Department of Genetics, Stanford Medical School, Stanford, California,1 Samuel Lunenfeld Research Institute, Mount Sinai Hospital,2 Department of Molecular and Medical Genetics, University of Toronto, Toronto, Ontario, Canada3
Received 28 October 2003/ Returned for modification 5 December 2003/ Accepted 2 February 2004
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Studies of the p90 ribosomal S6 kinases (RSKs) indicate that these proteins may aid in the specification of RTK signals. The RSK proteins are intercellular serine/threonine kinases and were among the first identified targets of ERK (39, 64). Their protein structure comprises an ERK binding site as well as two distinct functional kinase domains; the C-terminal kinase domain is important for autophosphorylation, while the N-terminal kinase domain phosphorylates other target substrates (11, 26, 39, 76). In mammals, there are four p90Rsk genes, termed Rsk1 to -4 (RPS6K A1, A3, A2, and A6, respectively) (2, 47, 75, 77). Comparative analyses of RSK1-4 suggest that these proteins may have distinct roles for specifying ERK signals. Biochemical studies of RSK1-3 demonstrate that these proteins have different binding specificities for ERK and, after RTK stimulation, interact with ERK for different lengths of time (55, 76). In addition, RSK1 has limited interaction with identified targets of RSK2 (18), and Rsk1, -2, -3, and -4 genes are expressed in different patterns during late embryonic stages and in adult tissues (2, 42, 75). The biochemical differences among the family members suggest that there may be functional differences among the RSK proteins on a cellular level. Moreover, the differential expression patterns of the Rsk genes suggest distinct roles for the specification of RTK signals during mammalian embryogenesis.
Genetic analysis of mice has shown that many components of the RTK pathway are critical for the formation and patterning of the extraembryonic tissues, the precursors of the placenta (27, 54, 58, 74). Analysis of activated ERK during early mouse development further demonstrates that RTK signals are stimulated in the extraembryonic tissue (21). We wanted to identify molecules that could modify the outcome of RTK signals in the developing mouse embryo. Given the well-established role of RTK signals in the extraembryonic tissue, we decided to use this tissue as a source for identifying molecules that can mediate RTK signals. Unfortunately, the mouse embryo is small and confined to the uterus during the time at which RTK signals in the extraembryonic tissue are most influential. To overcome these technical challenges, we devised a method to identify mediators of RTK signals in the extraembryonic tissue by exploiting the more tractable Xenopus embryo as a screening tool (6, 14). In Xenopus the RTK pathway is necessary for the formation of the mesoderm, a tissue that has been well studied (reviewed in reference 29). Based on the knowledge that the core proteins of RTK signaling are conserved across species and utilized for the formation of different types of tissues, we screened a mouse expression library containing extraembryonic tissue for molecules that, upon overexpression, could alter the fate of Xenopus mesoderm.
In this screen for RTK modulators, we identified ribosomal S6 kinase 4 (RSK4), the fourth and least-studied member of the RSK family (75). Though similar in structure to the other RSK family members, RSK4 has a function that is distinct from that of RSK1 to RSK3. Consistent with this functional divergence, the inhibitory activity of RSK4 for RTK signaling is dependent upon a region that is not conserved in the other RSK proteins. Analysis of RSK4 in the developing mouse embryo demonstrates that Rsk4 is at the right time and place for this functional activity. Rsk4 expression is altered in mice without fibroblast growth factor (FGF) signals, suggesting that RTK signals regulate Rsk4 in vivo. These data provide the first evidence that an RSK protein may play an important role in the regulation of RTK signaling and tissue patterning in the developing mammalian embryo. Moreover, this study provides further support for the notion that though similar, the RSK proteins have diverse and distinct functions in the regulation of RTK signals.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Construction of DNA plasmids.
The expression library used for the screen was constructed with the pCS105 expression vector (35). The identified Rsk4 gene was subcloned from this vector into pCS107 (6) at SalI/NotI sites. Using a PCR strategy, MYC-tagged clones were constructed by cloning products into the EcoRI site of MTpCS3+, a modified version of pCS2 (54, 56, 70) (for MTpCS3+ sequence, visit http://sitemaker.med.umich.edu/dlturner.vectors). The original Rsk4pCS105 plasmid was used as a template for the MYC-tagged Rsk4 and
1-96Rsk4 constructs. Rsk2 pMT2, provided by C. Bjorbaek (24), and Homo sapiens Rsk1 pKH3 and H. sapiens Rsk3 pkH3 (55) were the templates for the Rsk2, -1, and -3 MYC constructs, respectively. Primers with EcoRI sequences were used to amplify the Rsk4 open reading frame (ORF) (forward [F], 5' CGTCAGAATTCTATGCTGAATTTTAGAAGGACACGCC; reverse [R], 5' GCGTACGAATTCGGACTGAAGAGCACAAGACTCTTA),
1-96Rsk4 (F, 5' GCGTCAGAATTCTCCTGAAGCGGCGATGCTACCGTT; R, 5' GCGTACGAATTCGGACTGAAGAGCACAAGACTCTTA), Mus musculus Rsk2 (F, 5' AGCCTCTAGAAATGCC GCTGGCGCACGTGGCG; R, 5' GAGCCTCTAGAACAGGGCTGTTGAGGTG). H. sapiens Rsk1 (F, 5' GCGTCAGGATTCTATGCCGCTCGCCC; R, 5' GCGTCAGGATTCTCAGG GTGGTGG) and H. sapiens Rsk3 (F, 5' GCGTCAGGATTCTATGGACCTGAGCATG; R, 5' GCGTCAGGATTCTCTACAGCCGCGTGG). Protein analysis using the TNT coupled reticulolysate system (Promega, Madison, Wis.) with sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot analysis for MYC demonstrated bands at the expected sizes.
91-860Rsk4 was constructed from Rsk4 in MTpCS3+. MTpCS3+Rsk4 was cut with XhoI enzyme to excise all but the first 272 bp of the Rsk4 gene. Rsk4 in MTpCS3+ was also used as the template for the K
Q221Rsk4 construct. QuikChange site-directed mutagenesis (Stratagene, La Jolla, Calif.) was used with the following primer and its reverse complement: F, 5' GGGCAGCTCTATGCAATGCAGGTGTTAAG AAAAGCTT. Mutations were confirmed by sequence analysis. The full length of the clone was sequenced to ensure that no other mutations were present. In vitro transcription and translation of this clone, followed by SDS-PAGE and Western blot analysis with MYC antibody, demonstrated that a protein at the expected size was formed.
Transcription of RNA. DNA constructs were linearized, and RNA was transcribed with an mMESSAGE Machine kit (Ambion, Austin, Tex.). The sources of the constructs are given in Table 1.
|
In situ hybridizations. Plasmids used to generate antisense probes are listed in Table 2.
|
Mouse in situ hybridizations were completed using a modified protocol (10, 72): embryos were dissected from pregnant Swiss Webster mice (Simmonson Lab, Gilroy, Calif.). Embryos were blocked with 2% BM Block (Roche, Indianapolis, Ind.) in 1x MAB buffer (52) and incubated at 4°C with anti-digoxigenin-AP Fab fragments (Roche) at a 1/2,000 dilution. Embryos were developed with BM Purple AP substrate (Roche). The antisense probe for Rsk4 was synthesized by using the Rsk4
91-860 construct as a template.
Ectodermal explants and RT-PCR assays. Embryos were injected into the presumptive ectoderm at the one-cell stage, developed to stage 8-9, and transferred to 0.75x NAM (52) solution for tissue excision. Explants were cultured in 0.75x NAM until stage 10.5. RNA was isolated, and reverse transcription (RT)-PCR was performed as previously described (73). Primers used are listed in Table 3.
|
In vitro culture of mouse embryos. Embryos were dissected and cultured as described previously (21).
Protein assays and immunoblots. Embryos were injected with RNA at the one-cell stage. Ectoderm was excised at stage 8-9 and allowed to develop until stage 10.5 in 0.75x NAM. Tissue was lysed in NOP buffer (150 mM NaCl, 10 mM Tris [pH 7.5], 1 mM MgCl2, 0.75 mM CaCl2, 2% IGPal) with general protease inhibitors (Sigma, St. Louis, Mo.), 10 mM NaF (Sigma), 10 nM sodium orthovanadate (Sigma), and 5 mM ß-glyceraldehyde (Sigma). Lysates were centrifuged at 4°C for 10 min, and the supernatant was removed. Samples were analyzed by SDS-PAGE and Western blotting with the following antibodies: Phospho-p44/42MAPK(Thr202/Tyr204) E10 monoclonal, p42 MAP kinase 3A7 monoclonal, and phospho-Mek1/2 (Ser217/221) (Cell Signaling Technology), anti-rabbit immunoglobulin, horseradish peroxidase (HRP)-linked whole antibody from donkey (Amersham, Piscataway, N.J.), and HRP-labeled polyclonal anti-mouse immunoglobulin (Pharmingen, San Diego, Calif.).
Kinase assays.
One-cell-stage Xenopus embryos were injected with Rsk4, Rsk2,
1-96Rsk4, and K
Q221Rsk4 RNA. Protein lysates were harvested at the gastrula stage and analyzed for kinase activity using the S6 kinase assay (Upstate, Lake Placid, N.Y.). Five experiments were analyzed for P32 transfer. The counts per minute (cpm) of Rsk4, Rsk2, and
1-96Rsk4 were significantly different (P < 0.05) from the cpm of the control (uninjected embryo lysates) when analyzed individually with a matched t test. The cpm of K
Q221Rsk4 were not significantly different from that of the control lysates.
| RESULTS |
|---|
|
|
|---|
Rsk4 is the fourth member of the mammalian p90rsk gene family (39). Human Rsk4 was originally identified in a positional cloning study as a candidate for an X-linked mental retardation syndrome, although no mutations within the Rsk4 gene were identified in patients affected with the syndrome (75). To date, the biochemical and cellular characteristics of RSK4 have not been described. The cloning of Rsk4 in a functional screen for Xbra inhibition suggested that Rsk4 could modulate RTK signals.
As seen in Fig. 1, injection of Rsk4 into the marginal zone of the developing embryos results in the disruption of normal Xbra expression (Fig. 1E). Upon further development, these embryos have severe defects, including patent blastopores and deformed neural tubes (Fig. 1F and G). The resulting tailbud-stage embryos are truncated along the anterior-posterior axis (Fig. 1H). These developmental abnormalities are consistent with the disruption of mesoderm and are similar to the phenotypes seen in embryos injected with other RTK inhibitors, such as dominant-negative forms of the FGF receptor and RAF proteins (3, 67).
|
|
Rsk4 disrupts FGF signaling. The signaling pathways that regulate the specification, as well as the dorsal-ventral patterning, of the germ layers in Xenopus have been well studied. Cursory analysis of the tissue formation of Rsk4-injected embryos allowed for analysis of the effect of Rsk4 overexpression on several pathways, including the FGF and transforming growth factor beta (TGF-ß) pathways. Both the FGF and TGF-ß signaling pathways are integral to the proper induction of Xbra (reviewed in reference 29). The TGF-ß pathway can also induce endoderm and specify dorsal mesoderm (16, 33). These signaling pathways are not independent of each other, since TGF-ß signals cannot induce general mesoderm in the absence of the FGF pathway. For example, in the presence of dominant-negative FGF receptor, ectopic TGF-ß signals can no longer induce Xbra or MyoD but maintain the ability to induce the dorsal mesoderm marker Gsc (20, 44). The large effect of Rsk4 overexpression on somitic mesoderm, but not dorsal or endodermal tissues, is consistent with a specific effect of Rsk4 on the FGF pathway. To further investigate this possibility, the effect of Rsk4 on the FGF and TGF-ß pathways was analyzed in more detail.
To investigate the effect of Rsk4 on the FGF and TGF-ß pathways, an ectodermal explant assay was performed. Activin, encoding a TGF-ß ligand, Smad2, encoding a mediator of TGF-ß signals, and Fgf8 were injected into the presumptive ectoderm of one-cell embryos, with or without Rsk4. Ectoderm explants were cultured to stage 10.5 and then harvested for RNA. RT-PCR was performed to detect downstream targets of the TGF-ß and FGF pathways. As shown in Fig. 3, Gsc, a dorsal mesoderm marker, and Sox17ß, an endoderm marker, are induced by Activin. (The level of Smad2 RNA injected was not high enough to induce dorsal or endodermal genes in this experiment.) These inductions are maintained in the presence of Rsk4, indicating that Rsk4 does not directly inhibit the TGF-ß pathway (Fig. 3A). Analysis of Xbra demonstrated that the presence of Rsk4 inhibited Fgf8, Activin, and Smad2 from inducing Xbra. Previous studies have shown that if the FGF pathway is abrogated, TGF-ß cannot induce Xbra (20, 44). Therefore, this result is consistent with Rsk4 directly disrupting both the FGF pathway and Xbra-inducing capabilities of the TGF-ß pathway or the FGF pathway only. We further investigated the effect of Rsk4 on two FGF-specific targets, Sprouty2 and Sef (49, 69). Fgf8 enhanced the expression of both Sprouty2 and Sef. This up-regulation was impeded by the presence of Rsk4 (Fig. 3B), indicating that Rsk4 inhibits FGF signals. Additionally, Rsk4 inhibits the induction of Xbra by both FGF and TGF-ß signals. Since the FGF pathway is required for TGFß induction of Xbra and the injection of Rsk4 does not impede the transcription of other downstream signals of TGF-ß, we conclude that Rsk4 is acting specifically on the FGF pathway.
|
|
RTK inhibition is specific to Rsk4. The RSK proteins have high similarity (Fig. 5A), and RSK1, -2, and -3 have been used interchangeably in biochemical assays to illicit similar effects (55, 76). A few studies have suggested a role for RSK proteins in negative feedback inhibition (23, 24, 40); however, RSK1, -2, and -3 have not been shown to directly inhibit RTK signaling. To investigate whether the other Rsk genes were capable of Xbra disruption, H. sapiens Rsk1, M.m. Rsk2, and H. sapiens Rsk3 (2, 77) were injected into the marginal zone of one-cell X. laevis embryos and analyzed by in situ analysis for Xbra expression at the gastrula stage. Xbra expression was not specifically disrupted by any these genes (Fig. 5C). To measure the protein level in the injected embryos, 20 embryos from each batch of injected embryos were removed prior to fixation. Protein was isolated from these embryos and analyzed by SDS and Western blotting for the MYC-tag protein. As can be seen in Fig. 5B, the embryos had similar amounts of protein.
|
Conversely, we investigated whether Rsk4 could mimic the activity of FARsk1 in maturing X. laevis oocytes. Stage 6 oocytes were injected with Rsk4 RNA, and germinal vesicle breakdown was measured both visually and by ERK activity. Unlike results with FARsk1 (28), the Rsk4-injected oocytes did not mature in the absence of progesterone (data not shown). Since the Rsk genes are not interchangeable in our assays, we conclude that Rsk4 has an intrinsic property that is sufficient for the disruption of the RAS-ERK pathway and is not found in the other Rsk genes.
Mutational analysis of Rsk4.
To identify regions of Rsk4 that confer Xbra-inhibiting activity, we deleted regions of the Rsk4 gene that are divergent from the other Rsk genes (Fig. 6A). Members of the p90RSK family have a distinct protein structure, comprised of two functional kinase domains as well as an ERK (ERK1/2) docking site (26, 39, 76). Alignment of the Rsk4 translated ORF with members of the p90RSK family shows that these domains are highly conserved (Fig. 5 and data not shown). However, mouse RSK4 has a 96-amino-acid extension at its N terminus that is not present in the published sequences of mouse RSK1-3 or human RSK4 (2, 41, 75). No known protein motifs are present in this extension. However, it contains a high number of positively charged residues. To test whether this N-terminal extension conferred the mesoderm-inhibiting activity of RSK4, a
1-96Rsk4 construct was created. Further analysis of the clone demonstrated that it encodes a MYC-tagged protein of the expected size (Fig. 6B) and it is a functional kinase (see Materials and Methods). Fgf8 RNA was injected into the presumptive ectoderm of one-cell embryos with or without RNA generated from the
1-96Rsk4 construct. Ectodermal explants were excised, RNA was generated, and RT-PCR analysis for Xbra was performed. While the full-length Rsk4 was able to block the induction of Xbra by Fgf8,
1-96Rsk4 could not (Fig. 6C). To test whether the N-terminal region alone could confer RSK4 activity, an N-terminal clone, Rsk4
91-860, was constructed and analyzed. This clone did not impede the induction of Xbra by Fgf8 (Fig. 6C).
|
Rsk4 expression in the developing mouse gastrula. After first identifying and characterizing mouse RSK4 as a negative regulator of the RAS-ERK pathway in X. laevis, we proceeded to investigate the role of RSK4 in the mouse embryo. Since the Rsk4 gene was identified from an expression library derived from 6.5-d.p.c. mouse embryos, we examined the expression pattern of Rsk4 during this developmental time. Whole-mount in situ analysis revealed that Rsk4 localizes to the extraembryonic tissue of the mouse at 6.0 to 8.5 d.p.c. At 6.0 to 7.5 d.p.c., expression is restricted to central extraembryonic tissue: it is not expressed in the ectoplacental cone or the extraembryonic cells most proximal to the embryonic/extra-embryonic junction (Fig. 7A to C). Rsk4 expression is strong in the chorion at 7.5 d.p.c. (Fig. 7D) and persists to 8.5 d.p.c. (Fig. 7E). Expression can also be seen in the allantois (Fig. 7E). The strong expression of Rsk4 in the extraembryonic tissue suggests a possible role in the specification of these tissues.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
In vivo analysis of Rsk4. The extraembryonic patterning events that are regulated by RTK signals in the mouse are among the earliest in the developing mammal. Given the genetic and functional support for RTK signals in the extraembryonic tissue, we felt that this tissue was ideal for the identification of RTK modulators, despite some of the technical challenges. To facilitate the study of this small, less accessible tissue, we capitalized on the Xenopus embryo. Using an expression cDNA library from an early developing mouse embryo, we performed a functional screen with Xenopus to identify molecules that regulate and/or specify RTK signals and found Rsk4. Despite the obvious caveats of this nonconventional method, the subsequent demonstration of specific tissue expression of Rsk4 validated our initial studies with the frog embryo. Rsk4 is expressed in the extraembryonic tissue, a tissue in which the regulation of RTK signals is critical for proper development. Moreover, Rsk4 is localized to the central region of the extraembryonic tissue, and its expression is flanked both distally and proximally by the expression of active ERK. The most distal expression of active ERK is a layer of cells that forms a discrete ring (21). Maintenance of such a specific pattern requires a tight regulation of local signals and therefore often involves intricate feedback loops. In the absence of FGF, an RTK ligand, active ERK is lost distally and Rsk4 expression expands into the ring of cells that normally contains active ERK. This indicates that Rsk4 and activated ERK signals have a dynamic interaction in vivo. This interaction may regulate the specification of the distal extraembryonic cells. Though the exact role of these distal cells remains unknown, they are located in an area of active signaling that likely plays a role in the patterning of both embryonic and extraembryonic tissues (reviewed in references 8 and 9). Further studies of Rsk4 in this area may shed more light on the function of these cells, but certainly data from this report provide the first evidence that an RSK may be involved in the modulation of RTK signals in the early developing embryo.
How and where does Rsk4 act?
Results from mutational analysis provide some information about how RSK4 might act. Site-directed mutagenesis of the lysine in the N-terminal kinase domain removed the ability of RSK4 to disrupt RTK signals. This suggests that the inhibition of RTK signals by RSK4 is a result of the phosphorylation of substrate. Candidates for the molecular target of RSK4 kinase activity are plentiful. RSK4 could act by directly phosphorylating and inhibiting a member of the RAS-ERK pathway. Alternatively, it could act indirectly by either activating an inhibitor or repressing expression of downstream transcriptional targets. These possibilities can all be supported by studies of the other RSK isoforms. In a study using rat PC12 epidermal growth factor (EGF)-cultured cells, RSK2 was shown to phosphorylate SOS, a membrane-tethered protein that mediates RTK activities (23). From this result, it was hypothesized that RSK2 could feedback negatively on the EGF pathway, though no further evidence in support of this idea has been put forth. Although hypothesized for RSK2, we do not support this mode of action for RSK4. RSK4 is able to inhibit constitutively active forms of RAS and ERK, which are both downstream of SOS. Therefore, we think it is more likely that RSK4 can inhibit RTK signaling at the level of or downstream of ERK. This model is supported in the literature, where it is shown that RSK isoforms localize to the nucleus upon RTK activation (12). Moreover, RSK2 has been shown to up-regulate Estrogen Receptor
and c-Fos transcription, suggesting a role for the RSK proteins in transcriptional regulation (15, 18, 38).
Deletion of the N terminus of RSK4, a region not conserved in the other RSK proteins, removes the ability of RSK4 to disrupt RTK signaling, indicating that these N-acids are required for RSK4 activity. Since BLOCK analysis (32) did not identify any known protein motifs, there is little indication of the exact role for this region in conferring RSK4 activity. Protein from the
1-96Rsk4 construct maintains its ability to phosphorylate S6, suggesting that deletion of the N terminus does not disrupt the kinase ability of RSK4. Though no defined motifs were identified, the N terminus is comprised of many charged residues, suggesting that it could be targeting RSK4 to the nucleus or allowing RSK4 to interact with DNA. Analysis of Sef and Sprouty2, two negative feedback regulators of the FGF-RAS-ERK pathway, demonstrates that these genes are not transcriptionally regulated by RSK4. However, this does not exclude the possibility that RSK4 could be interacting with SEF and SPROUTY2 proteins or that RSK4 is interacting with other nuclear targets.
Our biochemical experiments suggest that RSK4 confers its Xbra inhibition by blocking signaling directly on or downstream of ERK, since RSK4 is able to block D. melanogaster Erksem from inducing its transcription. Consistent with RSK4 acting directly on ERK, tissues injected with Fgf8 and Rsk4 do not have phosphorylated ERK protein. Functional screens such as the one described in this report are inherently prone to the caveats of expressing genes at high, often nonphysiologic levels. Therefore, it is formally possible that RSK4, with its carboxy-terminal ERK binding site, is simply sequestering and inhibiting the activation of ERK to act as a dominant-negative molecule. We think this is unlikely for several reasons. First, the RSK4 putative N-terminal kinase activity is required for Rsk4 activity. Additionally, the other RSK isoforms, in which the C-terminal ERK docking site is conserved (59), do not maintain this function. Finally, mutational analysis demonstrates that without the N terminus of the gene, Rsk4 loses its ability to disrupt the FGF pathway. Since the conserved carboxy-terminal ERK binding site is still present on the
1-96Rsk4 clone, its presence cannot be the sole reason for the described Rsk4 function. Thus, while the data are consistent with RSK4 directly disrupting active ERK, the evidence that RSK4 requires its kinase activity and that the amino-terminally truncated RSK4 with an intact ERK binding site is not sufficient for its function suggests a mechanism of action that is more complex than simple sequestration of ERK by RSK4. The identification of the mechanism by which Rsk4 inhibits RTK signals and the identification of other Rsk4 targets will be exciting avenues for investigation. The use of trophoblast stem cells for biochemical assays in combination with RSK4 analysis in genetically perturbed mouse models should aid in these pursuits.
Summary. As a result of the conservation of the RAS-ERK cascade and the requirement of this pathway in multiple organisms for the specification of different tissue types, we were able to identify Rsk4 in a cross-species screen. Since its function is dependent upon a region of the gene that is divergent from the other Rsk family members, it would have been challenging to identify the full length of this gene by homology only. Among products of the Rsk genes, the ability to inhibit RTK signals is specific to RSK4, adding to the evidence that not all RSK functions are similar. Rsk4 is expressed in the extraembryonic region of the developing gastrula in a pattern that is consistent with its activity. Further investigation of Rsk4 in the contexts of general RAS-ERK signaling and the development of the extraembryonic tissues should add to these fields of investigation.
| ACKNOWLEDGMENTS |
|---|
This work was supported by a grant from the National Institutes of Health (ROI HD 41557). Support for A.P.M. was provided by the Medical Scientist Training Program (GM07365).
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
2. Alcorta, D. A., C. M. Crews, L. J. Sweet, L. Bankston, S. W. Jones, and R. L. Erikson. 1989. Sequence and expression of chicken and mouse rsk: homologs of Xenopus laevis ribosomal S6 kinase. Mol. Cell. Biol. 9:3850-3859.
3. Amaya, E., P. A. Stein, T. J. Musci, and M. W. Kirschner. 1993. FGF signalling in the early specification of mesoderm in Xenopus. Development 118:477-487.[Abstract]
4. Anderson, N. G., J. L. Maller, N. K. Tonks, and T. W. Sturgill. 1990. Requirement for integration of signals from two distinct phosphorylation pathways for activation of MAP kinase. Nature 343:651-653.[CrossRef][Medline]
5. Avruch, J., A. Khokhlatchev, J. M. Kyriakis, Z. Luo, G. Tzivion, D. Vavvas, and X. F. Zhang. 2001. Ras activation of the Raf kinase: tyrosine kinase recruitment of the MAP kinase cascade. Recent Prog. Horm. Res. 56:127-155.[Abstract]
6. Baker, J. C., R. S. Beddington, and R. M. Harland. 1999. Wnt signaling in Xenopus embryos inhibits bmp4 expression and activates neural development. Genes Dev. 13:3149-3159.
7. Baker, J. C., and R. M. Harland. 1996. A novel mesoderm inducer, Madr2, functions in the activin signal transduction pathway. Genes Dev. 10:1880-1889.
8. Beddington, R. S., and E. J. Robertson. 1998. Anterior patterning in mouse. Trends Genet. 14:277-284.[CrossRef][Medline]
9. Beddington, R. S., and E. J. Robertson. 1999. Axis development and early asymmetry in mammals. Cell 96:195-209.[CrossRef][Medline]
10. Belo, J. A., T. Bouwmeester, L. Leyns, N. Kertesz, M. Gallo, M. Follettie, and E. M. De Robertis. 1997. Cerberus-like is a secreted factor with neutralizing activity expressed in the anterior primitive endoderm of the mouse gastrula. Mech. Dev. 68:45-57.[CrossRef][Medline]
11. Bjorbaek, C., Y. Zhao, and D. E. Moller. 1995. Divergent functional roles for p90rsk kinase domains. J. Biol. Chem. 270:18848-18852.
12. Blenis, J., J. Chung, E. Erikson, D. A. Alcorta, and R. L. Erikson. 1991. Distinct mechanisms for the activation of the RSK kinases/MAP2 kinase/pp90rsk and pp70-S6 kinase signaling systems are indicated by inhibition of protein synthesis. Cell Growth Differ. 2:279-285.[Abstract]
13. Blumberg, B., C. V. Wright, E. M. De Robertis, and K. W. Cho. 1991. Organizer-specific homeobox genes in Xenopus laevis embryos. Science 253:194-196.
14. Borchers, A. G., A. L. Hufton, A. G. Eldridge, P. K. Jackson, R. M. Harland, and J. C. Baker. 2002. The E3 ubiquitin ligase GREUL1 anteriorizes ectoderm during Xenopus development. Dev. Biol. 251:395-408.[CrossRef][Medline]
15. Chen, R. H., P. C. Juo, T. Curran, and J. Blenis. 1996. Phosphorylation of c-Fos at the C-terminus enhances its transforming activity. Oncogene 12:1493-1502.[Medline]
16. Cho, K. W., B. Blumberg, H. Steinbeisser, and E. M. De Robertis. 1991. Molecular nature of Spemann's organizer: the role of the Xenopus homeobox gene goosecoid. Cell 67:1111-1120.[CrossRef][Medline]
17. Ciruna, B. G., and J. Rossant. 1999. Expression of the T-box gene Eomesodermin during early mouse development. Mech. Dev. 81:199-203.[CrossRef][Medline]
18. Clark, D. E., C. E. Poteet-Smith, J. A. Smith, and D. A. Lannigan. 2001. Rsk2 allosterically activates estrogen receptor alpha by docking to the hormone-binding domain. EMBO J. 20:3484-3494.[CrossRef][Medline]
19. Condie, B. G., and R. M. Harland. 1987. Posterior expression of a homeobox gene in early Xenopus embryos. Development 101:93-105.[Abstract]
20. Cornell, R. A., and D. Kimelman. 1994. Activin-mediated mesoderm induction requires FGF. Development 120:453-462.[Abstract]
21. Corson, L. B., Y. Yamanaka, K. M. Lai, and J. Rossant. 2003. Spatial and temporal patterns of ERK signaling during mouse embryogensis. Development 130:4527-4537.
22. Doniach, T., and T. J. Musci. 1995. Induction of anteroposterior neural pattern in Xenopus: evidence for a quantitative mechanism. Mech. Dev. 53:403-413.[CrossRef][Medline]
23. Douville, E., and J. Downward. 1997. EGF induced SOS phosphorylation in PC12 cells involves P90 RSK-2. Oncogene 15:373-383.[CrossRef][Medline]
24. Dufresne, S. D., C. Bjorbaek, K. El-Haschimi, Y. Zhao, W. G. Aschenbach, D. E. Moller, and L. J. Goodyear. 2001. Altered extracellular signal-regulated kinase signaling and glycogen metabolism in skeletal muscle from p90 ribosomal S6 kinase 2 knockout mice. Mol. Cell. Biol. 21:81-87.
25. Feldman, B., W. Poueymirou, V. E. Papaioannou, T. M. DeChiara, and M. Goldfarb. 1995. Requirement of FGF-4 for postimplantation mouse development. Science 267:246-249.
26. Fisher, T. L., and J. Blenis. 1996. Evidence for two catalytically active kinase domains in pp90rsk. Mol. Cell. Biol. 16:1212-1219.[Abstract]
27. Giroux, S., M. Tremblay, D. Bernard, J. F. Cardin-Girard, S. Aubry, L. Larouche, S. Rousseau, J. Huot, J. Landry, L. Jeannotte, and J. Charron. 1999. Embryonic death of Mek1-deficient mice reveals a role for this kinase in angiogenesis in the labyrinthine region of the placenta. Curr. Biol. 9:369-372.[CrossRef][Medline]
28. Gross, S. D., A. L. Lewellyn, and J. L. Maller. 2001. A constitutively active form of the protein kinase p90Rsk1 is sufficient to trigger the G2/M transition in Xenopus oocytes. J. Biol. Chem. 276:46099-46103.
29. Harland, R., and J. Gerhart. 1997. Formation and function of Spemann's organizer. Annu. Rev. Cell Dev. Biol. 13:611-667.[CrossRef][Medline]
30. Harland, R. M. 1991. In situ hybridization: an improved whole-mount method for Xenopus embryos. Methods Cell Biol. 36:685-695.[Medline]
31. Hemmati-Brivanlou, A., and D. A. Melton. 1994. Inhibition of activin receptor signaling promotes neuralization in Xenopus. Cell 77:273-281.[CrossRef][Medline]
32. Henikoff, S., and J. G. Henikoff. 1994. Protein family classification based on searching a database of blocks. Genomics 19:97-107.[CrossRef][Medline]
33. Henry, G. L., I. H. Brivanlou, D. S. Kessler, A. Hemmati-Brivanlou, and D. A. Melton. 1996. TGF-beta signals and a pattern in Xenopus laevis endodermal development. Development 122:1007-1015.[Abstract]
34. Hopwood, N. D., A. Pluck, and J. B. Gurdon. 1989. MyoD expression in the forming somites is an early response to mesoderm induction in Xenopus embryos. EMBO J. 8:3409-3417.[Medline]
35. Hsu, D. R., A. N. Economides, X. Wang, P. M. Eimon, and R. M. Harland. 1998. The Xenopus dorsalizing factor Gremlin identifies a novel family of secreted proteins that antagonize BMP activities. Mol. Cell 1:673-683.[CrossRef][Medline]
36. Hudson, C., D. Clements, R. V. Friday, D. Stott, and H. R. Woodland. 1997. Xsox17
and -ß mediate endoderm formation in Xenopus. Cell 91:397-405.[CrossRef][Medline]
37. Jacobson, M., and U. Rutishauser. 1986. Induction of neural cell adhesion molecule (NCAM) in Xenopus embryos. Dev. Biol. 116:524-531.[CrossRef][Medline]
38. Joel, P. B., J. Smith, T. W. Sturgill, T. L. Fisher, J. Blenis, and D. A. Lannigan. 1998. pp90rsk1 regulates estrogen receptor-mediated transcription through phosphorylation of Ser-167. Mol. Cell. Biol. 18:1978-1984.
39. Jones, S. W., E. Erikson, J. Blenis, J. L. Maller, and R. L. Erikson. 1988. A Xenopus ribosomal protein S6 kinase has two apparent kinase domains that are each similar to distinct protein kinases. Proc. Natl. Acad. Sci. USA 85:3377-3381.
40. Kinuya, M., K. Takishima, and G. Mamiya. 2000. Detection of kinases that phosphorylate 14-3-3 binding sites of Raf-1 using in situ gel kinase assay. Biol. Pharm. Bull. 23:1158-1162.[Medline]
41. Kispert, A., R. J. Stoger, M. Caparros, and B. G. Herrmann. 1999. The mouse Rsk3 gene maps to the Leh66 elements carrying the t-complex responder Tcr. Mamm. Genome 10:794-802.[CrossRef][Medline]
42. Kohn, M., H. Hameister, M. Vogel, and H. Kehrer-Sawatzki. 2003. Expression pattern of the Rsk2, Rsk4 and Pdk1 genes during murine embryogenesis. Gene Expr. Patterns 3:173-177.[CrossRef][Medline]
43. LaBonne, C., B. Burke, and M. Whitman. 1995. Role of MAP kinase in mesoderm induction and axial patterning during Xenopus development. Development 121:1475-1486.[Abstract]
44. LaBonne, C., and M. Whitman. 1994. Mesoderm induction by activin requires FGF-mediated intracellular signals. Development 120:463-472.[Abstract]
45. Lamb, T. M., A. K. Knecht, W. C. Smith, S. E. Stachel, A. N. Economides, N. Stahl, G. D. Yancopolous, and R. M. Harland. 1993. Neural induction by the secreted polypeptide noggin. Science 262:713-718.
46. MacNicol, A. M., A. J. Muslin, and L. T. Williams. 1993. Raf-1 kinase is essential for early Xenopus development and mediates the induction of mesoderm by FGF. Cell 73:571-583.[CrossRef][Medline]
47. Moller, D. E., C. H. Xia, W. Tang, A. X. Zhu, and M. Jakubowski. 1994. Human rsk isoforms: cloning and characterization of tissue-specific expression. Am. J. Physiol. 266:C351-C359.
48. Munoz-Sanjuan, I., and A. H.-Brivanlou. 2001. Early posterior/ventral fate specification in the vertebrate embryo. Dev. Biol. 237:1-17.[CrossRef][Medline]
49. Nutt, S. L., K. S. Dingwell, C. E. Holt, and E. Amaya. 2001. Xenopus Sprouty2 inhibits FGF-mediated gastrulation movements but does not affect mesoderm induction and patterning. Genes Dev. 15:1152-1166.
50. Nystrom, F. H., and M. J. Quon. 1999. Insulin signalling: metabolic pathways and mechanisms for specificity. Cell Signal 11:563-574.[CrossRef][Medline]
51. Oellers, N., and E. Hafen. 1996. Biochemical characterization of rolledSem, an activated form of Drosophila mitogen-activated protein kinase. J. Biol. Chem. 271:24939-24944.
52. Peng, H. B. 1991. Xenopus laevis: practical uses in cell and molecular biology. Solutions and protocols. Methods Cell Biol.36:657-662.[Medline]
53. Porter, A. C., and R. R. Vaillancourt. 1998. Tyrosine kinase receptor-activated signal transduction pathways which lead to oncogenesis. Oncogene 17:1343-1352.[CrossRef][Medline]
54. Rossant, J., and J. C. Cross. 2001. Placental development: lessons from mouse mutants. Nat. Rev. Genet. 2:538-548.[Medline]
55. Roux, P. P., S. A. Richards, and J. Blenis. 2003. Phosphorylation of p90 ribosomal S6 kinase (RSK) regulates extracellular signal-regulated kinase docking and RSK activity. Mol. Cell. Biol. 23:4796-4804.
56. Rupp, R. A., L. Snider, and H. Weintraub. 1994. Xenopus embryos regulate the nuclear localization of XMyoD. Genes Dev. 8:1311-1323.
57. Sasai, Y., B. Lu, S. Piccolo, and E. M. De Robertis. 1996. Endoderm induction by the organizer-secreted factors chordin and noggin in Xenopus animal caps. EMBO J. 15:4547-4555.[Medline]
58. Saxton, T. M., A. M. Cheng, S. H. Ong, Y. Lu, R. Sakai, J. C. Cross, and T. Pawson. 2001. Gene dosage-dependent functions for phosphotyrosine-Grb2 signaling during mammalian tissue morphogenesis. Curr. Biol. 11:662-670.[CrossRef][Medline]
59. Smith, J. A., C. E. Poteet-Smith, K. Malarkey, and T. W. Sturgill. 1999. Identification of an extracellular signal-regulated kinase (ERK) docking site in ribosomal S6 kinase, a sequence critical for activation by ERK in vivo. J. Biol. Chem. 274:2893-2898.
60. Smith, J. C., B. M. Price, J. B. Green, D. Weigel, and B. G. Herrmann. 1991. Expression of a Xenopus homolog of Brachyury (T) is an immediate-early response to mesoderm induction. Cell 67:79-87.[CrossRef][Medline]
61. Smith, W. C., and R. M. Harland. 1992. Expression cloning of noggin, a new dorsalizing factor localized to the Spemann organizer in Xenopus embryos. Cell 70:829-840.[CrossRef][Medline]
62. Smith, W. C., and R. M. Harland. 1991. Injected Xwnt-8 RNA acts early in Xenopus embryos to promote formation of a vegetal dorsalizing center. Cell 67:753-765.[CrossRef][Medline]
63. Sohaskey, M. L., and J. E. Ferrell, Jr. 2002. Activation of p42 mitogen-activated protein kinase (MAPK), but not c-Jun NH(2)-terminal kinase, induces phosphorylation and stabilization of MAPK phosphatase XCL100 in Xenopus oocytes. Mol. Biol. Cell 13:454-468.
64. Sturgill, T. W., L. B. Ray, E. Erikson, and J. L. Maller. 1988. Insulin-stimulated MAP-2 kinase phosphorylates and activates ribosomal protein S6 kinase II. Nature 334:715-718.[CrossRef][Medline]
65. Tan, P. B., and S. K. Kim. 1999. Signaling specificity: the RTK/RAS/MAP kinase pathway in metazoans. Trends Genet. 15:145-149.[CrossRef][Medline]
66. Tanaka, S., T. Kunath, A. K. Hadjantonakis, A. Nagy, and J. Rossant. 1998. Promotion of trophoblast stem cell proliferation by FGF4. Science 282:2072-2075.
67. Tang, T. L., R. M. Freeman, Jr., A. M. O'Reilly, B. G. Neel, and S. Y. Sokol. 1995. The SH2-containing protein-tyrosine phosphatase SH-PTP2 is required upstream of MAP kinase for early Xenopus development. Cell 80:473-483.[CrossRef][Medline]
68. Thomsen, G., T. Woolf, M. Whitman, S. Sokol, J. Vaughan, W. Vale, and D. A. Melton. 1990. Activins are expressed early in Xenopus embryogenesis and can induce axial mesoderm and anterior structures. Cell 63:485-493.[CrossRef][Medline]
69. Tsang, M., R. Friesel, T. Kudoh, and I. B. Dawid. 2002. Identification of Sef, a novel modulator of FGF signalling. Nat. Cell Biol. 4:165-169.[CrossRef][Medline]
70. Turner, D. L., and H. Weintraub. 1994. Expression of achaete-scute homolog 3 in Xenopus embryos converts ectodermal cells to a neural fate. Genes Dev. 8:1434-1447.
71. Whitman, M., and D. A. Melton. 1992. Involvement of p21ras in Xenopus mesoderm induction. Nature 357:252-254.[CrossRef][Medline]
72. Wilkinson, D. 1992. In situ hybridisation: a practical approach. IRL Press, Oxford University, Oxford, United Kingdom.
73. Wilson, P. A., and D. A. Melton. 1994. Mesodermal patterning by an inducer gradient depends on secondary cell-cell communication. Curr. Biol. 4:676-686.