µM ATP; 3 to 5 µCi of [ ${gamma}$ -³²P]ATP [5,000 Ci/mmol];Amersham Biosciences) was added to each tube. After incubationfor 30 min at 30°C, the beads in each sample were washedthree times with PBST; then 40 µl of 2x sodium dodecylsulfate (SDS) sample buffer (125 mM Tris-HCl [pH 6.8], 4.6%SDS, 10% mercaptoethanol, 20% glycerol) was added, and the sampleswere boiled for 5 min. Boiled samples were resolved in SDS-10%polyacrylamide gels, and the gels were stained with colloidalCoomassie brilliant blue R-250 to visualize protein loading.Gels were dried and exposed to Kodak X-Omat AR film to prepareautoradiographs for digital imaging. This type of assay detectsany kinase activity capable of phosphorylating the c-Jun N-terminalregion in a cell lysate.

In an alternative pulldown kinase assay, 20 µg of purifiedGST-c-Jun(1-141) protein was added to samples of whole-celllysates in microcentrifuge tubes, and the tubes were gentlyrotated at 4°C overnight. Each tube then received a 20-µlsuspension of glutathione-Sepharose 4B beads, and the tubeswere rotated at 4°C for 2 h. The beads in each tube werewashed twice with ice-cold LB and three times with ice-coldKB, and then JNK inhibitor I was added to a final concentrationof 1.7 µM in KB (8) (controls received KB only). The tubeswere incubated at 30°C for 10 min, and then kinase reactionsand analyses were performed as described above. This type ofassay detects any tightly bound kinase activity capable of phosphorylatingthe c-Jun N-terminal region and is diagnostic for activatedJNKs/SAPKs (see, e.g., reference 48).

Immunocomplex kinase assays of JNK activity were performed usingcell lysates prepared by essentially the same protocol as thatdescribed above for pulldown kinase assays. Each sample of lysatesupernatant (containing 100 to 200 µg of protein) wasdivided into two equal fractions in microcentrifuge tubes. Onefraction received an antibody (1 µg of an anti-JNK/SAPKor anti-ERK1/2 antibody), and the other fraction was used asa control for nonspecific protein binding to Protein A/G Plusagarose beads (Santa Cruz Biotechnology). Each tube then received20 µl of glutathione-Sepharose 4B beads, and the tubeswere gently tumbled for at least 1 h at 4°C. Tubes werespun at 600 x g and 4°C for 5 min, and beads were washedtwice with ice-cold LB and three times with ice-cold KB. TheKB from each sample of beads was removed and replaced with thesame buffer containing ATP (20 µM ATP; 3 to 5 µCiof [ ${gamma}$ -³²P]ATP [5,000 Ci/mmol]) and 5 µg of GST-c-Jun(1-141)protein. Samples were incubated for 30 min at 30°C, andreactions were stopped by addition of 40 µl of 2x SDSsample buffer, followed by boiling for 5 min. Samples were resolvedin SDS-10% polyacrylamide gels, and autoradiographs were preparedas described above.

Immunoblot analysis. Immunoblotting protocols have been described in detail elsewhere(27). Briefly, cells were placed on ice in air or on Super Icecold packs in the anaerobic glove box, and the medium was removed.Cells were lysed by addition of 200 µl of ice-cold LB(degassed before protein was harvested from hypoxic cells).After spinning at 9,000 x g for 5 min at 4°C, the proteinconcentrations of the supernatants were determined as describedabove. Equal protein samples (typically 10 to 15 µg) wereresolved in freshly prepared discontinuous SDS-10% polyacrylamidegels and electroblotted onto Immobilon P membranes (Millipore).We find that these gels provide better resolution of c-Jun phospho-isoformsthan commercially available preformed protein gels. Blots wereblocked in 5% nonfat dry milk in PBS containing 0.1% Tween 20at 4°C overnight. For protein detection, blots were incubatedat room temperature with a primary antibody, typically diluted1:1,000 in PBS-0.1% Tween 20 containing 5% nonfat driy milk,and a secondary anti-mouse or anti-rabbit immunoglobulin G (IgG)antibody conjugated with horseradish peroxidase (IgG-HRP; SantaCruz Biotechnology), diluted 1:10,000 or 1:5,000, respectively,in PBS-0.1% Tween 20. Primary antibody binding was detectedand visualized by using the ECL Plus Western Blotting Detectionsystem (Amersham Pharmacia Biotech, Inc.) according to the supplier'sinstructions.

ATP assay. Equal numbers of cells were plated in 35-mm-diameter plasticculture dishes (5 x 10⁵ cells/dish) in DMEMH-FBS and then incubatedin 5% CO₂-air or exposed to hypoxia (pO₂, $<=$ 0.01%) for as longas 8 h (triplicate dishes were harvested at each time point).Cells in each well were washed twice with PBS and lysed on iceby addition of 0.5 ml of 5% trichloroacetic acid (TCA) and scrapingwith a plastic spatula. Lysates were spun at 9,000 x g for 5min at 4°C, and the pellets were kept. Pellets were dissolvedin 0.5 ml of 0.1 N NaOH, incubated at 65°C for 10 min, andvortexed vigorously to shear genomic DNA. Total cellular ATPwas measured by using a luciferase-luciferin assay (ATP BioluminescentAssay kit; Sigma) according to the supplier's instructions.

Glucose uptake assay. Cellular uptake or absorption of the glucose analog 2-deoxyglucose(2-DG) was measured essentially according to the protocol describedin reference 32. Briefly, wt and HIF-1 ${alpha}$ -null cells were platedinto the wells of two 24-well plates (10⁵ cells/well; 0.5 mlof DMEMH-FBS) and incubated at 37°C overnight. One platewas placed inside the anaerobic glove box in a humidified acrylicbox in contact with the anaerobic atmosphere and incubated ona 37°C warm plate for 8 h. The other plate was incubatedat 37°C in air-5% CO₂ for 8 h. Hypoxic cells in the anaerobicglove box were washed with degassed PBS, and then 1.0 ml ofthe following solution in 1x Dulbecco's PBS (D-PBS; Sigma) wasadded to each well: 0.1 mM 2-DG, 4 µCi of 2-deoxy-D-[2,6-³H]glucose/ml,and 1% bovine serum albumin, with or without 20 nM cytochalasinB. Cells were incubated at 37°C for 5 min, and the platewas placed on an ice-cold surface. Then 0.5 ml of ice-cold D-PBScontaining 110 µg of phloretin/ml was added to each wellto stop 2-DG uptake, and the plate was removed from the anaerobicglove box and placed on ice. Cells were washed three times withD-PBS containing 55 µg of phloretin/ml and lysed by adding300 µl of 0.1% SDS to each well and gently agitating theplate for 5 min at room temperature. Normoxic cells were handledidentically. The supernatant was removed from each well withoutscraping, and the protein concentration of each supernatantwas determined by a BCA assay. The radioactivity of each samplewas determined by counting 200 µg of total protein in5 ml of CytoScint (ICN). Values of 2-DG uptake that could beinhibited by cytochalasin B were calculated and expressed aspicomoles per 5 min per milligram of total cellular protein.

Detection of cell surface glucose receptors by photoaffinity labeling. Bio-LC-ATB-BGPA is a member of a series of membrane-impermeantphotoaffinity labels for cell surface glucose receptors (GLUTreceptors) (7, 9). Briefly, cells were plated in DMEMH-10% FBSat 3 x 10⁶/100-mm-diameter plastic culture dish (two dishesfor each treatment), and experiments were performed the nextday. A fresh solution of the Bio-LC-ATB-BGPA cross-linker (0.2mg/ml in deionized water) was prepared under low light conditionsand stored in the dark until needed. Normoxic and hypoxic cellswere washed twice with ice-cold D-PBS (hypoxic cells were washedin the anaerobic glove box) and immediately placed on an ice-coldsurface to inhibit GLUT receptor endocytosis. One plate foreach treatment received 1 ml of the cross-linker solution; theother plate received 1 ml of D-PBS. Cells for each treatmentwere directly exposed on ice to 350-nm light for 30 s (approximately2 mJ/s) for a total of 2 min of exposures, and then the cellswere washed three times with ice-cold D-PBS. Cells were lysedin PBS containing 1% Triton X-100 and PIC III, the lysates werespun at 9,000 x g for 5 min at 4°C, and the supernatantswere recovered. Samples of the lysates were adjusted to an equalprotein concentration with the lysis solution, and then eachsample received 75 µl of streptavidin-agarose beads (ImmunoPureimmobilized streptavidin gel; Pierce Chemical Co.). Sampleswere tumbled overnight at 4°C and then washed three timeswith ice-cold PBS-0.1% Triton X-100 and twice with ice-coldPBS. Each sample received 30 µl of SDS sample buffer,and samples were heated at 95°C for 10 min. Samples wereresolved in protein gels (NuPAGE 10% Bis-Tris gels; Invitrogen)and immunoblotted, as described above.

Coculturing assay. In order to investigate a potential autocrine mechanism of hypoxia-induciblec-Jun phosphorylation and c-jun mRNA expression, wt and HIF-1 ${alpha}$ -nullcells were plated in either the wells or the inserts of multiwellcell culture plates (Falcon 24-multiwell cell culture insertsystems; pore size, 3 µm; Becton Dickinson). All combinationsof wt and HIF-1 ${alpha}$ -null cells were separately plated in wells andcompanion inserts in triplicate (2 x 10⁵ cells per well or perinsert) in 2 ml of DMEMH-FBS and were incubated at 37°Covernight. Plates were either exposed to hypoxia (pO₂, $<=$ 0.01%)in the anaerobic glove box on a 37°C warm plate for 8 hor incubated in 5% CO₂-air at 37°C for 8 h. Whole-cell lysateswere prepared from the wells as described above for immunoblotanalysis. Total RNA was harvested from the wells of identicalplates, purified by the RNeasy method (Qiagen), and used forquantitative real-time reverse transcriptase PCR (RT-PCR) analysisof c-jun expression.

Quantitative real-time RT-PCR analysis. Quantitative real-time RT-PCR analysis was performed by usinga LightCycler System instrument (Roche Diagnostics) accordingto the manufacturer's protocols for the SYBER Green method.The following primers were used: the c-jun sense primer (5'-CATGGAGTCTCAGGAGCGGATCA-3')and the c-jun antisense primer (5'-TGAGTACGATTGCGTCGTCAACG-3');the GLUT1 sense primer (5'-AGTATGTGGAGCAACTGTGCGG-3') and theGLUT1 antisense primer (5'-GGTGTCTTGTCACTTTGGCTGG-3'); the GLUT4sense primer (5'-TCGTCATTGGCATTCTGGTTG-3') and the GLUT4 antisenseprimer (5' CAGGGGCTTTAGACTCTTTCGG 3'). Mouse heart total RNA(BD Biosciences Clontech) was used to provide a positive controlfor amplification of mouse GLUT4 mRNA.

RESULTS

Top

Results

HIF-1-dependent phosphorylation of the c-Jun N-terminal region in response to hypoxia or anoxia involves JNK/SAPK activity. Previously we used anti-c-Jun antibodies specific for N-terminalphosphorylation sites and c-jun knock-in mEFs (S63A S73A andT91A T93A) to show that most, if not all, of the N-terminalsites can be phosphorylated in response to hypoxia or anoxia(27). Using wt and HIF-1 ${alpha}$ -null cells, we also showed that underthese low-oxygen conditions, N-terminal phosphorylation wasdependent on HIF-1 (27). Transient N-terminal phosphorylationwas detectable between 0.5 and 2 h of hypoxia, but this responsewas not dependent on HIF-1 (23). To further investigate HIF-1-dependentc-Jun N-terminal phosphorylation, we compared the abilitiesof whole-cell lysates of wt and HIF-1 ${alpha}$ -null cells to phosphorylatea wt fusion protein substrate [GST-c-Jun(1-141)]. Figure 1 confirmsprevious findings for HIF-1-dependent c-Jun N-terminal phosphorylation.Lysates of normoxic and hypoxic wt and HIF-1 ${alpha}$ -null cells wereused in pulldown kinase assays to show a direct correlationbetween JNK activity (Fig. 1A) and levels of endogenous c-Junphosphorylation determined by immunoblotting (Fig. 1B). EGFtreatment was used as a control for both c-Jun N-terminal phosphorylationand endogenous c-Jun phosphorylation (27). GST alone was notphosphorylated in any of the kinase assays described here (datanot shown).

View larger version (48K):
[in this window]
[in a new window]
FIG. 1. Inducible JNK activity in cells exposed to hypoxia or anoxia is impaired in the absence of HIF-1 ${alpha}$ . (A) Autoradiograph showing phosphorylation of a GST-c-Jun(1-141) fusion protein substrate in pulldown kinase assays using whole-cell lysates of wt and HIF-1 ${alpha}$ -null mEFs harvested under normoxic conditions (air-5% CO₂) or following exposure to hypoxia (pO₂, $<=$ 0.01%; 8 h). EGF exposure (50 ng/ml; 5 min) in air-5% CO₂ was used as a positive control. The beads-only control refers to identical lysate samples that received only clean agarose beads before the addition of radiolabeled ATP (for details, see Materials and Methods). Coomassie staining of the substrate bands is shown here and elsewhere to confirm equal loading of the original SDS-polyacrylamide gels used to obtain autoradiographs. This autoradiograph is representative of multiple independent experiments. (B) Replicate immunoblots of total protein from wt and HIF-1 ${alpha}$ -null mEFs harvested under normoxic conditions (air-5% CO₂) or following exposure to hypoxia (pO₂, $<=$ 0.01%; 8 h) or EGF (50 ng/ml; 5 min). Blots were probed with an anti-phospho-c-Jun antibody (left panel; KM-1) or with an antibody that recognizes nonphosphorylated c-Jun (right panel; H79). In this experiment and in all others, hypoxic cells to be used for protein kinase or phosphorylation assays were harvested under anaerobic conditions.

Phosphorylation of a substrate such as GST-c-Jun(1-141) in apulldown kinase assay is considered diagnostic of total JNK/SAPKactivation (17, 48). To confirm that JNKs/SAPKs contributedto the activity exemplified in Fig. 1A, identical lysates ofnormoxic and hypoxic wt and HIF-1 ${alpha}$ -null cells were incubatedwith free GST-c-Jun(1-141), extracted with GSH-agarose beads,and then exposed to a peptide inhibitor of JNKs/SAPKs (JNK inhibitorI) before kinase assays were performed (8). Figure 2A showsthat the JNK/SAPK inhibitor suppressed phosphorylation of GST-c-Jun(1-141)complexes extracted from lysates of both cell types, indicatingthat the fusion protein captured JNKs/SAPKs. We also performedimmunoprecipitation or immunocomplex kinase assays using similarlysates with an anti-JNK antibody that has broad specificityfor mammalian JNK/SAPK family members (JNK1 to -3) (26) andwith the GST-c-Jun(1-141) substrate. Figure 2B shows that theinhibitor suppressed basal and/or inducible JNK/SAPK activityimmunoprecipitated from normoxic and hypoxic wt and HIF-1 ${alpha}$ -nullcells. In general, JNKs/SAPKs immunoprecipitated from lysatesof aerobic and hypoxic wt and HIF-1 ${alpha}$ -null cells had the samepattern of activity toward GST-c-Jun(1-141) as activities detectedin corresponding pulldown kinase assays: JNK/SAPK activity wasinduced in hypoxic wt but not HIF-1 ${alpha}$ -null cells. Together thefindings presented in Fig. 2 demonstrate that JNK/SAPK activitycontributes both to HIF-1-dependent c-Jun N-terminal phosphorylationin hypoxia-exposed cells and to basal c-Jun phosphorylationin normoxic wt and HIF-1 ${alpha}$ -null cells. Because of the potentialfor reduced specificity or potency in cell-based assays (4),we did not use the JNK/SAPK inhibitor to investigate hypoxia-induciblec-Jun phosphorylation in intact wt and HIF-1 ${alpha}$ -null cells.

View larger version (43K):
[in this window]
[in a new window]
FIG. 2. HIF-1-dependent JNK activity in cells exposed to hypoxia or anoxia involves JNKs/SAPKs. (A) Autoradiograph of pulldown kinase assays and the corresponding stained gel showing phosphorylation of the GST-c-Jun(1-141) fusion protein substrate extracted from whole-cell lysates of wt and HIF-1 ${alpha}$ -null mEFs harvested under normoxic conditions (air-5% CO₂) or following exposure to hypoxia (pO₂, $<=$ 0.01%; 8 h). Beads with adsorbed fusion protein were thoroughly washed, and then kinase assays were performed in the absence (–) or presence (+) of a peptide JNK/SAPK inhibitor (1.7 µM). For details, see Materials and Methods. (B) (Top) Representative autoradiographs showing phosphorylation of the GST-c-Jun(1-141) fusion protein substrate by JNKs/SAPKs immunoprecipitated from whole-cell lysates of wt and HIF-1 ${alpha}$ -null mEFs harvested under normoxic conditions (air-5% CO₂) or following exposure to hypoxia (pO₂, $<=$ 0.01%; 8 h). Kinase assays were performed in the absence (–) or presence (+) of the peptide JNK/SAPK inhibitor (1.7 µM). (Center) Corresponding stained gels for the immunoprecipitation assays (immunocomplex kinase assays) shown above. (Bottom) Immunoblots of total JNKs/SAPKs immunoprecipitated from the same whole-cell lysates of wt and HIF-1 ${alpha}$ -null mEFs used for the immunocomplex kinase assays shown above. Blots were probed with a primary anti-JNK2 monoclonal antibody (cross-reactive with mouse JNK1 and JNK3) and a secondary anti-mouse IgG antibody conjugated with horseradish peroxidase. IP, immunoprecipitation assay; IB, immunoblot assay.

The contribution of JNK/SAPK activity to both basal and hypoxia-induciblephosphorylation of endogenous c-Jun was demonstrated previouslyby immunoblotting studies using specific anti-phospho-c-Junantibodies (27). However, it was not obvious from these studieswhether c-Jun N-terminal phosphorylation in hypoxic cells involvesa preference for any of the known phospho-acceptor sites (Ser63,Ser73, Thr91, and Thr93) (6, 44). To address this issue, wegenerated GST-c-Jun(1-141) constructs containing site-specificmutations (replacement of Ser or Thr with Ala) at these positionsand used these molecules as substrates for pulldown assays ofJNK/SAPK activity in lysates of normoxic, hypoxic, or EGF-treatedwt and HIF-1 ${alpha}$ -null cells. Figure 3 shows representative resultsfrom kinase assays involving the substrate mutants GST-c-Jun(1-141)S63A S73A and GST-c-Jun(1-141) T91A T93A. Although there werevariations in the relative levels of phosphorylation betweeneach set of results for the wt and mutated GST-c-Jun(1-141)substrates, essentially identical patterns of kinase activitywere obtained for all substrates; hypoxia-inducible JNK activitywas detected in lysates of wt but not HIF-1 ${alpha}$ -null cells, andEGF stimulated this activity in both cell types. As a potentialcaveat, it is possible that the wt and mutated GST-c-Jun(1-141)substrates are inherently less specific than the N-terminalregion of endogenous c-Jun toward specific protein kinases.However, the trend revealed by the pulldown kinase assays shownin Fig. 1 to 3 agree with our previous findings with c-jun knock-inmEFs (S63A S73A and T91A T93A), which indicated that all sitesin the c-Jun N-terminal region can be phosphorylated in cellsexposed to hypoxia or anoxia (27). In addition, a recent reporthas demonstrated that all of these N-terminal sites in endogenousc-Jun can be phosphorylated by MAPKs (preferentially by JNKs/SAPKs),based on immunoblot analyses involving a comprehensive panelof phosphospecific anti-c-Jun antibodies (38). Taken together,these published findings and our present results suggest thatall sites in the c-Jun N-terminal region are susceptible tohypoxia-inducible phosphorylation.

View larger version (28K):
[in this window]
[in a new window]
FIG. 3. Autoradiograph showing phosphorylation of the GST-c-Jun(1-141) S63A S73A or GST-c-Jun(1-141) T91A T93A mutant fusion protein substrate in pulldown kinase assays using whole-cell lysates of wt and HIF-1 ${alpha}$ -null mEFs harvested under normoxic conditions (air-5% CO₂) or following exposure to hypoxia (pO₂, $<=$ 0.01%; 8 h) or EGF (50 ng/ml; 5 min). These results are representative of at least three independent experiments.

Finally, to determine whether the dependence of hypoxia-inducibleJNK/SAPK activity on HIF-1 ${alpha}$ is unique among MAPK family members,we used specific anti-phospho-MAPK antibodies to evaluate thelevels of ERK1/2 and p38 MAPKs phosphorylated on the TXY activationmotif (TEY and TGY for ERK1/2 and p38 MAPK, respectively) (26)in lysates of normoxic and hypoxic wt and HIF-1 ${alpha}$ -null cells.Figure 4 shows that there was no induction of ERK1/2 phosphorylationabove the basal level in hypoxic compared with normoxic wt cells.However, the basal level of phosphorylated ERK1/2 was stronglydecreased in hypoxic compared with normoxic HIF-1 ${alpha}$ -null cells.Consistent with this suppression of basal ERK1/2 phosphorylationin hypoxic HIF-1 ${alpha}$ -null cells, basal ERK1/2 immunocomplex kinaseactivity was also significantly decreased in hypoxic but notin normoxic HIF-1 ${alpha}$ -null cells. The levels of phosphorylated p38MAPKs were increased in response to the same hypoxic exposure,but this increase was essentially the same on immunoblots oflysates of both normoxic and hypoxic wt and HIF-1 ${alpha}$ -null cells(data not shown). The findings shown in Fig. 4 demonstrate thatbasal ERK1/2 phosphorylation and associated kinase activitiesare HIF-1 dependent, but unlike JNKs/SAPKs, these activitiesare not inducible in response to hypoxia or anoxia.

View larger version (78K):
[in this window]
[in a new window]
FIG. 4. Basal ERK1/2 phosphorylation and activity are defective in HIF-1 ${alpha}$ -null mEFs exposed to hypoxia or anoxia. ERK1/2 is not inducible in wt mEFs. (Top and center) Immunoblots of total protein from wt and HIF-1 ${alpha}$ -null mEFs harvested under normoxic conditions (air-5% CO₂) or following exposure to hypoxia (pO₂, $<=$ 0.01%; 8 h). Replicate blots were probed with an anti-phospho-ERK1/2 antibody (specific for phospho-Thr202 and phospho-Tyr204 in the TEY activation motif) (top) or with an antibody that recognizes total ERK1/2 (center). (Bottom) Autoradiograph showing phosphorylation of myelin basic protein (MBP) by ERK1/2 immunoprecipitated from identical whole-cell lysates of wt and HIF-1 ${alpha}$ -null mEFs harvested under normoxic conditions (5% air-CO₂) or following exposure to hypoxia (pO₂, $<=$ 0.01%; 8 h). PD 98059 (PD) was used as a control for ERK1/2 activity in these experiments. PD (final concentration, 50 µM) was added just before initiation of hypoxia.

HIF-1-dependent phosphorylation of the c-Jun N-terminal region in response to hypoxia or anoxia is dependent on glucose utilization. HIF-1 activity is critical for physiological adaptations tolow oxygen and glucose conditions (18, 51). Therefore, we reasonedthat the deficient responses of MAPK signaling pathways involvingJNKs/SAPKs and ERK1/2 found in hypoxic HIF-1 ${alpha}$ -null cells (Fig.2 and 4) could be evidence of global defects in HIF-1-regulatedprocesses rather than specific defects in gene expression. Toinvestigate this possibility, we determined whether the absenceof HIF-1 ${alpha}$ expression influenced total cellular ATP productionand glucose uptake in HIF-1 ${alpha}$ -null versus wt cells under the samehypoxic conditions that induced c-Jun N-terminal phosphorylationin wt cells (Fig. 1).

Figure 5A shows that total cellular ATP levels were not significantlydifferent in wt versus HIF-1 ${alpha}$ -null cells during hypoxic exposuretimes of 2 to 8 h. This finding agrees with the results of aprevious study in which exposure to hypoxia for at least 24h was required to produce statistically significant decreasesin ATP production in immortalized mEFs (50). Thus, total cellularATP production, which is expected to be dependent on anaerobicglycolysis under these hypoxic conditions (18), did not differbetween the wt and HIF-1 ${alpha}$ -null cells at the maximum exposuretime (8 h) used in the present study. There were also no significantdifferences between wt and HIF-1 ${alpha}$ -null cells in the ratios ofreduced to oxidized pyridine nucleotide reducing equivalents(NADPH/NADP⁺, NADH/NAD⁺) following 8 h of hypoxia (data notshown), indicating indirectly that the cellular redox stateswere similar under these stress conditions (14, 42). Therefore,hypoxia-inducible JNK activity was not stimulated in responseto depletion of total ATP in wt cells exposed to hypoxia oranoxia. However, Fig. 5B shows that hypoxic wt cells absorbedsignificantly more extracellular glucose than HIF-1 ${alpha}$ -null cells,which were unable to change their glucose uptake between thenormoxic and hypoxic states investigated here. This findingis reasonable considering that HIF-1 is an essential regulatorof both glucose absorption and flux through the glycolytic pathway,biochemical processes underlying the positive Pasteur effect(18). Figure 5C shows that hypoxia strongly induced expressionof GLUT1 mRNA in wt but not HIF-1 ${alpha}$ -null cells, suggesting thathypoxia-inducible glucose absorption by wt cells was mediatedat least in part by upregulated GLUT1 receptors (reviewed inreference 22). Figure 5D indicates that HIF-1-dependent GLUT1expression ultimately promoted enhanced surface expression ofthis receptor, consistent with the significant increase in therate of extracellular glucose uptake detected under these hypoxicconditions (Fig. 5B). HIF-1 has been reported to be the primarytranscriptional regulator of the mouse GLUT1 gene in responseto hypoxia (15, 40). We have not been able to detect expressionof GLUT4, another prominent hypoxia-inducible glucose receptorin some cell types (e.g., cardiac myocytes [56), by using quantitativeRT-PCR analysis of total RNA from wt or HIF-1 ${alpha}$ -null cells (datanot shown). Taken together with the information, found at theEntrez-GEO database (http://www.ncbi.nlm.nih.gov/, data setGDS405), that GLUT1 is the major GLUT isoform expressed in culturednormal mEFs, our present findings indicate that inducible GLUT1expression is mainly responsible for the increased rate of glucoseabsorption stimulated in wt cells by hypoxia.

View larger version (25K):
[in this window]
[in a new window]
FIG. 5. (A) Total cellular ATP levels are not significantly different between wt and HIF-1 ${alpha}$ -null mEFs exposed to hypoxia or anoxia. Histogram shows total cellular ATP levels in lysates of wt (open bars) and HIF-1 ${alpha}$ -null (closed bars) mEFs harvested under normoxic conditions (air-5% CO₂) or following exposure to hypoxia for the indicated times. Error bars, sample standard deviations from triplicate measurements. (B) wt but not HIF-1 ${alpha}$ -null mEFs exhibit an increased demand for extracellular glucose in response to hypoxia or anoxia. wt and HIF-1 ${alpha}$ null mEFs were assayed for uptake of 2-deoxy-D-[2,6-³H]glucose (2-DG; 4 Ci/ml) after a 10-min exposure to the label under normoxic conditions (air-5% CO₂) or following exposure to hypoxia (pO₂, $<=$ 0.01%; 8 h). Error bars, sample standard deviations from three independent experiments; *, P $<=$ 0.04. For details, see Materials and Methods. (C) Hypoxia or anoxia strongly induces expression of the GLUT1 gene in wt mEFs. Histogram shows relative amounts (fold induction relative to normoxic levels) of GLUT1 mRNA detected by quantitative RT-PCR amplification of total RNA harvested from wt and HIF-1 ${alpha}$ -null mEFs after exposure to normoxic conditions (air-5% CO₂) or hypoxia (pO₂, $<=$ 0.01%; 8 h). Error bars, sample standard deviations from triplicate measurements. (D) Hypoxia or anoxia induces surface expression of the GLUT1 receptor on wt mEFs. (Top) Immunoblot of cross-linked GLUT1 protein captured from lysates of wt and HIF-1 ${alpha}$ -null mEFs exposed to the cell-impermeant cross-linking agent for glucose receptors, Bio-LC-ATB-BGPA. Cells were harvested under normoxic conditions (air-5% CO₂) or following exposure to hypoxia (pO₂, $<=$ 0.01%; 8 h). Darker exposures show very light bands in the three lanes that appear empty. (Center) Immunoblot of total protein from the wt and HIF-1 ${alpha}$ -null mEFs used for the cross-linking experiment. The blot was probed with an anti-GLUTI antibody. (Bottom) Ponceau S staining of total protein on the immunoblot shown above. Arrows indicate the position of a marker with an electrophoretic mobility within the range corresponding to GLUT1 (55 kDa).

Previously we determined that HIF-1-dependent N-terminal phosphorylationof c-Jun in cells exposed to hypoxia or anoxia is serum independent(27), which suggested that this phenomenon is independent ofextracellular factors. However, the glucose concentration inthe cell culture medium was a constant in the earlier study.Taken together with the present finding that the ability ofhypoxic HIF-1 ${alpha}$ -null cells to increase glucose uptake from themedium was impaired, this fact suggested that hypoxia-induciblec-Jun phosphorylation and glucose uptake in wt cells are functionallyrelated. To test this possibility, we performed immunoblottingstudies with an anti-phospho-c-Jun antibody specific for phospho-Ser63and/or -Ser73 in order to evaluate the effect on c-Jun N-terminalphosphorylation of the addition of glucose to normoxic and hypoxicwt and HIF-1 ${alpha}$ -null cells cultured in glucose-free medium forapproximately 8 h. Figure 6 shows two important findings ofthis study. First, the normal induction of c-Jun N-terminalphosphorylation in hypoxic wt but not in hypoxic HIF- ${alpha}$ -null cells(Fig. 6; compare lane 4 with lane 10) was eliminated in glucose-freemedium (lanes 5 and 11), showing a dependence of this inductionon the presence of extracellular glucose. However, basal c-Junphosphorylation was also greatly inhibited in both cell typesin the absence of extracellular glucose (Fig. 6, lanes 5 and11). Thus, while this particular study suggests that HIF-1-dependentinduction of GLUT1 expression is necessary for hypoxia-induciblec-Jun N-terminal phosphorylation, it is unlikely that expressionof the receptor alone is sufficient to induce the phosphorylationresponse. This finding demonstrates that extracellular glucoseis essential for both basal and inducible c-Jun N-terminal phosphorylationin hypoxic wt cells. Second, the addition of degassed glucoseto hypoxic wt and HIF-1 ${alpha}$ -null cells cultured in glucose-freemedium restored basal and hypoxia-inducible c-Jun N-terminalphosphorylation in wt cells but only basal phosphorylation inHIF-1 ${alpha}$ -null cells (Fig. 6; compare lane 6 with lane 12). Thisfinding confirms that extracellular glucose is required forbasal c-Jun N-terminal phosphorylation in both cell types uponexposure to hypoxia or anoxia, and it demonstrates that thecontribution of extracellular glucose to hypoxia-inducible c-JunN-terminal phosphorylation is HIF-1 dependent. Importantly,because the addition of the same amount of extracellular glucoseto HIF-1 ${alpha}$ -null cells cultured in glucose-free medium had no effecton c-Jun phosphorylation, a contribution of increased osmolalityto the induction of c-Jun N-terminal phosphorylation in hypoxicwt cells can be eliminated. Together with the finding that wtcells exhibited an increased uptake of extracellular glucosein response to an identical hypoxic exposure (Fig. 5B), thisimmunoblotting study suggests that the initial signal responsiblefor HIF-1-dependent c-Jun N-terminal phosphorylation is theenhanced glucose utilization associated with the transitionfrom normoxic to anaerobic metabolism.

View larger version (50K):
[in this window]
[in a new window]
FIG. 6. HIF-1-dependent c-Jun N-terminal phosphorylation requires the presence of extracellular glucose. (Top) Immunoblot of total protein from wt and HIF-1 ${alpha}$ -null mEFs harvested under normoxic conditions (air-5% CO₂) or following exposure to hypoxia (pO₂, $<=$ 0.01%; 8 h) in normal or glucose-free medium (No Glucose; glucose starvation was for 8 h only). The blot was probed with the anti-phospho-c-Jun antibody KM-1 (P-c-Jun). Plus signs indicate glucose-starved cultures to which degassed glucose was added to a final concentration of 4.5 g/liter 1 h before protein was harvested. This immunoblot is representative of two independent experiments. (Center) Ponceau S staining of total protein on the immunoblot shown above. Arrow indicates the position of a marker (between lanes 6 and 7) with an electrophoretic mobility within the range corresponding to c-Jun phospho-isoforms (50.4 kDa). (Bottom) A replicate immunoblot probed with an antibody that recognizes nonphosphorylated c-Jun (H79).

HIF-1-dependent induction of c-Jun N-terminal phosphorylation and c-jun expression in response to hypoxia or anoxia is not an autocrine phenomenon. Previously we demonstrated that induction of both c-Jun N-terminalphosphorylation and c-jun expression in cells exposed to hypoxiaor anoxia is independent of serum (27), indicating that theseresponses do not require extracellular signals such as polypeptidegrowth factors. However, this earlier study did not excludethe possibility that a HIF-1-dependent autocrine mechanism couldregulate the responses of the c-jun system to hypoxia or anoxia.HIF-1 has been reported to influence gene expression throughboth autocrine and paracrine signaling pathways (24, 46, 55,66). To detect a putative HIF-1-dependent autocrine factor(s),we used immunoblotting and quantitative RT-PCR to investigatethe hypoxic response of c-Jun N-terminal phosphorylation andc-jun mRNA expression, respectively, in cocultured wt and HIF-1 ${alpha}$ -nullcells. Stimulation of c-Jun N-terminal phosphorylation is generallyassociated with increased expression of the c-jun gene (26,59).

wt and HIF-1 ${alpha}$ -null cells were cocultured in the same medium inthe inserts or wells of modified Boyden chambers, and normoxicand hypoxic cells in the wells were harvested for total cellularprotein or RNA. By coculturing wt and HIF-1 ${alpha}$ -null cells in thisarrangement, we expected that a putative autocrine factor expressedfrom wt cells during hypoxia or anoxia would be detected byits ability to complement the defect in hypoxia-inducible c-JunN-terminal phosphorylation and/or c-jun mRNA expression in HIF-1 ${alpha}$ -nullcells (27). Figure 7A shows that cocultured wt cells had noeffect on c-Jun N-terminal phosphorylation in HIF-1 ${alpha}$ -null cellsduring 8 h of hypoxia; only wt cells exhibited the normal hypoxicinduction of endogenous c-Jun phosphorylation. Figure 7B showsthat cocultured wt cells also had no effect on c-jun mRNA expressionin HIF-1 ${alpha}$ -null cells during 8 h of hypoxia. In agreement withthe findings of our previous study (27), only wt cells exhibitedhypoxic induction of c-jun mRNA. These findings indicate thatneither the induction of c-Jun N-terminal phosphorylation norc-jun mRNA expression in cells exposed to hypoxia or anoxiainvolves an autocrine mechanism. Rather, the findings shownin Fig. 5B and 6 support a glucose-dependent mechanism of hypoxia-inducibleJNK activity in wt cells.

View larger version (18K):
[in this window]
[in a new window]
FIG. 7. HIF-1-dependent induction of c-Jun N-terminal phosphorylation and c-jun expression in cocultured wt and HIF-1 ${alpha}$ -null cells exposed to hypoxia or anoxia. (A) Immunoblot of total protein harvested from mEFs in the wells of modified Boyden chambers after exposure to normoxic conditions (air-5% CO₂) or hypoxia (pO₂, $<=$ 0.01%; 8 h). wt and HIF-1 ${alpha}$ -null mEFs were plated on either cell-impermeant inserts or companion wells of the chambers and were cocultured in the same medium before and during exposure to hypoxia. The blot was probed with the anti-phospho-c-Jun antibody KM-1 (P-c-Jun). (B) Histogram of relative amounts of c-jun mRNA detected by quantitative RT-PCR amplification of total RNA harvested from mEFs in the wells of modified Boyden chambers after exposure to normoxic conditions (air-5% CO₂) or hypoxia (pO₂, $<=$ 0.01%; 8 h). Open bars (same), identical genotypes in the chamber or insert; shaded bars (mixed), different genotypes in the chamber or insert. Error bars, sample standard deviations for triplicate measurements. For details, see Materials and Methods.

DISCUSSION

Top

Discussion

The major conclusion of the present study is that HIF-1-dependentphosphorylation of the c-Jun N-terminal region in cells exposedto hypoxia or anoxia is functionally coupled to glucose utilization(Fig. 1, 5, and 6). This conclusion is biochemically reasonableconsidering that energy metabolism in hypoxic or anoxic cellsis sustained by HIF-1 through positive transcriptional controlof both glucose receptor (e.g., GLUT1) and glycolytic enzymeexpression (50, 51). Thus, increased demand for glucose duringthe normal physiological transition from normoxic to glycolyticmetabolism (the positive Pasteur effect) generates a signalleading to increased N-terminal phosphorylation of c-Jun. Anattractive feature of this model is that it provides a physiologicalexplanation for how the induction of HIF-1 activity in hypoxicor anoxic cells could influence a network of signaling pathwaysregulating multiple downstream targets, including c-Jun/AP-1.

We determined that JNKs/SAPKs contribute to hypoxia-induciblec-Jun N-terminal phosphorylation in wt cells (Fig. 2). Thisfinding is also biochemically reasonable considering the establishedimportance of the JNK/SAPK pathway for regulating the c-jungene and c-Jun/AP-1 activity in general (26). ERK1/2 can alsophosphorylate the c-Jun N-terminal region (see, e.g., reference30), but JNKs/SAPKs have been reported to preferentially phosphorylatec-Jun under conditions where both the JNK/SAPK and ERK1/2 pathwaysare activated (38). We did not detect an induction of ERK1/2activity in hypoxic wt cells in the present study (Fig. 4).Interestingly, the addition of glucose to hypoxic HIF-1 ${alpha}$ -nullcells did not restore basal ERK1/2 phosphorylation (data notshown). There have been several reports of the activation ofMAPKs in various cell types by hypoxia, including JNKs/SAPKs(13, 21, 25, 29, 32, 35, 36, 49, 58), ERK1/2 (10, 13, 21, 33,39, 43, 53, 58), and p38 MAPK (10, 12, 13, 21, 23, 29, 43).Our present findings indicate at least one pathway by whichhypoxia can stimulate JNK/SAPK activity but do not explain theinduction of p38 MAPKs by this stress. Potential molecular mechanismsthat couple JNK/SAPK activity to changes in intracellular glucoseconcentrations are under investigation by many groups, althoughthis research is mainly focused on normoxic or oxidative metabolism(37, 54, 62). In terms of hypoxic signaling mechanisms, overexpressionof GLUT1 in vascular smooth muscle cells, with artificiallyincreased glucose uptake as a consequence, has been reportedto decrease rather than increase hypoxia-inducible JNK/SAPKactivation and to inhibit apoptosis, possibly through the effectof enhanced glucose levels on MEKK1 activity (32). We have beenunable to detect significant cell death in either wt or HIF-1 ${alpha}$ -nullcells exposed to the same low oxygen conditions that inducec-Jun N-terminal phosphorylation, suggesting that the hypoxicresponse of JNKs/SAPKs is not simple but may depend on the degreeor duration of stress in a particular cell type. AMP-activatedprotein kinase (AMPK) has been reported to directly stimulateglycolysis in hypoxic or anoxic cells, and sustained AMPK activitycan induce JNK/SAPK activity in normoxic liver cells (20). However,the pathways that transmit signals directly associated withglucose uptake to a stress-responsive network containing AMPKare not clear (reviewed in reference 47). Determining exactlyhow a signal(s) arising from stimulated glucose utilizationis able to induce c-Jun N-terminal phosphorylation in cellsexposed to hypoxia or anoxia would significantly advance ourunderstanding of the adaptation of both tumor and normal cellsto this common physiological and pathophysiological stress.

In summary, using genetically manipulated cells that are wtor null for the hypoxia-responsive transcription factor HIF-1 ${alpha}$ ,we have demonstrated that c-Jun phosphorylation in wt cellsexposed to hypoxia or anoxia is directly correlated with enhancedglucose utilization. There was no hypoxia-inducible c-Jun phosphorylationin the absence of extracellular glucose, but the addition ofglucose to hypoxic wt cells cultured in glucose-free mediumrestored this induction. Increased glucose uptake in responseto hypoxia was dependent on the expression of HIF-1 ${alpha}$ and thereforeon HIF-1 activity, indicating a pathway in which intracellularglucose levels connect hypoxia-inducible JNK activity with oxygensensing. It remains to be determined whether an increased rateof glucose uptake or the combination of this uptake and enhancedglycolytic activity is critical for the activation of kinasessuch as JNKs/SAPKs. wt and HIF-1 ${alpha}$ -null cells exhibit significantdifferences in vitro in terms of metabolic phenotypes such asthe Pasteur effect (50) and in vivo as experimental fibrosarcomas(16, 57). In the context of the tumor microenvironment, identifyingc-Jun/AP-1-dependent genes responsive to HIF-1-dependent glucoseflux and elucidating their contribution to tumor developmentare important areas for further research that will increaseour understanding of the role of hypoxia in malignant progression.

ACKNOWLEDGMENTS

This work was supported by grants CA73807 and CA82515 from theNIH.

FOOTNOTES

* Corresponding author. Mailing address: SRI International, Bldg. L, Rm. A258, 333 Ravenswood Ave., Menlo Park, CA 94025. Phone: (650) 859-3080. Fax: (650) 859-5816. E-mail: keith.laderoute{at}sri.com.

REFERENCES

Top