![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
J. Russell Hayman,3, Hua Gu,2 and John H. Kehrl1*
Laboratories of Immunoregulation,1 Immunology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland 20892,2 Department of Microbiology, James H. Quillen College of Medicine, East Tennessee State University, Johnson City, Tennessee 376143
Received 22 December 2003/ Returned for modification 9 January 2004/ Accepted 24 March 2004
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
subunits, likely fine tune the cellular responses to chemokines. Here we show that Rgs1–/– mice possess B cells that respond excessively and desensitize improperly to the chemokines CXCL12 and CXCL13. Many of the B-cell follicles in the spleens of Rgs1–/– mice have germinal centers even in the absence of immune stimulation. Furthermore, immunization of these mice leads to exaggerated germinal center formation; partial disruption of the normal architecture of the spleen and Peyer's patches; and abnormal trafficking of immunoglobulin-secreting cells. These results reveal the importance of a regulatory mechanism that limits and desensitizes chemokine receptor signaling. |
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Most chemoattracant receptors and all chemokine receptors couple to heterotrimeric G-proteins (1). Activated receptors trigger G subunits to exchange GTP for GDP, which dissociates the G subunit from ß
heterodimers, leading to the activation of downstream effectors. However, G subunits possess an intrinsic GTPase activity that limits the duration of their remaining GTP bound. GTP hydrolysis allows the heterotrimer to reform, and signaling ceases (18, 35). Also limiting the duration of G subunits' remaining GTP bound, members of the regulator of G protein signaling (RGS) protein family dramatically increase the intrinsic G GTPase activity, a property that defines them as GTPase activating proteins (GAPs). Genetic studies in Saccharomyces cerevisiae, Caenorhabditis elegans, and Aspergillus nidulans first identified such proteins (7, 21, 25). Independently, a mammalian protein termed GAIP was discovered to interact with a G subunit (6) and four mammalian proteins designated RGS1, RGS2, RGS3, and RGS4 substituted to various degrees for Sst2p, a yeast protein involved in the desensitization of pheromone signaling (9). Approximately 25 human RGS proteins have now been identified. When tested in standard in vitro GAP assays, most RGS proteins possess GAP activity for the subunits of the Gi and Gq subfamilies (3, 19, 44).
Since chemokine receptors use Gi and perhaps Gq to transduce intracellular signals, the presence of an RGS protein in target cells could substantially alter the response to chemokine stimulation (20). B-lymphocytes, especially following B-cell activation through their antigen receptors, express RGS1. Consistent with a role for RGS1 in regulating the B-cell responses to chemokines, the expression of RGS1 in B-cell lines dramatically impairs their migratory response to CXCL12 and CXCL13 (4, 33, 38). Because the normal trafficking of B cells depends upon the ligand receptor pairs CXCL12-CXCR4 (34, 46) and CXCL13-CXCR5 (11, 15, 26), a deficiency of Rgs1 in vivo could alter B-cell development and/or the organization of B cells in lymphoid tissues. To test that possibility we generated Rgs1–/– mice.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
RNA isolation and reverse transcription (RT)-PCR analysis. Total RNA was isolated, using a QIAGEN RNA kit with DNase treatment, from cell populations sorted by fluorescence-activated cell sorting or magnetic bead isolation. The cDNA was generated using the Clontech Advantage TM RT-for-PCR kit. For the PCRs, various amounts of cDNA were used with purRE Taq Ready-to-Go PCR Beads (Amersham Biosciences) and 1 µl of each primer. The following primer pairs were used: for ß-actin, 5'CCTAAGGCCAACCGTGAAAAG3' and 5'TCTTCATGGTGCTAGGAGCCA3'; for Rgs1, 5'ACGAGCAGCCATCTCCATGCC and 5'CCCAGATTCCAGATGTGGGAT3'; for Rgs2, 5'AGCCTGAGTGTTAGGAAAACATGG3' and 5'TCTTTCATCTCAAACTCTGCTTTC3'; for Rgs10, 5'GCAGTCTCGGCTCACTGAAAAGATTC3' and 5'TATCCAGAGGGAAGGTCTAGCACACTCC3'; for Rgs13, 5'ATGAGCAGGCGGAATTGTTGGA3' and 5'GAAACTGTTGTTGGACTGCATA3'; and for Rgs16, 5'CCATCGGGAAGAGAGGTGGAGTCGC3' and 5'CCAGGAGTGAGGAAATCAAGACGGG3'. The PCR amplifications were done with the following protocol: 94°C for 3 min initially; followed by 26 to 30 cycles of 30 s at 94°C, 30 s at 58 or 60°C, and 1 min at 72°C; and finally 1 cycle at 72°C for 10 min. The PCR products were separated by electrophoresis in 2% agarose and visualized by staining with ethidium bromide. For each primer pair, the number of PCR cycles chosen was chosen to be in the linear amplification range.
Cell isolation and flow cytometry. Bone marrow cells were isolated from femur bones. A portion was used for RNA preparation and the rest was used to isolate various progenitor B-cell populations using the monoclonal antibodies (MAbs) B220 and CD43 (BD PharMingen) and cell sorting with a FACStarPlus (Becton Dickinson). Thymocytes and T-cell fractions were prepared using the CD4 and CD8 MAbs (BD PharMingen) and cell sorting. B cells from spleen, mesenteric lymph node, peripheral lymph nodes, and Peyer's patches were isolated by negative depletion using biotinylated antibodies to CD4, CD8, GR-1, and CDllc (BD PharMingen) and DynabeadsR M-280 Streptavidin (Dynal Inc., Lake Success, N.Y.). Activated splenic B cells were obtained at various time points following the immunization of mice with a 10% sheep red blood cell (SRBC) solution. In addition, B-cell subsets were isolated from the T-depleted spleen cells by staining remaining cell suspensions with MAbs to CD21, CD23, and B220 (BD PharMingen) and cell sorting. The B-cell populations collected were marginal zone (CD21hi CD23low B220+), follicular cells (CD21+ CD23+ B220+), and transitional cells (CD21dim CD23– B220+). Plasma cells were isolated by cell sorting T-cell-depleted spleen or Gr-1/Mac-1-depleted bone marrow and staining for B220, immunoglobulin G (IgG), and CD138. The cell populations were greater than 95% pure.
Immunofluorescence microscopy, immunohistochemistry, and immunoblotting. Tissues were embedded in OCT compound, snap frozen, and stored at –80°C. Cryostat sections (10 µm thick) were dried and fixed in acetone or in some cases were formalin fixed and paraffin embedded. In some cases (RGS1 antibody), the acetone-fixed, OCT-embedded sections were rehydrated, treated with 0.15% Triton X-100 in phosphate-buffered saline (PBS) for 5 min, washed with PBS, and quenched with 50 mM NH4CL in PBS prior to use. For immunofluorescent microscopy the slides were preincubated for 30 min in antibody blocking solution (Dako Corporation) plus 5% serum before incubation with antibodies in a humidified chamber for 1 h at 37°C. Antibodies used were rabbit anti-RGS1 (affinity-purified rabbit antibody raised against an N-terminal RGS1 peptide [33]), anti-IgM (Jackson ImmunoResearch Laboratories), PNA (Vector Laboratories), or anti-B220 or anti-IgG (BD PharMingen). After three washes in PBS a labeled secondary antibody was added for detection, goat anti-rabbit IgG or rabbit anti-goat IgG (Jackson ImmunoResearch Laboratories). The sections were incubated for 1 h at 37°C and then washed with PBS as before and mounted with Fluoromount-G (Southern Biotechnologies). For immunohistochemistry the sections were blocked with a peroxidase blocking reagent and preincubated for 30 min in antibody blocking solution (Dako Corporation) plus 5% serum before incubation with directly biotin-conjugated anti-CD3 and anti-B220 (BD PharMingen) MAbs using the Zymed LAB-SA system (Zymed Laboratories). The sections were visualized using an Olympus BX60 microscope-camera equipped with epifluorescence or in some instances a Leica confocal microscope (NIAID Imaging Unit). The immunoblotting of RGS1 was performed as previously described (33).
Determination of intracellular calcium levels. Splenic cells were isolated, and a single-cell suspension was made. Cells were washed in HBSS buffer (Hanks' balanced salt solution with calcium and magnesium, 10 mM HEPES, and 1% fetal bovine serum), and resuspended at 107 cells/ml in HBSS buffer plus the fluorescent calcium probe Indo-1 (indo-1/acetoxymethylester; Sigma or Molecular Probes) at a final concentration of 2 µg/ml. The cells were incubated for 30 min at 30°C while protected from light. Next, the cells were washed with HBSS buffer and resuspended at 106 cells/ml in HBSS buffer. Cells were stained with MAbs CD21-FITC, CD23-PE, and B220-APC (BD PharMingen) for 10 min and washed three times in HBSS buffer. The cells were warmed at 37°C for 3 min, loaded into the Time Zero module (Cyteck, Fremont, Calif.) and run at 1,000 cells/s. A baseline was collected for 30 s, and then a sham of 50 µl of HBSS buffer was injected, and finally at 60 s the stimulant was injected. For the desensitization assay cells, a second injection of stimulant was added 2 min after the calcium level returned to baseline. The measurement of calcium flux was performed on a FACSVantage flow cytometer (BD Biosciences) equipped with an argon laser tuned to 488 nm and a Krypton laser tuned to 360 nm. Indo-1 fluorescence was analyzed at 390/20 and 530/20 for bound and free probe, respectively. The data were analyzed using the FlowJo software (Tree Star Inc.). Results are shown as fluorescence ratio (violet/blue).
Chemotaxis assays. Lymphocyte chemotaxis assays were performed using a transwell chamber as previously described (33). Optimal concentrations for CXCL12- and CXCL13-induced chemotaxis were determined in titration experiments. Aliquots of various fractions (input, migrated to chemokine, or migrated in the absence of chemokine) were stained with anti-B220 for 15 min at 4°C, washed, and analyzed on a FACScalibur. Results are shown as the percentage of specific migration, which was calculated by determining the difference between the number of cells in the chemokine-containing well and the number in the well without chemokine, multiplying this difference by 100, and dividing the result by the number of cells put into the assay. For the migration desensitization analyses, cells were exposed either to PBS buffer or to CXCL12 (50 ng/ml; R&D Systems) for 5 min, washed, and then used in a CXCL12 or CXCL13 chemotaxis assay. The results are shown as a ratio of the CXCL12 desensitized to PBS exposed 100 times for either the wild-type or Rgs1–/– B cells.
Immunizations, ELISA, and enzyme-linked immunospot (ELISPOT) assay. Serum samples from 6- to 12-week-old animals were assayed for immunoglobulin isotype levels by a sandwich enzyme-linked immunosorbent assay (ELISA) protocol using mouse immunoglobulin standards, goat antibodies specific for mouse immunoglobulin and immunoglobulin isotypes (Southern Biotechnology), and the ABTS developing reagents (Kirkegaard & Perry Laboratories). Optical density was determined with a microplate reader set at 405 nm. Mice were immunized with trinitrophenol-keyhole limpet hemocyanin (TNP-KLH) with adjuvant (100 µg intraperitoneally) and were rechallenged at 14 and 70 days. Serum TNP-specific immunoglobulin levels were analyzed by ELISA. Briefly, 96-well ELISA plates (Nunc) were coated with TNP-OVA (Sigma) overnight at 4°C, washed, and blocked with 5% bovine serum albumin fraction V (Sigma). Serial dilutions of serum were then added to the plates and incubated 4 h at 4°C. After washing horseradish peroxidase-labeled goat anti-mouse immunoglobulin isotype antibodies were added for 2 h at room temperature. The developing reagents were the same as described above. Additional mice were immunized intraperitoneally using either 5 or 50 µg of NP-KLH absorbed to alum. Serum NP-specific immunoglobulin levels were measured as described above except the ELISA plates were coated with NP-bovine serum albumin.
Either OVA-specific IgG or total IgG and IgA antibody secreting cells were identified by conventional ELISPOT analysis. The ELISPOT protocol from BD Biosciences was followed. Briefly, various dilutions of single-cell suspensions prepared from bone marrow, spleen, blood, and lamina propria, from ovalbumin-absorbed to Alum or SRBC-immunized mice, were cultured overnight on nitrocellulose 96-well plates (Millipore) coated either with ova or goat-anti-mouse IgA or IgG (Southern Biotechnologies Inc.). The cells were removed and the captured immunoglobulins were detected with biotinylated goat anti-IgG or anti-IgA (Caltag Laboratories) followed by SA-HRP (BD Biosciences). The plates were developed with an AEC chromogenic substrate solution (BD Biosciences) and spots were enumerated manually using a dissecting microscope.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
A Northern blot analysis of Rgs1 expression had revealed an increase in B cells following in vivo activation by antigen, while anti-CD40 stimulation had no effect (38). We examined the expression of Rgs1 in various B- and T-cell subsets isolated from immune tissues by RT-PCR (Fig. 1A). We found a detectable signal in total bone marrow cells and weak signal in B220+ bone marrow cells. Within the B-cell subsets in the spleen Rgs1 expression predominated in the follicular B cells, with only a low signal detected in marginal zone and transitional B cells. B220+ B cells from mesenteric lymph nodes and purified cells from Peyer's patches also expressed Rgs1. Plasma cells isolated by cell sorting for B220 dim/IgG+/CD138++ cells 1 week following immunization with ovalbumin also expressed Rgs1. Among the T-cell subsets from the thymus and spleen, CD4+ cells expressed low amounts of Rgs1.
|
Generation of Rgs1–/– mice. We screened a murine ES cell genomic library with the Rgs1 cDNA and isolated a 15-kb NOT1 fragment that encompassed Rgs1. Located on mouse chromosome 1, Rgs1 spans approximately 5 kb and contains five exons, of which the last three contribute to the coding of the RGS domain (Fig. 1C). We produced Rgs1–/– mice by inserting a neomycin gene into the first exon of Rgs1, which contains the initiating ATG, thereby disrupting the first coding amino acid and the exon splice donor site. Southern blot analysis of wild type and DNA prepared from Rgs1–/– mice revealed the appropriate restriction pattern (data not shown). In addition, PCR primers designed to amplify different size products from the wild type and the mutated allele gave bands of the predicted size (Fig. 1D, top panel). Mice heterozygous for the Rgs1 mutation had no apparent abnormalities, and Rgs1–/– mice appeared in liters with the expected Mendelian frequencies. Immunoblotting B-cell lysates from wild-type and Rgs1–/– mice that had been previously immunized or not for RGS1 expression revealed low levels of RGS1 in unimmunized B cells that increased following immunization and as expected an absence of RGS1 in the Rgs1–/– B cells (Fig. 1D, bottom panel). Because Rgs1 is located in a cluster of Rgs genes on chromosome 1 (40) we checked whether the Rgs1 mutation significantly altered the expression of two genes in the cluster that have lymphoid expression, Rgs2 and Rgs13. In addition, we checked two Rgs genes not present in the Rgs1 cluster, Rgs10 and Rgs16, but which also appear in lymphocytes (2). The Rgs1–/– mice lacked Rgs1 expression in B cells isolated from immunized spleens or in unfractionated cells isolated from their Peyer's patches, while their B cells expressed nearly similar levels of Rgs2, Rgs10, Rgs13, and Rgs16 as those from control mice (Fig. 1E). The slight increase in Rgs13 expression may be secondary to increased germinal center formation in the lymphoid tissues of the Rgs1–/– mice (see below). Thus, the targeting of Rgs1 did not appear to significantly alter the expression of clustered or related genes.
The development of lymphoid tissues, including spleen, thymus, mesenteric lymph nodes, and Peyer's patches, in the Rgs1–/– mice appeared relatively normal, although occasionally we noted a reduction in the expected sizes of the inguinal and popliteal lymph nodes (data not shown). Flow cytometric analysis of lymph node cells, splenocytes, thymocytes, and bone marrow cells revealed a minimal increase in the number of B220 cell in the bone marrow, a normal distribution of CD4 and CD8 expression on thymocytes, and no significant alteration in the B/T ratio among splenocytes, lymph node cells, or Peyer's patch cells. Of the B-cell subsets in the spleen we noted an increase in the number of cells with a marginal zone phenotype in Rgs1–/– B cells compared to control mice (Table 1). However, we did not detect an obvious expansion of the marginal zone on spleen sections.
|
|
Next, we checked the effect of Rgs1 deficiency on the migratory response to a secondary chemokine challenge. We exposed B cells to CXCL12, washed the cells, and measured subsequent migratory responses to CXCL12 or CXCL13. The wild-type cells exhibited both a homologous, reduced response to a rechallenge with CXCL12 and heterologous desensitization, a reduced response to rechallenge with CXCL13. The Rgs1–/– B cells exhibited a decreased ability to desensitize following a rechallenge with CXCL12 or CXCL13 (Fig. 2D).
The spleen and Peyer's patches in Rgs1–/– mice. Because the spleen sections prepared from Rgs1–/– mice, but not from wild-type mice, had a significant number of germinal centers even the absence of immunization, we examined the kinetics of germinal center development in these mice following immunization with SRBC. We estimated the number of germinal centers by determining the density of PNA+ B220+ clusters in timed tissue sections (clusters were defined as containing greater than 25 PNA+ B220+ cells). Germinal centers appeared more rapidly, reached a higher density, and resolved more slowly in the spleens from the Rgs1–/– mice compared to controls (Fig. 3A and B). At day 30 postimmunization, wild-type spleens had resolved their germinal center reaction while Rgs1–/– spleens still had approximately half their peak number. Following immunization the Rgs1–/– spleens lost the normal sharp delineation between their B and T zones and had oddly shaped periarterial lymphatic sheaths (Fig. 3C).
|
|
|
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Besides RGS proteins, mammalian cells use other mechanisms to desensitize signaling through G-protein-coupled receptors, including receptor uncoupling, G-protein degradation, and receptor sequestration. However, the failure of the Rgs1–/– B-cell CXCR4 and CXCR5 receptors to undergo rapid homologous desensitization unveiled the importance of the RGS mechanism in these cells. Previous results obtained by expressing mutant G subunits insensitive to RGS proteins in pertussis-toxin-treated cells (36), blocking endogenous RGS proteins with specific antibodies (8), reducing endogenous RGS mRNAs with ribozyme technology (43), and analyzing opioid antinociception in Rgs9–/– mice (14) have implicated RGS proteins in the desensitization of other G-protein linked signaling pathways. While additional studies examining other RGS proteins and different G-protein-coupled receptor-linked signaling pathways will be required to understand the relative importance of the various desensitization mechanisms, the data reported here suggest that RGS proteins have a prominent role in the desensitization of chemokine receptor signaling. Furthermore, the involvement of Rgs1 in the rapid desensitization that occurs following chemokine exposure of wild-type B cells suggests that the initial G-protein signaling shifts RGS1 from an inactive to an active state. This may involve the translocation of RGS1 from a cytosolic pool to the cell membrane as G-protein signaling causes several other RGS proteins to similarly translocate via a process that depends upon their N termini (9, 41). Alternatively, RGS proteins may be recruited into lipid rafts where chemokine receptors and G subunits likely reside (31).
Besides their role in desensitization, the level of an RGS protein within a cell can set a response threshold. Consistently, a higher percentage of the Rgs1–/– B cells migrated to CXC12 than did the control cells, suggesting that unstimulated normal splenic B cells express sufficient amounts of RGS1 to alter the threshold at which a response occurs. The in situ demonstration of the presence of RGS proteins has proven difficult, perhaps because high levels of these proteins in cells grossly impairs signaling through multiple G-protein-linked signaling pathways, a situation most cells generally avoid. Yet RGS1 levels can be substantially raised in B cells, and the most pronounced disarrangements in lymphoid architecture occurred following immunization, which normally elevates B-cell Rgs1 expression levels. The levels of RGS1 in B cells may act as an intracellular rheostat controlling both the magnitude of a G-protein-coupled receptor-triggered response as well as the response threshold.
How do the signaling data explain the phenotypes observed in the Rgs1–/– mice, in particular: (i) the early and excessive germinal center formation following immunization; (ii) the abnormal splenic architecture, which is accentuated following immunization; and (iii) the shrinkage of Peyer's patches and improper trafficking of ASCs. The first phenotypic abnormality suggests an enhanced recruitment of B cells into the nascent germinal centers in the Rgs1–/– mice. The rapid induction of Rgs1 following engagement of the antigen receptor in wild-type mice may normally temper premature recruitment of B cells into germinal centers. This may have two functions: (i) to promote the extrafollicular generation of plasma cells and (ii) to limit the number of B cells seeding individual germinal centers. Based on the known elevated expression of Rgs1 in germinal center B cells and their known refractoriness to chemoattractants, we had expected that Rgs1 might function to promote the retention of germinal center B cells in developing germinal centers and that the lack of Rgs1 would lead to short-lived germinal centers in which cells exited prematurely. Without following the kinetics of individual germinal center formation, we cannot fully exclude this scenario; however, the observed Rgs1–/– phenotype of excessive and persistent germinal centers did not support this idea. One explanation may be that germinal center B cells not only express Rgs1, but they also prominently express Rgs13 (39). Thus, the lack of Rgs1 may be compensated for by the presence of Rgs13. Studies of Rgs13–/– mice and mice lacking both Rgs1 and Rgs13 should provide additional insights into germinal B cells trafficking and function.
The loss of the normal sharp delineation between the B- and T-cell zones and misshapen lymphoid follicles, which immunization exaggerated, suggests an interference with the normal directed movement of these cells that occurs during an immune response. This may result, as suggested above, from an inability to properly navigate through a series of chemokine gradients. Both the follicular dendritic cell and stromal cell networks appear intact in the Rgs1–/– mice, making the impairment in the production of homing chemokines by Rgs1–/– stromal cells an unlikely explanation (CXCL12, CXCL13, and CD11c immunohistochemical staining in the wild-type and Rgs1–/– mice appeared similar [C. Moratz, unpublished observation]). Imaging of normal and genetically modified B cells migrating in response to complex chemokine gradients should provide further insights into the role of RGS1 and other RGS proteins in B lymphocyte chemotaxis.
The partial collapse of the Peyer's patches and abnormal trafficking of ASCs in the Rgs1–/– mice are likely related. At 1 and 2 weeks following immunization there is a substantial reduction in the size of the Peyer's patches and reduced numbers of ASCs in the spleen, bone marrow, and lamina propria, while the numbers of ASCs in the blood are elevated compared to wild-type mice. Consistent with the spleen ELISPOT data we also observed a reduced number of IgG-positive cells in the bridging channels of the spleen at similar time points, which may account for the lag in the production of IgG noted following immunization. The reduced numbers of ASCs in the spleen of the Rgs1–/– mice could be accounted for by either a decreased generation of ASCs or a failure to retain produced cells. Based on the rapid exit of cells from Peyer's patches, the latter seems more likely. The increase of IgG ASCs in the spleen at 1 month may reflect the continued presence of germinal centers in the spleen, which leads to a prolonged generation of ASCs compared to that seen in wild-type mice, where the germinal center response has largely subsided. The heightened number of ASCs in the blood and reduced numbers of ASCs in the bone marrow and lamina propria reflects either the failure of Rgs1–/– ASCs to normally enter the bone marrow and lamina propria or, alternatively, a failure of the cells to be normally retained in the end organs. The former seems less likely since Rgs1–/– B cells are hyperresponsive to chemokines, while the latter provides a coherent explanation consistent with the known roles of RGS proteins.
CXCL12 promotes the lodgment of IgG-ASCs in the bone marrow (16), while CCL28 promotes the homing of IgA-ASCs to the lamina propria (24). Arguing for the importance of CXCL12 signaling in the localization of IgG-ASCs, CXCR4-deficient ASCs are mislocalized in the spleen, found at increased levels in the blood, and fail to normally accumulate in the bone marrow (16). However, despite their continued CXCR4 expression, IgG-ASCs lose their responsiveness to CXCL12 after lodging in the bone marrow. Between day 6 and day 12 following a secondary immunization with OVA, the percentage of IgG ASCs responsive to CXCL12 in a transwell assay fell from 65% to less than 5% (17). Thus, there is dissociation between CXCR4 expression and CXCL12 responsiveness as is the case with germinal center B cells and with B-cell lines overexpressing RGS1 (33). RGS proteins such as RGS1 may serve as stop signals for migrating cells. While the upregulation of an RGS protein would cause a loss of responsiveness to the localizing chemokine, i.e., the loss of CXCL12 sensitivity of IgG-ASCs, responsiveness to any competing chemoattractants would be lost as well. Whether recent IgA-ASC emigrants into the lamina propria also lose their responsiveness to localizing chemokines is unknown, although the failure of Rgs1–/– IgA-ASCs to normally populate the lamina propria following immunization argues that a similar phenomenon occurs.
In conclusion, the development of Rgs1–/– mice has revealed an important role for RGS1 in B lymphocytes in the desensitization of signaling through the CXCR4 and CXCR5 receptors, thereby implicating RGS proteins as major regulators of chemokine signaling in B cells and perhaps other immune cell types. The enhanced chemotaxis and exaggerated calcium responses to chemokines observed with unstimulated Rgs1–/– B cells indicate that the relatively low level of RGS1 present in nonstimulated normal B cells alters chemokine receptor signaling. Finally, the abnormalities in chemokine signaling likely directly relate to the exaggerated germinal center response and the disruption of architectures of the spleen and Peyer's patches noted following immunization.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
C.M. and J.R.H. contributed equally to this work.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Beadling, C., K. M. Druey, G. Richter, J. H. Kehrl, and K. A. Smith. 1999. Regulators of G protein signaling exhibit distinct patterns of gene expression and target G protein specificity in human lymphocytes. J. Immunol. 162:2677-2682.
3. Berman, D. M., T. M. Wilkie, and A. G. Gilman. 1996. GAIP and RGS4 are GTPase-activating proteins for the Gi subfamily of G protein alpha subunits. Cell 86:445-452.[CrossRef][Medline]
4. Bowman, E. P., J. J. Campbell, K. M. Druey, A. Scheschonka, J. H. Kehrl, and E. C. Butcher. 1998. Regulation of chemotactic and proadhesive responses to chemoattractant receptors by RGS (regulator of G-protein signaling) family members. J. Biol. Chem. 273:28040-28048.
5. Campbell, J. J., and E. C. Butcher. 2000. Chemokines in tissue-specific and microenvironment-specific lymphocyte homing. Curr. Opin. Immunol. 12:336-341.[CrossRef][Medline]
6. De Vries, L., M. Mousli, A. Wurmser, and M. G. Farquhar. 1995. GAIP, a protein that specifically interacts with the trimeric G protein G alpha i3, is a member of a protein family with a highly conserved core domain. Proc. Natl. Acad. Sci. USA 92:11916-11920.
7. Dietzel, C., and J. Kurjan. 1987. Pheromonal regulation and sequence of the Saccharomyces cerevisiae SST2 gene: a model for desensitization to pheromone. Mol. Cell. Biol. 7:4169-4177.
8. Diverse-Pierluissi, M. A., T. Fischer, J. D. Jordan, M. Schiff, D. F. Ortiz, M. G. Farquhar, and L. De Vries. 1999. Regulators of G protein signaling proteins as determinants of the rate of desensitization of presynaptic calcium channels. J. Biol. Chem. 274:14490-14494.
9. Druey, K. M., K. J. Blumer, V. H. Kang, and J. H. Kehrl. 1996. Inhibition of G-protein-mediated MAP kinase activation by a new mammalian gene family. Nature 379:742-746.[CrossRef][Medline]
10. El-Sawy, T., N. M. Fahmy, and R. L. Fairchild. 2002. Chemokines: directing leukocyte infiltration into allografts. Curr. Opin. Immunol. 14:562-568.[CrossRef][Medline]
11. Forster, R., A. E. Mattis, E. Kremmer, E. Wolf, G. Brem, and M. Lipp. 1996. A putative chemokine receptor, BLR1, directs B cell migration to defined lymphoid organs and specific anatomic compartments of the spleen. Cell 87:1037-1047.[CrossRef][Medline]
12. Forster, R., L. Ohl, and G. Henning. 2001. Lessons learned from lymphocytes: CC Chemokine receptor-7 involved in lymphogenic metastasis of melanoma. J. Natl. Cancer Inst. 93:1588-1589.
13. Foxman, E. F., J. J. Campbell, and E. C. Butcher. 1997. Multistep navigation and the combinatorial control of leukocyte chemotaxis. J. Cell Biol. 139:1349-1360.
14. Garzon, J., M. Rodriguez-Diaz, A. Lopez-Fando, and P. Sanchez-Blazquez. 2001. RGS9 proteins facilitate acute tolerance to mu-opioid effects. Eur. J. Neurosci. 13:801-811.[CrossRef][Medline]
15. Gunn, M. D., V. N. Ngo, K. M. Ansel, E. H. Ekland, J. G. Cyster, and L. T. Williams. 1998. A B-cell-homing chemokine made in lymphoid follicles activates Burkitt's lymphoma receptor-1. Nature 391:799-803.[CrossRef][Medline]
16. Hargreaves, D. C., P. L. Hyman, T. T. Lu, V. N. Ngo, A. Bidgol, G. Suzuki, Y. R. Zou, D. R. Littman, and J. G. Cyster. 2001. A coordinated change in chemokine responsiveness guides plasma cell movements. J. Exp. Med. 194:45-56.
17. Hauser, A. E., G. F. Debes, S. Arce, G. Cassese, A. Hamann, A. Radbruch, and R. A. Manz. 2002. Chemotactic responsiveness toward ligands for CXCR3 and CXCR4 is regulated on plasma blasts during the time course of a memory immune response. J. Immunol. 160: 1277-1282.
18. Hepler, J. R., and A. G. Gilman. 1992. G proteins. Trends Biochem. Sci. 17:383-387.
19. Hunt, T. W., T. A. Fields, P. J. Casey, and E. G. Peralta. 1996. RGS10 is a selective activator of G alpha i GTPase activity. Nature 383:175-177.[CrossRef][Medline]
20. Kehrl, J. H. 1998. Heterotrimeric G protein signaling: roles in immune function and fine-tuning by RGS proteins. Immunity 8:1-10.[CrossRef][Medline]
21. Koelle, M. R., and H. R. Horvitz. 1996. EGL-10 regulates G protein signaling in the C. elegans nervous system and shares a conserved domain with many mammalian proteins. Cell 84:115-125.[CrossRef][Medline]
22. Kosco-Vilbois, M. H., J. Y. Bonnefoy, and Y. Chvatchko. 1997. The physiology of murine germinal center reactions. Immunol. Rev. 156:127-136.[CrossRef][Medline]
23. Kunkel, E. J., and E. C. Butcher. 2002. Homeostatic chemokines and the targeting of regional immunity. Adv. Exp. Med. Biol. 512:65-72.[Medline]
24. Kunkel, E. J., C. H. Kim, N. H. Lazarus, M. A. Vierra, D. Soler, E. P. Bowman, and E. C. Butcher. 2003. CCR10 expression is a common feature of circulating and mucosal epithelial tissues IgA Ab-secreting cells. J. Clin. Investig. 111:1001-1010.[CrossRef][Medline]
25. Lee, B. N., and T. H. Adams. 1994. Overexpression of flbA, an early regulator of Aspergillus asexual sporulation, leads to activation of brlA and premature initiation of development. Mol. Microbiol. 14:323-334.[Medline]
26. Legler, D. F., M. Loetscher, R. S. Roos, I. Clark-Lewis, M. Baggiolini, and B. Moser. 1998. B cell-attracting chemokine 1, a human CXC chemokine expressed in lymphoid tissues, selectively attracts B lymphocytes via BLR1/CXCR5. J. Exp. Med. 187:655-660.
27. Liu, Y. J., and C. Arpin. 1997. Germinal center development. Immunol. Rev. 156:111-126.[CrossRef][Medline]
28. Lombardi, M. S., A. Kavelaars, and C. J. Heijnen. 2002. Role and modulation of G protein-coupled receptor signaling in inflammatory processes. Crit. Rev. Immunol. 22:141-163.[Medline]
29. Luster, A. D. 2002. The role of chemokines in linking innate and adaptive immunity. Curr. Opin. Immunol. 14:129-135.[CrossRef][Medline]
30. MacLennan, I. C., A. Gulbranson-Judge, K. M. Toellner, M. Casamayor-Palleja, E. Chan, D. M. Sze, S. A. Luther, and H. A. Orbea. 1997. The changing preference of T and B cells for partners as T-dependent antibody responses develop. Immunol. Rev. 156:53-66.[CrossRef][Medline]
31. Manes, S., R. Ana Lacalle, C. Gomez-Mouton, and C. Martinez-A. 2003. From rafts to crafts: membrane asymmetry in moving cells. Trends Immunol. 24:320-326.[Medline]
32. Melchers, F., A. G. Rolink, and C. Schaniel. 1999. The role of chemokines in regulating cell migration during humoral immune responses. Cell 12:351-354.
33. Moratz, C., V. H. Kang, K. M. Druey, C. S. Shi, A. Scheschonka, P. M. Murphy, T. Kozasa, and J. H. Kehrl. 2000. Regulator of G protein signaling 1 (RGS1) markedly impairs Gi alpha signaling responses of B lymphocytes. J. Immunol. 164:1829-1838.
34. Nagasawa, T., S. Hirota, K. Tachibana, N. Takakura, S. Nishikawa, Y. Kitamura, N. Yoshida, H. Kikutani, and T. Kishimoto. 1996. Defects of B-cell lymphopoiesis and bone-marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-1. Nature 382:635-638.[CrossRef][Medline]
35. Neer, E. J. 1995. Heterotrimeric G proteins: organizers of transmembrane signals. Cell 80:249-257.[CrossRef][Medline]
36. Potenza, M. N., S. J. Gold, A. Roby-Shemkowitz, M. R. Lerner, and E. J. Nestler. 1999. Effects of regulators of G protein-signaling proteins on the functional response of the mu-opioid receptor in a melanophore-based assay. J. Pharmacol. Exp. Ther. 291:482-491.
37. Proudfoot, A. E. 2002. Chemokine receptors: multifaceted therapeutic targets. Nat. Rev. Immunol. 2:106-115.[CrossRef][Medline]
38. Reif, K., and J. G. Cyster. 2000. RGS molecule expression in murine B lymphocytes and ability to down-regulate chemotaxis to lymphoid chemokines. J. Immunol. 164:4720-4729.
39. Shi, G.-X., K. Harrison, G. L. Wilson, C. Moratz, and J. H. Kehrl. 2002. RGS13 regulates germinal center B-lymphocytes responsiveness to CXCL12 and CXCL13. J. Immunol. 169:2507-2515.
40. Sierra, D. A., D. J. Gilbert, D. Householder, N. V. Grishin, K. Yu, P. Ukidwe, S. A. Barker, W. He, T. G. Wensel, G. Otero, G. Brown, N. G. Copeland, N. A. Jenkins, and T. M. Wilkie. 2002. Evolution of the regulators of G-protein signaling multigene family in mouse and human. Genomics 79:177-185.[CrossRef][Medline]
41. Srinivasa, S. P., L. S. Bernstein, K. J. Blumer, and M. E. Linder. 1998. Plasma membrane localization is required for RGS4 function in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 95:5584-5589.
42. Tarlinton, D. 1998. Germinal centers: form and function. Curr. Opin. Immunol. 10:245-251.[CrossRef][Medline]
43. Wang, Q., M. Liu, B. Mullah, D. P. Siderovski, and R. R. Neubig. 2002. Receptor-selective effects of endogenous RGS3 and RGS5 to regulate mitogen-activated protein kinase activation in rat vascular smooth muscle cells. J. Biol. Chem. 277:24949-24958.
44. Watson, N., M. E. Linder, K. M. Druey, J. H. Kehrl, and K. J. Blumer. 1996. RGS family members: GTPase-activating proteins for heterotrimeric G-protein alpha-subunits. Nature 383:172-175.[CrossRef][Medline]
45. Wehrli, N., D. F. Legler, D. Finke, K. M. Toellner, P. Loetscher, M. Baggiolini, I. C. MacLennan, and H. Acha-Orbea. 2001. Changing responsiveness to chemokines allows medullary plasmablasts to leave lymph nodes. Eur. J. Immunol. 31:609-616.[CrossRef][Medline]
46. Zou, Y. R., A. H. Kottmann, M. Kuroda, I. Taniuchi, and D. R. Littman. 1998. Function of the chemokine receptor CXCR4 in haematopoiesis and in cerebellar development. Nature 393:595-599.[CrossRef][Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. |
|---|
