![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Molecular and Cellular Biology, May 2004, p. 4138-4150, Vol. 24, No. 10
0270-7306/04/$08.00+0 DOI: 10.1128/MCB.24.10.4138-4150.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
and Ellen Fanning*
Department of Biological Sciences and the Vanderbilt-Ingram Cancer Center, Vanderbilt University, Nashville, Tennessee 37235
Received 27 June 2003/ Returned for modification 12 August 2003/ Accepted 19 February 2004
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Biochemical and physical mapping of origins of replication in mammalian chromosomes suggests that replicators may specify start sites of replication. For example, start sites are usually inherited from mother cell to daughter cell and exhibit the same timing of origin firing in successive cell division cycles (reviewed in references 14, 22, 23, 28, 31, 32, 51, 56, and 62). Given the conservation of ORC from yeast to mammals, it is reasonable to hypothesize that ORC recognizes replicators in mammalian chromosomes. Consistent with this idea, ORC resides at several metazoan origins, including Sciara coprophila oriII/9A (11), Drosophila melanogaster ACE3 (7, 8), origins upstream from the human MCM4 (45) and TOP1 genes (38), and at the 3' end of the human lamin B2 gene (1). However, identification of specific sequence elements in mapped mammalian origins that ORC could recognize has been difficult so far (9, 14, 31, 61).
As an alternative to mapping origins, genetic assays have been devised to test directly for replicator activity of DNA fragments from mammalian chromosomes. In these assays, local replication initiation activity in the DNA fragment is measured after it has been placed at ectopic chromosomal locations in mammalian cells. One strategy involves integration of the putative replicator into a previously defined locus using FLP- or Cre-mediated recombination and analysis of a cloned cell population (see, e.g., references 4 and 50). Another strategy uses nonspecific integration of a putative replicator into multiple ectopic sites in chromosomal DNA followed by analysis of uncloned cell pools or cloned lines (5). Thus, both strategies are fundamentally analogous to the stably integrated reporter gene constructs used successfully in studies of cis-acting sequence elements that control gene expression in eukaryotic chromosomes (reviewed in references 34 and 46).
Using these genetic assays, defined DNA fragments of several kilobase pairs in length containing the human ß-globin (4), the human c-myc (50, 49), and hamster dihydrofolate reductase (DHFR) ori-ß (5) initiation regions (IRs) have been demonstrated to serve as replicators when placed at ectopic chromosomal locations. Initial mutational analyses of these replicators also revealed that multiple defined sequence elements are required for their initiation activity. However, consensus DNA sequences shared among these replicators have not been identified. Given the requirement for defined sequence elements in these mammalian replicators, it is possible that some of these elements may substitute functionally for each other even though they lack a consensus sequence, a possibility that we have explored in this report.
Toward this end, we extend our previous work by first showing that the DHFR ori-ß replicator directs robust initiation in ectopic chromosomal locations in both hamster and human cell lines and then identifying several new sequence elements that are specifically required for ori-ß replicator activity. In addition, we present evidence that the human lamin B2 origin directs initiation at ectopic locations in hamster chromosomes. Lastly, we demonstrate that an AT-rich element from the human lamin B2 origin is able to substitute for an essential AT-rich element in the hamster ori-ß origin, suggesting that some defined functional elements may be conserved among mammalian replicators.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Plasmid construction.
The plasmid pMCD, containing DHFR ori-ß on a 5.8-kb BamHI-KpnI fragment (GenBank accession no. Y09885) in pUC19, was the kind gift of Nick Heintz (18). The plasmid pDP17, containing approximately 13.5 kb of the human lamin B2 origin (GenBank accession no. M94363) was the kind gift of Mauro Giacca. Plasmid pLam was created by subcloning a 6.5-kb BamHI-SalI fragment from pDP17 into the BamHI-SalI site of pUC19. Mutant pMCD
AT was described previously (5). Mutant pATrep was created by swapping the 344-bp SphI-EcoRV fragment of pMCD for a 297-bp SphI-PvuII fragment from pSV2neo (Clontech Laboratories, Inc., Palo Alto, Calif.). Mutant pLamRep was created by swapping the 344-bp SphI-EcoRV fragment of pMCD for a 224-bp fragment of the lamin B2 origin. The 224-bp fragment was generated by PCR amplification of pDP17 using primers that contained either an SphI or an EcoRV recognition sequence on the 5' end (5'-CAAAGCATGCAGATGCATGCCTAGCGTGTTC and 5' CTGTGATATCTAGCTACACTAGCCAGTGACCTTTTTCCT). The PCR products were digested with SphI and EcoRV and cloned into the pMCD SphI-EcoRV vector fragment. Deletion mutant pAKO was described previously (5). Substitution mutant p4rep was created by PCR amplification using mutagenic primers (5'-GATTCACTGCATGCTTTCTTTCC and 5'-GGAAAGAAACATGCAGTGAATC) to replace the 4-bp sequence GGCC with CATG. Mutant pBENDx was created by using PCR and mutagenic primers (5'-GAGTCAGCGCATGGGCGCGCAAGACTAGCGCCTAAGTCTCATC and 5'-GCCCATGCGCTGACTCGCGCCTAGTTTCGCGATTATTATTATTAG) to replace the five tracts of A and T which contribute to the bend (18) with G and C (see Fig. 3B). Mutant pRIP DSx was created using PCR and mutagenic primers (5'-CTAGTTTTTTTATCGATCTCGAGGGTTCAAATTAGG and 5'-CCTAATTTGAACCCTCGAGATCGATAAAAAAACTAG) to replace the RIP60 consensus binding sequence (17) with other sequences (see Fig. 4B). The nucleotide position and size of each mutation are provided in Table 1.
|
|
|
DNA isolation and gradient centrifugation. For each experiment with each construct, total genomic DNA was isolated from uncloned stably transfected cell pools (5). Cells were collected as a loose pellet in a 50-ml conical centrifuge tube, washed with phosphate-buffered saline, and resuspended in 6 ml of 400 mM Tris-HCl [pH 8.0]-60 mM EDTA-150 mM NaCl-1% sodium dodecyl sulfate with two sharp flicks of the wrist. The suspension was poured into a 15-ml polypropylene centrifuge tube and mixed with 1.5 ml of 5 M sodium perchlorate by rotating on a horizontal mechanical rotator for 15 min at room temperature. After incubation at 65°C for 25 min, 5.5 ml of cold chloroform (chilled at –20°C) was added to the tube and mixed for 10 min by rotation at room temperature. The tube was centrifuged at 1,400 x g for 5 min, and the aqueous phase containing nucleic acid (top) was carefully transferred to a fresh 50-ml tube. Two volumes of cold ethanol were added to the aqueous phase and the tube was gently inverted to facilitate mixing. The insoluble DNA floating in the tube was lifted out on a pipette tip and air-dried in a 2-ml microcentrifuge tube. It was redissolved in 1 to 2 ml of sterile TE by mixing overnight on a rotator. No RNase treatment was performed. Each experiment yielded 400 to 700 µg of total nucleic acid from DR12 and 1 to 2 mg from HeLa or HCT116 cells.
For each transfectant, 400 to 500 µg of total nucleic acid in 1 ml of TE (10 mM Tris-HCl, pH 8.0; 1 mM EDTA) was heat denatured at 100°C for 10 min, followed by a 10-min incubation in ice-water. The entire sample was then immediately loaded onto a 5-to-30% linear neutral sucrose gradient and centrifuged at 26,000 rpm (Sorvall AH-629 rotor) for 17 h at 20°C. As size markers, 50 µg of pMUT8-2, digested with KpnI and NdeI to produce fragment sizes of 921 and 2,972 bp, and 50 µg of pKl26, digested with StuI and BglII to produce fragment sizes of 1,636 and 4,338 bp, were loaded on a separate sucrose gradient and centrifuged concurrently with each genomic DNA sample. Fractions of 1 ml were collected, and a 50-µl aliquot of each marker fraction was analyzed by electrophoresis on a 1% agarose gel at 200 mA for 2 h followed by ethidium bromide staining. A single fraction (containing an average of 3.55 µg in 27 experiments) enriched in nascent DNA corresponding to a length of ca. 0.4 to 2.0 kb (hereafter termed the nascent fraction) was dialyzed against TE and used as a template for all PCR amplifications in that experiment.
To monitor the composition of the nucleic acid in the nascent fraction of a typical experiment, a 500-µl sample of the fraction was precipitated with 1/10 volume of 3 M sodium acetate and an equal volume of isopropanol. The precipitate was redissolved in 30 µl of TE. Ten microliters of this material was digested with RNase A (40 µg/ml; BD Biosciences, Palo Alto, Calif.) for 1 h at 37°C. Another 10 µl was digested with 10 U of mung bean nuclease (Promega, Madison, Wis.) at 37°C for 15 min. Both samples and 10 µl of the undigested starting material were then analyzed by 1% agarose gel electrophoresis and visualized by ethidium bromide staining.
Construction of PCR competitive templates. Except for the lamin B2 competitors, competitors were previously described (5). The competitors for the lamin B2 origin were constructed in the same manner using the following primers (55): ComB48DX, 5'-GTCGACGGATCCCTGCAGGTCAGAGGCAGAACCTAAAATC; ComB48SX, 5'-ACCTGCAGGGATCCGTCGACAGTTTATTCCTGAGGGGAAG; BEComDX, 5'-ACCTGCAGGGATCCGTCGACAGCTCCCTGACCTGTGTAC; and BEComSX, 5'-GTCGACGGATCCCTGCAGGTCACGCCAGGGCCTTGAGG.
PCR-based nascent-strand abundance assay. The competitive PCR nascent-strand abundance assay was performed as previously described using primer sets 8, 2, 6, and 3 on DHFR ori-ß (Fig. 1A) (5, 27, 44, 55) and primer sets LO, BE, and B48 (30) on the human lamin B2 origin and lamin B2 replacement constructs. In our hands, primer pair B48 yielded specific amplification products with lamin B2 templates only in the hamster cell background (not shown); hence, the flanking primer pair LO was used in the human background. The sequences and map positions of the primers are listed in Table 2. Each PCR mixture included the corresponding competitor plasmid DNA, which had been precalibrated against 20 ng of total genomic DNA from asynchronously growing CHOK1, HeLa, or HCT116 cells (5). Amplification reaction mixtures with each primer set contained increasing amounts of the nascent fraction and a constant amount of the corresponding competitor DNA. PCR was carried out in a Perkin-Elmer 4800 thermal cycler. For the ori-ß primers, the reaction conditions were 50 cycles of 94°C for 30 s, 56°C for 30 s, and 72°C for 30 s. For the lamin B2 primers, the reaction conditions were 50 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 30 s. Amplification products were resolved by 7% polyacrylamide gel electrophoresis, stained with ethidium bromide, and quantified by densitometry (IPLab Gel software; Signal Analytics Corporation, Vienna, Va.).
|
|
To facilitate comparison between independent transfection experiments with the same ori-ß construct, the abundance of target sequences for each primer pair in each experiment was expressed relative to the abundance of the target sequences for the distal primer pair 3 in the same experiment (termed initiation activity). For the lamin B2 origin, the abundance of target sequences for each primer pair in each experiment was expressed relative to the abundance of the target sequences for the distal primer pair BE in the same experiment. Therefore, the nucleic acid concentration of the nascent fraction in each experiment only impacts abundance and not the initiation activity, since it cancels out when the initiation activity is calculated for each experiment. Standard error of the mean (SEM) was chosen to express the reliability of the mean (67).
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Targeted deletion analysis of the 5.8-kb ori-ß DNA fragment using the strategy described in Fig. 1 revealed that several DNA sequence elements were required for full initiation activity of ectopic ori-ß in DR12 hamster cells (summarized in Fig. 2A) (5). However, the deletion analysis did not rule out the possibility that the decreased activity of the ori-ß mutants was due to altered spacing of potentially important flanking elements or to a need for a minimal fragment length for initiation activity (see reference 33 and references therein). To assess these possibilities, two of the deleted regions were replaced with stuffer DNA with different sequences but similar or identical length (Fig. 2B). These stuffer replacement mutants were transfected stably into ectopic sites in hamster DR12 cells that lack the entire DHFR locus (37). The initiation activity of the stuffer replacement mutants in uncloned cell pools was then measured using a PCR-based nascent-strand abundance assay and compared to the activity of the ectopic wild-type ori-ß fragment (pMCD) and the previously described deletion mutants pMCDAT and pAKO (Fig. 2A; Table 3). Each construct was assayed in at least three independent transfection experiments, and the results of a typical experiment for each construct are listed in Table 3.
|
|
AT (Fig. 2C, compare pMCDAT and pATrep). This result indicates that the stuffer DNA was unable to functionally substitute for the AT-rich element, suggesting that the sequence in the AT-element is specifically required for ectopic ori-ß activity.
Deletion of 4 bp (pAKO) within the mapped IR also reproducibly decreased initiation activity at ectopic ori-ß (Fig. 2A) (5). Although the decrease in initiation activity was modest, it is remarkable that such a minor nucleotide change affected ori-ß activity at all. Deletion of 4 bp would be equivalent to about half of a helical turn and could disrupt local interactions between proteins bound to sites flanking the deletion or directly disrupt a protein binding site. To test these possibilities, the 4-bp GGCC nucleotide sequence was replaced with CATG (p4rep [Fig. 2B]). This replacement was unable to restore initiation activity to the ectopic ori-ß fragment (compare pAKO and p4rep [Fig. 2C]), suggesting that the 4-bp sequence may be specifically involved in origin function rather than serving as a spacer. These results demonstrate that the AT-rich and the 4-bp element contribute in a sequence-specific manner to initiation activity at ectopic ori-ß.
To identify other potential functional elements that may contribute to DHFR ori-ß activity, mutational analysis of the ori-ß IR was extended to other sequence elements studied previously (18). The ori-ß IR contains a well-characterized region of intrinsically bent DNA located between the critical AT-rich element and the 4-bp element (Fig. 3A). The functional importance of the bent DNA for ori-ß activity was examined by creating a mutation designed to remove the bend (pBENDx, Fig. 3B). The five phased A/T tracts that cause the bend were changed to alternating G and C tracts (Fig. 3B). Analysis of the predicted DNA structure of a 309-bp BglI-BglII DNA fragment indicated that replacing the five A/T tracts should significantly alter the local structure of the DNA, essentially "straightening out" the bent DNA region (Fig. 3C). In order to confirm experimentally that the sequence changes altered the architecture at the bend, wild-type and mutant constructs were digested with BglI and BglII to release a 309-bp fragment containing the bent DNA near the middle of the fragment. If the 309-bp DNA is bent, its electrophoretic mobility should be retarded relative to that of the unbent size marker DNA (64, 43). The GC substitutions should restore the mobility of the fragment to that expected for its length. As expected, the 309-bp DNA fragment containing the wild-type sequence (pMCD) had a retarded electrophoretic mobility, while the mutant 309-bp fragment (pBENDx) migrated at the position expected for its length, confirming that the mutant fragment lacked the bend (Fig. 3D). To determine whether the altered sequence affected ori-ß initiation activity, the pBENDx mutant DNA was stably transfected into DR12 cells in three separate experiments and initiation activity in uncloned cell pools was measured by the PCR-based nascent-strand abundance assay. Little initiation activity was observed with the mutant pBENDx (Fig. 3E); its activity was not significantly different from that detected in the negative control (Fig. 3E). This result indicates that either the sequence-determined bend or the specific sequence that was mutated in this element is crucial for ectopic ori-ß activity in hamster cells.
The intrinsically bent DNA element in ori-ß was reported to undergo enhanced bending and looping in vitro in the presence of the zinc finger DNA-binding protein RIP60 (17, 21, 35). Two potential RIP60 binding sites of opposite polarity are located in ectopic ori-ß (Fig. 4A, RIP US and RIP DS), one in the IR and the other directly adjacent to the region of bent DNA. Although it was not tested whether RIP60 binds to ori-ß in vivo (17, 21, 35), the importance of the bent DNA element for ori-ß activity raised the question of whether the enhanced bending facilitated by RIP60 in vitro might affect initiation activity of ectopic ori-ß in vivo. To explore this possibility, we mutated the RIP60 binding site adjacent to the bent element (pRIP DSx) (Fig. 4B). Since the RIP60 binding site mutation did not alter the nucleotides in the adjacent A/T tract of the bent DNA element, the 309-bp BglI-BglII fragment of pRIP DSx should retain the distinctive bend predicted by DNA structure analysis (Fig. 4C). To test this prediction experimentally, the electrophoretic mobility of the 309-bp BglI-BglII DNA fragment of pRIP DSx was examined. The mobility of the mutant fragment was slightly lower than that of the wild-type fragment, indicating that the mutant retained a region of DNA bending (Fig. 4D). The lower mobility of the mutant fragment may indicate that its three-dimensional conformation differs slightly from that in pMCD. The initiation activity of the ectopic pRIP DSx mutant in pools of stably transfected cells was tested using the PCR-based nascent-strand abundance assay. The activity of ectopic pRIP DSx was markedly decreased relative to that of pMCD (Fig. 4E), implying that the sequence of the RIP60 consensus binding site is important for full initiation activity at ectopic ori-ß in hamster cells.
Taken together, these results indicate that at least four defined elements contribute in a sequence-specific manner to ectopic ori-ß activity in hamster cells, in that these elements cannot be functionally replaced by unrelated DNA sequences.
A 5.8-kb DNA fragment containing the hamster DHFR ori-ß IR is sufficient to direct initiation at ectopic sites in human chromosomes. Several mammalian origins have been reported to be active in cells or extracts of other vertebrate species (4, 25, 47, 65), yet no consensus DNA sequences have been identified that are conserved from one origin to another (4, 9, 31, 61). As a possible resolution for this conundrum, we reasoned that if replicators are indeed comprised of specific elements that contribute to initiation activity, as suggested by the results presented above and elsewhere (49), some of these elements could still be functionally conserved among different replicators in vertebrates.
To test this notion, we wished to determine whether the elements that contribute to hamster DHFR ori-ß activity in ectopic chromosomal locations in the hamster cell would also be important for ori-ß activity in other mammalian cell lines. As a first step, we asked whether the wild-type ori-ß IR was active at ectopic chromosomal sites in human cells. The 5.8-kb DNA fragment containing ori-ß (pMCD) was stably transfected into two human cell lines, HeLa and HCT116. The PCR-based nascent-strand abundance assay was used to measure initiation activity of ectopic ori-ß in nascent genomic DNA from pools of uncloned cells. A peak of initiation activity was easily detectable in both cell types at the same position observed with the ectopic ori-ß in hamster cells (Fig. 5A). Ectopic ori-ß was equally active in HeLa and HCT116 cells, and the initiation activity in both human lines was about twice that in DR12 cells (Fig. 5A).
|
AT) and substitution (pATrep) mutants were stably transfected into HeLa cells and activity of ectopic ori-ß was assayed in a nascent DNA fraction from pools of uncloned cells. Initiation activities of both mutants in human cells were decreased (Fig. 5B and C). The relative decrease in activity displayed by the two mutants in human cells was proportional to that observed in hamster cells (Fig. 5B and C). We conclude that the AT-rich element is required for full initiation activity of ectopic ori-ß in both human and hamster cells. A 6.5-kb DNA fragment containing the human lamin B2 IR is sufficient to direct initiation at ectopic chromosomal sites in a hamster cell line. The finding that a hamster replicator directs initiation at ectopic sites in human cells and that at least one element critical for its activity in hamster cells is also needed for full activity in the human cell milieu led us to question whether a human origin could serve as a replicator in a hamster cell background. The human lamin B2 IR has been mapped by quantitative PCR with a peak of initiation activity occurring near the 3' end of the lamin B2 coding sequence (30) (Fig. 6A). The start sites of leading-strand synthesis were fine-mapped to a single nucleotide on each strand and were separated by only four nucleotides (2). In addition, the human lamin B2 start site is associated with prereplication complexes that presumably direct initiation (1).
|
|
|
Since the AT-rich lamin B2 fragment used in the pLamRep mutant of ori-ß contains the start site mapped at the endogenous lamin B2 locus (2, 30), we wondered whether the lamin B2 start site might be activated in the context of the pLamRep mutant of ori-ß. To assess this possibility, nascent DNA from pools of stably transfected DR12 cells was tested in the competitive PCR-based nascent-strand abundance assay using the B48 primer set that was originally used to map the initiation site in the lamin B2 origin (30) (Table 2; Fig. 7D). The initiation activity detected in the lamin B2 sequence of the pLamRep mutant of ori-ß was close to background level (Fig. 6E), demonstrating that the lamin B2 IR was not measurably activated in the context of ori-ß in hamster cells. Due to the endogenous lamin B2 locus, initiation activity at the lamin B2 element of ectopic pLamRep could not be unambiguously determined in the human cell background.
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
It remains unknown what the minimal sequence might be that constitutes replicator activity in mammalian chromosomes, but all four of the mammalian replicators identified so far appear to be larger than most replicators in budding or fission yeast. Like those of yeast, they reside in intergenic regions and contain stretches of AT-rich sequence (53, 57, 66). Of course, all of them also contain the previously mapped IR that led investigators to test them for replicator activity, and one of them, the lamin B2 replicator, is bound to pre-RC proteins in a cell cycle-dependent manner in vivo (1). One suspects that the other mammalian replicators are likely to bind pre-RC proteins as well, and it will be interesting to see whether ORC binding is essential for replicator activity at these IRs.
Multiple sequence elements contribute to replicator activity of ori-ß. The data presented in this report indicate that four distinct elements are required in a sequence-specific fashion for full ori-ß activity in hamster cells. These elements include an AT-rich element, a 4-bp sequence located within the mapped IR, a region of AT-rich bent DNA located between these two elements, and an AT-rich RIP60 protein binding site adjacent to the bent region. The dinucleotide repeat element in the 5.8-kb ori-ß fragment also appears to contain DNA sequences that are specifically required for replicator activity (5; S. Gray, A. Altman, and E. Fanning, unpublished data). These five elements are dispersed throughout most of the 5.8-kb fragment. In contrast, an asymmetric AT-rich sequence (TR) located near the 5' end of the 5.8-kb fragment was previously shown to be dispensable for ori-ß activity (5). All five essential elements have been assayed by nucleotide substitution, as well as by deletion mutagenesis, in the context of multiple undefined chromosomal integration sites found in pools of uncloned transfected cells. We speculate that possible position effects caused by ori-ß integration into certain chromosomal sites would be obscured in this approach. Whether all five elements would also be essential when the mutant ori-ß replicators are analyzed in a single defined ectopic chromosomal site is an open question. Nevertheless, mutational analysis of the ectopic ß-globin (4) and c-myc replicators (49) placed at unique chromosomal integration sites by site-specific recombination has also revealed several sequence elements that are required for initiation activity. Taken together, these results suggest that mammalian chromosomal replicators may be quite complex and their activity may depend on multiple elements composed of specific DNA sequences that are distributed over a region of several kilobases.
The biochemical mechanisms by which these elements affect replicator activity remain unknown. They may bind ORC, transcription factors, and perhaps other as yet unidentified proteins or affect local chromatin organization or other aspects of chromosome architecture. It will be of great interest to compare the sequence modules needed for activity in the various mammalian replicators and their biochemical functions. Perhaps, like transcriptional control sequences, the collection of modules controlling replication in mammalian chromosomes is larger and more complex than those used in budding yeast (46).
Possible functional conservation of an AT-rich element in two mammalian chromosomal replicators.
AT-rich DNA sequences are frequently found in origins of replication and may be selectively bound by ORC in eukaryotes (references 6 and 61 and references therein). The AT-rich region located downstream from the ori-ß start site appears to be crucial for replication initiation (Fig. 2A and C). Deletion of a 344-bp fragment containing a stretch of alternating AT residues reduced activity to near background levels (Fig. 2C [pMCDAT]) (5). The fact that an unrelated stuffer DNA fragment was unable to substitute for the AT-rich element argues that the AT-rich element is a specific sequence element required for origin activity (Fig. 2C). Given that the fragment deleted in the pMCDAT mutant was 65% AT, whereas the 297-bp nonorigin stuffer DNA was only 40% AT, it was possible that AT richness or a minimal length rather than a specific sequence was required for activity. This seems unlikely, however, since an even shorter (224-bp) element of only 58% AT from the human lamin B2 origin substituted functionally for the activity of the ori-ß AT-element in hamster cells (Fig. 7B), as well as partially in human cells (Fig. 7C). Also consistent with a sequence-specific requirement, an AT-rich element in the human c-myc origin could not be functionally replaced even by a nonorigin fragment of exactly the same length and AT richness (49). These results indicate that replicators may be composed of functionally different classes of AT-rich sequences, some of them able to functionally substitute for each other while others cannot, raising the question of what these functions may be. Biochemical studies to examine pre-RC proteins associated with ori-ß, the mutants lacking the AT element, and the pLamRep mutant may reveal whether the AT element and the 224-bp lamin B2 element share common biochemical functions.
In summary, the results presented here show that the ectopic DHFR ori-ß replicator is active in both hamster and human cells and that a human lamin B2 fragment is active as a replicator at ectopic sites in hamster chromosomes. Mutational analysis of the ori-ß replicator strongly suggests that at least four defined sequence modules, including an architectural element, are required for full activity of ectopic ori-ß, and that one of these elements can be fully or partially replaced by an element from the lamin B2 origin. Studies to determine whether any of these sequences interact with initiator proteins in vivo may elucidate the roles of these elements in the events leading up to the initiation of DNA synthesis.
|
ACKNOWLEDGMENTS |
|---|
We thank M. Giacca and N. Heintz for plasmids; S. Gray, M. Giacca, and A. Patten for stimulating discussion; and S. Gray, A. Patten, G. Biamonti, and M. Debatisse for sharing unpublished data with us.
|
FOOTNOTES |
|---|
Present address: Booz Allen Hamilton, Inc., Falls Church, VA 22042.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Abdurashidova, G., M. Deganuto, R. Klima, S. Riva, G. Biamonti, M. Giacca, and A. Falaschi. 2000. Start sites of bidirectional DNA synthesis at the human lamin B2 origin. Science 287:2023-2026.
3. Abdurashidova, G., S. Riva, G. Biamonti, M. Giacca, and A. Falaschi. 1998. Cell cycle modulation of protein-DNA interactions at a human replication origin. EMBO J. 17:2961-2969.[CrossRef][Medline]
4. Aladjem, M. I., L. W. Rodewald, J. L. Kolman, and G. M. Wahl. 1998. Genetic dissection of a mammalian replicator in the human ß-globin locus. Science 281:1005-1009.
5. Altman, A. L., and E. Fanning. 2001. The Chinese hamster dihydrofolate reductase replication origin beta is active at multiple ectopic chromosomal locations and requires specific DNA sequence elements for activity. Mol. Cell. Biol. 21:1098-1110.
6. Anglana, M., F. Apiou, A. Bensimon, and M. Debatisse. 2003. Dynamics of DNA replication in mammalian somatic cells: nucleotide pool modulates origin choice and interorigin spacing. Cell 114:385-394.[CrossRef][Medline]
7. Austin, R. J., T. L. Orr-Weaver, and S. P. Bell. 1999. Drosophila ORC specifically binds to ACE3, an origin of DNA replication control element. Genes Dev. 13:2639-2649.
8. Beall, E. L., J. R. Manak, S. Zhou, M. Bell, J. L. Lipsick, and M. R. Botchan. 2002. Role for a Drosophila Myb-containing protein complex in site-specific DNA replication. Nature 420:833-837.[CrossRef][Medline]
9. Bell, S. P. 2002. The origin recognition complex: from simple origins to complex functions. Genes Dev. 16:659-672.
10. Bell, S. P., and A. Dutta. 2002. DNA replication in eukaryotic cells. Annu. Rev. Biochem. 71:333-374.[CrossRef][Medline]
11. Bielinsky, A. K., H. Blitzblau, E. L. Beall, M. Ezrokhi, H. S. Smith, M. R. Botchan, and S. A. Gerbi. 2001. Origin recognition complex binding to a metazoan replication origin. Curr. Biol. 11:1427-1431.[CrossRef][Medline]
12. Bielinsky, A.-K., and S. A. Gerbi. 1998. Discrete start sites for DNA synthesis in the yeast ARS1 origin. Science 279:95-98.
13. Bielinsky, A.-K., and S. A. Gerbi. 1999. Chromosomal ARS1 has a single leading strand start site. Mol. Cell 3:477-486.[CrossRef][Medline]
14. Bogan, J. A., D. A. Natale, and M. L. DePamphilis. 2000. Initiation of eukaryotic DNA replication: conservative or liberal? J. Cell Physiol. 184:139-150.[CrossRef][Medline]
15. Brattain, M. G., D. E. Brattain, A. M. Sarrif, L. J. McRae, W. D. Fine, and J. G. Hawkins. 1982. Enhancement of growth of human colon tumor cell lines by feeder layers of murine fibroblasts. J. Natl. Cancer Inst. 69:767-771.
16. Brattain, M. G., W. D. Fine, F. M., Khaled, J. Thompson, and D. E. Brattain. 1981. Heterogeneity of malignant cells from a human colonic carcinoma. Cancer Res. 41:1751-1756.
17. Caddle, M. S., L. Dailey, and N. H. Heintz. 1990. RIP60, a mammalian origin-binding protein, enhances DNA bending near the dihydrofolate reductase origin of replication. Mol. Cell. Biol. 10:6236-6243.
18. Caddle, M. S., R. H. Lussier, and N. H. Heintz. 1990. Intramolecular DNA triplexes, bent DNA and DNA unwinding elements in the initiation region of an amplified dihydrofolate reductase replicon. J. Mol. Biol. 211:19-33.[CrossRef][Medline]
19. Chuang, R. Y., and T. J. Kelly. 1999. The fission yeast homologue of Orc4p binds to replication origin DNA via multiple AT-hooks. Proc. Natl. Acad. Sci. USA 96:2656-2661.
20. Clyne, R. K., and T. J. Kelly. 1995. Genetic analysis of an ARS element from the fission yeast Schizosaccharomyces pombe. EMBO J. 14:6348-6357.[Medline]
21. Dailey, L., M. S. Caddle, N. Heintz, and N. H. Heintz. 1990. Purification of RIP60 and RIP100, mammalian proteins with origin-specific DNA-binding and ATP-dependent helicase activities. Mol. Cell. Biol. 10:6225-6235.
22. Dhar, V., D. Mager, A. Iqbal, and C. L. Schildkraut. 1988. The coordinate replication of the human beta-globin gene domain reflects its transcriptional activity and nuclease hypersensitivity. Mol. Cell. Biol. 8:4958-4965.
23. Dijkwel, P. A., and J. L. Hamlin. 1995. The Chinese hamster dihydrofolate reductase origin consists of multiple potential nascent-strand start sites. Mol. Cell. Biol. 15:3023-3031.[Abstract]
24. Dijkwel, P. A., S. Wang, and J. L. Hamlin. 2002. Initiation sites are distributed at frequent intervals in the Chinese hamster dihydrofolate reductase origin of replication but are used with very different efficiencies. Mol. Cell. Biol. 22:3053-3065.
25. Dimitrova, D. S., and D. M. Gilbert. 1998. Regulation of mammalian replication origin usage in Xenopus egg extract. J. Cell Sci. 111:2989-2998.[Abstract]
26. Dimitrova, D. S., M. Giacca, F. Demarchi, G. Biamonti, S. Riva, and A. Falaschi. 1996. In vivo protein-DNA interactions at a human DNA replication origin. Proc. Natl. Acad. Sci. USA 93:1498-1503.
27. Diviacco, S., P. Norio, L. Zentilin, S. Menzo, M. Clementi, G. Biamonti, S. Riva, A. Falaschi, and M. Giacca. 1992. A novel procedure for quantitative polymerase chain reaction by coamplification of competitive templates. Gene 122:313-320.[CrossRef][Medline]
28. Epner, E., W. C. Forrester, and M. Groudine. 1988. Asynchronous DNA replication within the human beta-globin gene locus. Proc. Natl. Acad. Sci. USA 85:8081-8085.
29. Gey, G. O., W. D. Coffman, and M. T. Kubicek. 1952. Tissue culture studies of the proliferative capacity of cervical carcinoma and normal epithelium. Cancer Res. 12:264-265.
30. Giacca, M., L. Zentilin, P. Norio, S. Diviacco, D. Dimitrova, G. Contreas, G. Biamonti, G. Perini, F. Weighardt, S. Riva, and A. Falaschi. 1994. Fine mapping of a replication origin of human DNA. Proc. Natl. Acad. Sci. USA 91:7119-7123.
31. Gilbert, D. M. 2001. Making sense of eukaryotic origins of DNA replication. Science 294:96-100.
32. Gilbert, D. M. 2002. Replication timing and transcriptional control: beyond cause and effect. Curr. Opin. Cell Biol. 14:377-383.[CrossRef][Medline]
33. Heintzel, S. S., P. J. Krysan, C. T. Tran, and M. P. Calos. 1991. Autonomous DNA replication in human cells is affected by the size and the source of the DNA. Mol. Cell. Biol. 11:2263-2272.
34. Hochheimer, A., and R. Tjian. 2003. Diversified transcription initiation complexes expand promoter selectivity and tissue-specific gene expression. Genes Dev. 17:1309-1320.
35. Houchens, C. R., W. Montigny, L. Zeltser, L. Dailey, J. M. Gilbert, and N. H. Heintz. 2000. The DHFR ori beta-binding protein RIP60 contains 15 zinc-fingers: DNA binding and looping by the central three fingers and an associated proline-rich region. Nucleic Acids Res. 28:70-581.
36. Jacob, F., S. Brenner, and F. Cuzin. 1963. On the regulation of DNA replication in bacteria. Cold Spring Harbor Symp. Quant. Biol. 28:329-348.
37. Jin, Y., T. Yie, and A. Carothers. 1995. Non-random deletions at the dihydrofolate reductase locus of Chinese hamster ovary cells induced by 
-particle stimulating radon. Carcinogenesis 16:1981-1991.
38. Keller, C., E. M. Ladenburger, M. Kremer, and R. Knippers. 2002. The origin recognition complex marks a replication origin in the human TOP1 gene promoter. J. Biol. Chem. 277:31430-31440.
39. Kim, S.-M., and J. A. Huberman. 1998. Multiple orientation-dependent, synergistically interacting, similar domains in the ribosomal DNA replication origin of the fission yeast, Schizosaccharomyces pombe. Mol. Cell. Biol. 18:7294-7303.
40. Kobayashi, T., T. Rein, and M. L. DePamphilis. 1998. Identification of primary initiation sites for DNA replication in the hamster dihydrofolate reductase gene initiation zone. Mol. Cell. Biol. 18:3266-3277.
41. Kong, D., and M. L. DePamphilis. 2001. Site-specific DNA binding of the Schizosaccharomyces pombe origin recognition complex is determined by the Orc4 subunit. Mol. Cell. Biol. 21:8095-8103.
42. Kong, D., and M. L. DePamphilis. 2002. Site-specific ORC binding, pre-replication complex assembly and DNA synthesis at Schizosaccharomyces pombe replication origins. EMBO J. 21:5567-5576.[CrossRef][Medline]
43. Koo, H. S., H. M. Wu, and D. M. Crothers. 1986. DNA bending at adenine/thymine tracts. Nature 320:501-506.[CrossRef][Medline]
44. Kumar, S., M. Giacca, P. Norio, G. Biamonti, S. Riva, and A. Falaschi. 1996. Utilization of the same DNA replication origin by human cells of different derivation. Nucleic Acids Res. 24:3289-3294.
45. Ladenburger, E. M., C. Keller, and R. Knippers. 2002. Identification of a binding region for human origin recognition complex proteins 1 and 2 that coincides with an origin of DNA replication. Mol. Cell Biol. 22:1036-1048.
46. Levine, M., and R. Tjian. 2003. Transcription regulation and animal diversity. Nature 424:147-151.[CrossRef][Medline]
47. Li, C. J., J. A. Bogan, D. A. Natale, and M. L. DePamphilis. 2000. Selective activation of pre-replication complexes in vitro at specific sites in mammalian nuclei. J. Cell Sci. 113:887-898.[Abstract]
48. Lipford, J. R., and S. P. Bell. 2001. Nucleosomes positioned by ORC facilitate the initiation of DNA replication. Mol. Cell 7:21-30.[CrossRef][Medline]
49. Liu, G., M. Malott, and M. Leffak. 2003. Multiple functional elements comprise a mammalian chromosomal replicator. Mol. Cell. Biol. 23:1832-1842.
50. Malott, M., and M. Leffak. 1999. Activity of the c-myc replicator in an ectopic chromosomal location. Mol. Cell. Biol. 19:5685-5695.
51. Mechali, M. 2001. DNA replication origins: from sequence specificity to epigenetics. Nat. Rev. Genet. 2:640-645.[Medline]
52. Mesner, L. D., X. Li, P. A. Dijkwel, and J. L. Hamlin. 2003. The dihydrofolate reductase origin of replication does not contain any nonredundant genetic elements required for origin activity. Mol. Cell. Biol. 23:804-814.
53. Newlon, C. S., and J. F. Theis. 2002. DNA replication joins the revolution: whole-genome views of DNA replication in budding yeast. Bioessays 24:300-304.[CrossRef][Medline]
54. Okuno, Y., H. Satoh, M. Sekiguchi, and H. Masukata. 1999. Clustered adenine/thymine stretches are essential for function of a fission yeast replication origin. Mol. Cell. Biol. 19:6699-6707.
55. Pelizon, C., S. Diviacco, A. Falaschi, and M. Giacca. 1996. High-resolution mapping of the origin of DNA replication in the hamster dihydrofolate reductase gene domain by competitive PCR. Mol. Cell. Biol. 16:5358-5364.[Abstract]
56. Phi-van, L., C. Sellke, A. von Bodenhousen, and W. H. Stratling. 1998. An initiation zone of chromosomal DNA replication at the chicken lysozyme gene locus. J. Biol. Chem. 273:18300-18307.
57. Raghuraman, M. K., E. A. Winzeler, D. Collingwood, S. Hunt, L. Wodicka, A. Conway, D. J. Lockhart, R. W. Davis, B. J. Brewer, and W. L. Fangman. 2001. Replication dynamics of the yeast genome. Science 294:115-121.
58. Simpson, R. T. 1990. Nucleosome positioning can affect the function of a cis-acting DNA element in vivo. Nature 343:387-389.[CrossRef][Medline]
59. Takahashi, T., E. Ohara, H. Nishitani, and H. Masukata. 2003. Multiple ORC binding sites are required for efficient MCM loading and origin firing in fission yeast. EMBO J. 22:964-974.[CrossRef][Medline]
), contained within a 55-kb zone of less-frequent initiation events (shaded area) are indicated (see references 
