Previous Article | Next Article ![]()
Molecular and Cellular Biology, July 2004, p. 6084-6093, Vol. 24, No. 13
0270-7306/04/$08.00+0 DOI: 10.1128/MCB.24.13.6084-6093.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Department of Molecular Genetics and Microbiology, University of Massachusetts Medical School, Worcester, Massachusetts 01655,1 Life Sciences Division, Lawrence Berkeley National Laboratory, University of California, Berkeley, Berkeley, California 947202
Received 2 February 2004/ Returned for modification 27 February 2004/ Accepted 5 April 2004
|
|
|---|
mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show that XPG recruits PC4 to a bubble-containing DNA substrate with a resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate. |
|
|---|
Oxidative DNA damage results from the interaction of reactive oxygen species (ROS) with DNA. ROS are produced as by-products of normal aerobic metabolism and by exogenous factors, such as ionizing radiation and chemical oxidants (6, 12, 35, 36). The deleterious consequences of ROS to an organism's genetic material are held in check by proteins that prevent or repair oxidative DNA damage (7, 12, 13, 15, 21). Unrepaired oxidative lesions result in increased mutagenesis, lethality, and apoptosis (23, 27). A balance between DNA repair and damage prevention mechanisms and ROS production is required to maintain a low spontaneous mutation rate. Factors that increase ROS production, reduce ROS detoxification, or factors that affect repair of oxidative DNA lesions result in increased mutagenesis. This is best demonstrated in Escherichia coli; mutations that inactivate the fpg and mutY genes, whose products repair the predominant oxidative lesion 8-oxoguanine (8-oxoG) and its mispaired intermediate 8-oxoG:A, respectively, result in a mutator phenotype that specifically increases GC
TA transversion mutagenesis (37).
In this study, we screened a human cDNA library and describe the isolation and characterization of the human transcription positive cofactor 4 (PC4) gene as a suppressor of oxidative mutagenesis in the E. coli fpg mutY strain. We demonstrate that PC4 and its Saccharomyces cerevisiae ortholog SUB1 are required for resistance to hydrogen peroxide and function to prevent spontaneous and induced oxidative mutagenesis. The oxidation resistance function of PC4 requires its single-strand DNA (ssDNA) binding activity, which is not required for the transcription coactivator function of PC4 (56, 57). A function of PC4 in repair of oxidative DNA damage is suggested by its physical and biochemical interactions with the multifunctional human DNA repair protein XPG, the structure-specific endonuclease activity of which is essential for nucleotide excision repair (NER) but which also plays important nonenzymatic roles in base excision repair (BER) and transcription-coupled repair (TCR) of oxidative damage (52a).
|
|
|---|
fpg::Tn10), MV4707 (cc104
mutY::Catr), and MV4709 (cc104
fpg::Tn10
mutY::Catr) were constructed by P1 transduction selecting for the appropriate antibiotic resistance marker. Bacterial mutagenesis assays. The papillation assay medium (39) contains 0.2% D-glucose, 1x A salts, 1 mM MgSO4, 5 µg of thiamine hydrochloride/ml, 0.5 mM IPTG (isopropyl-ß-D-thiogalactopyranoside), 40 µg of X-Gal (5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside)/ml, 0.5 mg of phenyl-ß-D-galactopyranoside (P-Gal)/ml, 50 µg of carbenicillin/ml, and 2% agar. For pBAD24 induction, 0.2% L-arabinose (20) was added and the glucose concentration was reduced to 0.05%. Papillation was scored 5 to 6 days after plating. Spontaneous mutation frequencies (revertants/total cells) were quantitated by plating dilutions of the overnight cultures of individual transformants on lactose and glucose minimal media and incubating 3 days at 37°C. LacZ revertants were detected on lactose plates, total colonies on glucose plates.
Construction of Fpg, hOGG1, and hMYH expression vectors.
To overexpress the E. coli Fpg protein, a 1-kbp EcoRI/HindIII fragment from V243 (39) was subcloned into pTrc 99A (Pharmacia, Inc.) (pTrc-Fpg). To construct pTrc-hOGG1, a 5.7-kbp XbaI/HindIII fragment from pET8c-OGG1-1a (42) (Y. Nakabeppu, Kyushu University, Fukuoka, Japan) was subcloned into pTrc 99A. To construct pTrc-hMYH, a 4.5-kbp StuI/BamHI fragment from pT7blue-hMYH
3-2 (43) (Y. Nakabeppu, Kyushu University) was subcloned into SmaI/BamHI-linearized pTrc 99A.
Construction of wild-type and mutant PC4 expression vectors. Plasmids carrying the full-length coding sequences of the wild type (PC4-wt) or the ssDNA binding-defective mutants (PC4-W89A and PC4-ß2ß3) (57) were obtained from M. Meisterernst (Munich, Germany). The full-length PC4 wild-type and mutant protein coding sequences were isolated as NdeI and EcoRI fragments and subcloned into the corresponding sites in pET-28b(+) to attach the six-histidine tag to their amino termini. The insert containing NcoI and SalI fragments from the pET-28(+) derivatives were subcloned into the corresponding sites of pBAD24 for araBAD promoter-dependent expression. Expression of the six-histidine-tagged PC4 proteins was verified by Western blotting using the anti-Penta His antibody (QIAGEN).
Construction of yeast strains and expression vectors.
The S. cerevisiae wild-type strain FY833 (MATa his3
200 leu2
1 lys2
202 trp1
63 ura3-52) and the sub1
mutant strain YMH476 (FY833 sub1
::hisG) (59) were obtained from M. Hampsey (Rutgers University). Additional sub1
mutants were constructed by PCR-mediated one-step gene replacement methods (8). Cells were cultured either in YPD (1% yeast extract, 2% peptone, 2% dextrose) or, for plasmid-bearing strains, in synthetic complete medium lacking leucine or uracil (SC-leu or SC-ura). To express PC4 in yeast strains, the coding sequence for amino acids (aa) 40 to 127 was amplified by PCR using the PC4 cDNA clone initially isolated from the genetic screen as the template with primers PC4-N (ACGCGTCGACATGCAAAAGACAGGTGAGACTTCGAGAGCTCTG) and PC4-C (CCGCTCGAGTCATCTTACAAATTCCTCTGC). The ATG initiation codon shown in boldface along with the italicized sequences for SalI and XhoI restriction sites were added for protein expression and cloning purposes. The SalI- and XhoI-treated PCR product was inserted into pMV611, which carries the LEU2 gene from pRS315 (49) and the GPD promoter from p426-GPD (41). To express the Sub1 protein, the SUB1 open reading frame was amplified from the FY833 genomic DNA by PCR using primers X001-SUB1f (GCTCTAGATGTCATATTACAACAGGTATAGG) and E292-SUB1r (GCGAATTCTTATTCTTCTTCACTTATGTCG). The italicized sequences for XbaI and EcoRI restriction sites were introduced to the ends of the PCR product for cloning into p416-GPD, which carries the URA3 gene for selection (41). MVY219 (rad2
::TRP1) and MVY221 (sub1
rad2
::TRP1) RAD2 deletion strains were constructed by transforming FY833 (wt) and YMH476 (sub1
) with SalI-digested pWS521 (W. Siede, University of North Texas Health Science Center).
H2O2 sensitivity and induced mutagenesis. Yeast strains were grown to mid-log phase at 30°C, washed, and resuspended in phosphate-buffered saline. Cells were then treated with H2O2 by shaking at 30°C for 1 h as indicated. Cells were harvested by centrifugation, washed, resuspended in sterile deionized H2O, diluted, and plated on YPD for survival analysis of non-plasmid-bearing strains or SC-leu or SC-ura for plasmid-bearing strains. Survival experiments were repeated from 3 to 10 times, and representative data indicating the reproducible differences between strains are shown. To measure the can1r mutagenesis, cells were plated on synthetic medium lacking arginine but containing 60 µg of canavanine/ml and incubated at 30°C for 3 to 4 days for survival and 4 to 5 days for mutagenesis.
UV and MMS sensitivity tests.
Yeast strains were grown to mid-log phase at 30°C, washed with water, suspended in phosphate-buffered saline, incubated with the indicated concentrations of methyl methanesulfonate (MMS; Sigma Chemical) for 1 h at 30°C, diluted, and plated on YPD plates. Surviving colonies were counted after 3 to 4 days of incubation at 30°C. For UV dose response tests, approximately 1,000 log-phase cells were placed in each spot on YPD plates. Spots were irradiated with UV (
= 254 nm) in 30-J/m2 increments using a Stratalinker UV Crosslinker (Stratagene). Plates were then incubated in the dark at 30°C for 3 to 4 days.
Expression and purification of PC4 and XPG. Full-length wild-type PC4 was expressed in the E. coli BL21(DE3) strain and purified according to the methods of Ge et al. (18). The cDNA for human XPG (a generous gift from Stuart Clarkson) was inserted into a pFASTBAC vector, expressed in High5 insect cells, and purified to 95% homogeneity essentially as described previously (16). For use only in the far-Western assays, a heart muscle kinase (HMK) recognition sequence tag, RRASV, was added at the C terminus.
Protein-protein interaction assays. For far-Western analysis, human PC4 protein (1.5 µg), human Nth1 protein (2.1 µg), and E. coli EndoIII (3 µg) were separated on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (precast 4 to 20% gel; Bio-Rad), transferred to a polyvinylidene difluoride membrane, and stained with Ponceau S to visualize the proteins on the membrane. The membrane was then blocked with a blocking buffer (25 mM HEPES-KOH [pH 7.7], 25 mM NaCl, 5 mM MgCl2, 1 mM dithiothreitol [DTT], 1% nonfat milk, 0.1% NP-40) for 2 h at 4°C and probed overnight at 4°C on a rocker with blocking buffer containing 150 mM KCl and 32P-labeled XPG with a HMK tag. The membrane was washed with washing buffer (25 mM HEPES-KOH [pH 7.7], 25 mM NaCl, 150 mM KCl, 5 mM MgCl2, 1 mM DTT, 1% nonfat milk, 0.5% NP-40), and interactions were visualized by both phosphorimager and autoradiography. For slot blot analysis, 1 µg each of PC4, hNth1, and EndoIII was applied to a nitrocellulose membrane, and the membrane was processed as described above.
Electrophoretic mobility shift assay. The sequences of the oligonucleotides used to form the bubble DNA substrate for the electrophoretic mobility shift assay were as follows (with the central unpaired region of the substrates in bold): 10T-strand, 5'-GGGCAGACAACGTGGCGCTGTTTTTTTTTTGTGTCCTAGCACAGCGTATG-3'; and 10C-strand, 5'-CATACGCTGTGCTAGGACACCCCCCCCCCCCAGCGCCACGTTGTCTGCCC-3'.
The 10T-strand was 5'-end labeled with T4 polynucleotide kinase and [
-32P]ATP and annealed with the complementary 10C-strand by heating for 3 min at 90°C and cooling to room temperature. The resulting DNA bubble substrate was gel purified. Fifty femtomoles of 32P-labeled bubble DNA was incubated at room temperature with XPG, PC4, or both for 20 min in a 20-µl reaction mixture containing 10 mM HEPES-KOH (pH 7.5), 110 mM KCl, 1 mM EDTA, 1 mM DTT, 4% glycerol, and 0.2 µg of poly(dI · C-dI · C). After the incubation, the samples were loaded on a 4.5% nondenaturing polyacrylamide gel (19:1, acrylamide to bisacrylamide). Electrophoresis was performed under refrigeration at 150 V for 2 h in 0.5x Tris-borate-EDTA buffers. The gels were analyzed by phosphorimager and ImageQuant software (Molecular Dynamics).
|
|
|---|
TA transversion mutations (37, 38, 40). Production of ROS by normal metabolic processes leads to accumulation of 8-oxoG lesions in DNA and results in elevated spontaneous mutagenesis (37). The GC
TA transversions are detected using the cc104 allele of lacZ, which reverts only by GC
TA transversion (14). On indicator medium, E. coli cells carrying lacZ(cc104) produce distinctive white LacZ colonies containing dark blue LacZ+ revertant microcolonies, or papillae (Fig. 1) (37). Figure 1 compares the mutator phenotype of the fpg mutY double mutant strain (Fig. 1B) with that of wild-type E. coli (Fig. 1A) and shows the suppression of mutagenesis resulting from the expression of E. coli and human DNA repair genes. Complete suppression of the fpg mutY strain's mutator phenotype is seen upon high-level expression of the bacterial fpg gene (Fig. 1C), reducing the frequency of transversions to levels below that seen in the wild type (Fig. 1A). Since most of the transversion mutations seen in the wild-type strain can also be prevented by fpg overexpression (60), GC
TA transversions can be considered a signature of oxidative DNA damage. Suppression of the fpg mutY mutator phenotype is also seen upon expression of the human 8-oxoG glycosylase, OGG1 (Fig. 1D), or the human MutY ortholog, MYH (Fig. 1E) (1, 3, 43, 46, 48, 50).
![]() View larger version (104K): [in a new window] |
FIG. 1. Mutator phenotype of E. coli fpg mutY and its suppression by bacterial and human DNA repair genes. Upper panels show the phenotype of (A) wild-type E. coli cc104 carrying the GC TA transversion-specific allele of lacZ and (B) its isogenic fpg mutY double mutant derivative. The antimutator activity resulting from (C) expression of bacterial fpg protein (E. coli fpg mutY/pfpg), (D) expression of the human 8-oxoG DNA glycosylase OGG1 (E. coli fpg mutY/phOGG1), (E) expression of the human MutY ortholog hMYH (E. coli fpg mutY/phMYH), and (F) expression of the truncated form of PC4 isolated in this study (E. coli fpg mutY/pSE380-PC4).
|
|
View this table: [in a new window] |
TABLE 1. Mutation frequency of fpg mutY strains expressing bacterial and human DNA repair genes
|
![]() View larger version (13K): [in a new window] |
FIG. 2. Structure of PC4 and its derivatives. The upper panel shows the domains of wild-type PC4. The protein region designated aa 22 to 87 is the minimal coactivator clone described by Kaiser et al. (28), and it is shown for comparison. The initial PC4 clone is the form of PC4 initially isolated in our screen. The white amino-terminal box indicates the in-frame vector sequence fused to the 40 to 127 aa region of PC4. The PC4-CTD expressed in yeast was constructed by adding an ATG codon 5' to sequences encoding PC4 aa residues 40 through 127. The S. cerevisiae SUB1 gene is also shown, the boxes containing the dotted lines (not to scale) depict the heterologous 39-aa amino-terminal and 187-aa carboxyl-terminal domains of unknown function.
|
![]() View larger version (60K): [in a new window] |
FIG. 3. ssDNA binding activity of PC4 is required for mutation suppression in E. coli fpg mutY. Histidine-tagged forms of PC4 and its ssDNA binding-defective mutants W89A and ß2ß3 are expressed from the L-arabinose-inducible araBAD promoter present on the pBAD24 vector. (A) Upper panels show the mutator activity in the absence of L-arabinose, lower panels show the mutator activity of wild-type and mutant forms of PC4 after induction by L-arabinose. (B) Left section shows the Western blotting using antihistidine antibody to determine levels of wild-type (WT) and mutant protein expression; the right section shows the same gel stained with Coomassie brilliant blue.
|
Yeast sub1
mutants are hypersensitive to hydrogen peroxide.
To determine if PC4 functions to prevent oxidative mutagenesis in eukaryotes, we turned to yeast genetics. Sequence analysis reveals that PC4 orthologs exist in all sequenced eukaryotic genomes and that the most conserved region is the C-terminal ssDNA binding and dimerization domains. The S. cerevisiae PC4 ortholog, termed Sub1 (31) or Tsp1 (22), shows 48% identity and 58% similarity when compared with the C-terminal region (aa residues 63 to 127) of PC4 (2). Like its human ortholog, Sub1 is involved in various aspects of transcription but is not essential for viability (11, 22, 31, 59).
To determine if Sub1 plays a role in oxidation resistance, we tested yeast sub1
mutants for phenotypes associated with oxidative stress, DNA damage, or repair. Figure 4A shows that the yeast sub1
mutant (59) obtained from M. Hampsey (Rutgers University) is extremely hypersensitive to hydrogen peroxide compared to its wild-type parent. To confirm this, we disrupted the SUB1 gene in two other laboratory strains, W303-1B (lab strain) and RDKY3023 (R. Kolodner, University of California, San Diego), and found similar degrees of sensitization (data not shown). Reintroduction of the wild-type SUB1 gene on the p416-GPD yeast expression vector (41) fully restores peroxide resistance to the sub1
mutant, demonstrating that the observed peroxide sensitivity is solely due to the sub1
mutation (Fig. 4A). In contrast, the sub1
mutant strain does not cause increased sensitivity to methylation or UV treatments (Fig. 5), suggesting that Sub1 does not play a role in either NER or BER of alkylation damage but rather is specific for protection from oxidative DNA damage.
![]() View larger version (11K): [in a new window] |
FIG. 4. Peroxide sensitivity of the yeast sub1 mutant strain, its suppression by yeast SUB1, and truncated PC4 gene expression. (A) , S. cerevisiae wild-type (wt) yeast carrying the vector p416-GPD; , S. cerevisiae sub1 mutant carrying the vector p416-GPD; , wild type carrying the full-length SUB1 gene; , S. cerevisiae sub1 mutant carrying the full-length SUB1 gene expression plasmid. (B) , S. cerevisiae wild-type yeast carrying the vector pMV611; , S. cerevisiae sub1 mutant carrying the vector pMV611; , wild type carrying the truncated PC4 gene expression plasmid; , S. cerevisiae sub1 mutant carrying the truncated PC4 gene expression plasmid.
|
![]() View larger version (15K): [in a new window] |
FIG. 5. MMS and UV survival in the wild type (wt) and sub1 mutant of S. cerevisiae. (A) MMS survival of wild-type yeast ( ) and the sub1 mutant (). Data shown represent the averages of three experiments. Error bars indicate standard errors of the mean and are shown when they extend beyond the symbol. (B) UV spot test. Overnight cultures, diluted to inoculate each spot with approximately 1,000 cells of the wild type (upper row) and the sub1 mutant (lower row), were placed on YPD agar plates and exposed to increasing doses of UV.
|
mutant.
To determine if the human PC4 gene can function to protect against oxidative DNA damage, we tested if it suppresses the peroxide sensitivity of the yeast sub1
mutant strain. We constructed a plasmid that expresses the truncated form of PC4 by adding an ATG codon to the 5' end of PC4 beginning with the glutamine 40 codon. This construct corresponds to the PC4 coding sequence of the truncated form of PC4 originally isolated (Fig. 2). Expression of this clone in yeast results in a complete restoration of peroxide resistance (Fig. 4B), indicating that the truncated form of PC4 can fully substitute for the yeast SUB1 gene and strongly suggesting that the human PC4 gene, like its yeast counterpart, functions in oxidation resistance.
The yeast sub1
mutation increases spontaneous and induced mutagenesis.
Since many mutations affecting peroxide sensitivity also affect spontaneous and peroxide-induced mutagenesis, we tested if the sub1
mutation has such effects by measuring the forward mutation frequency to canavanine resistance. Canavanine resistance can result from a wide variety of genetic changes including GC
TA transversions, and OGG1 mutants of yeast show a sevenfold increase in spontaneous canavanine resistance mutagenesis (52). Figure 6 shows that the sub1
mutant exhibits a twofold increase in both spontaneous and peroxide-induced mutagenesis, indicating that Sub1 protects against mutations arising from the low spontaneous production of endogenous ROS and exposure to high levels of exogenous hydrogen peroxide.
![]() View larger version (17K): [in a new window] |
FIG. 6. The yeast sub1 mutation results in elevated mutagenesis. Spontaneous and induced mutagenesis in the wild type (wt) and the sub1 mutant of S. cerevisiae. The insert expands the view of the mutagenesis in the absence of exogenous peroxide addition.
|
partially suppresses peroxide sensitivity of sub1
.
A nonenzymatic function of XPG is essential for TCR of oxidative damage (34) and has also been implicated in transcription per se (9, 33). XPG also stimulates initiation of BER by the NTH1 glycosylase that removes oxidized pyrimidines, again in a nonenzymatic capacity (4, 30, 34). Furthermore, XPG also interacts with and stimulates APE1, the major human AP endonuclease activity in BER, and appears to coordinate NTH1 and APE1 function in vitro (B. Haltiwanger and P. K. Cooper, unpublished results). Because PC4 and Sub1 also have roles in both transcription and resistance to oxidative damage, we wondered whether they might interact with XPG and its yeast homolog Rad2, respectively. We therefore constructed a sub1
rad2
double mutant strain in order to see if these mutations are epistatic or result in increased peroxide sensitivity. Interestingly, the rad2
mutation partially rescues the sub1
mutant strain, reducing its peroxide sensitivity (Fig. 7). This finding suggests an interplay between Rad2 and Sub1 in minimizing oxidative damage. In particular, it raises the possibility that in the absence of Sub1, an activity of Rad2 responding to oxidative damage is deleterious.
![]() View larger version (17K): [in a new window] |
FIG. 7. Partial suppression of sub1 hydrogen peroxide sensitivity by rad2 . , wild type (wt); , sub1 mutant strain; , rad2 mutant strain; , sub1 rad2 double mutant strain. Representative data are shown.
|
![]() View larger version (34K): [in a new window] |
FIG. 8. Interaction of PC4 and XPG. Slot blot and far-Western tests were performed as described in Materials and Methods. Full-length hNTH1 and E. coli EndoIII were used as the positive and negative controls, respectively. The left portions of the panels show Ponceau S-stained images of the membrane, and right portions show the results of incubation of membranes with 32P-labeled XPG-HMK. The position of the protein in the membrane is indicated.
|
![]() View larger version (52K): [in a new window] |
FIG. 9. (A) XPG protein enhances PC4 binding to DNA bubble substrates. Portions (2.5 nM) of the 10-nucleotide (nt) bubble DNA substrate were incubated with 41 nM purified XPG (lanes 2 to 7) or without XPG (lanes 9 to 13) as described in Materials and Methods. Reaction mixtures were supplemented with 44 (lanes 3 and 9), 88 (lanes 4 and 10), 176 (lanes 5 and 11), 352 (lanes 6 and 12), and 704 nM (lanes 7 and 13) human PC4 protein. Samples were loaded onto a 4.5% native gel, and electrophoresis was conducted at 150 V for 2 h at 4°C. The gel was dried and exposed on a phosphorimager screen. No protein was added in lanes 1 and 8. (B) Quantitative representation of the effect of XPG on PC4 binding. (C) Displacement of XPG by PC4 does not depend on the order of addition of the proteins. In all experiments, 44 nM XPG and 352 nM PC4 protein and the same DNA bubble substrates shown in Fig. 8 were used. Lanes 2 and 3, XPG was first incubated with the DNA bubble substrate (lane 2) and PC4 protein was then added (lane 3); lane 4, PC4 protein was first incubated with the DNA bubble substrate followed by XPG addition; lane 5, XPG and PC4 were mixed first and then added to the DNA bubble substrate; lane 6, PC4 alone was incubated with the substrate. Samples were run in a 4.5% native gel, and electrophoresis was conducted at 150 V for 2 h in the cold. The gel was dried and exposed on a phosphorimager screen.
|
|
|
|---|
mutant of yeast suggests a similar function for the human PC4 protein. These observations, combined with previous results (54), demonstrate the utility of the bacterial screen for the identification of unique human oxidation resistance proteins.
The previously identified transcriptional coactivator function of PC4 does not require the ssDNA binding activity (56, 57) contained in the most highly conserved region of this family of proteins. A novel function in DNA repair for the ssDNA binding activity of PC4 is indicated by the result that the truncated form of human PC4, lacking sequences required for transcription coactivation, can function to suppress oxidative mutagenesis in bacteria and can complement the peroxide sensitivity of a yeast sub1
mutant. This conclusion is further supported by the observation that the DNA binding-defective mutant forms of human PC4 are incapable of functioning as antimutators in the bacterial oxidative mutagenesis assays. Thus, we propose that PC4 functions both in transcription and in repair of oxidative DNA damage. These two functions are genetically separable; mutations in PC4's amino terminal domain primarily affect transcription coactivation, and mutations in its ssDNA binding domain primarily affect DNA repair.
Taken together, the observations that Sub1 functions in a repair pathway involving Rad2 and that PC4 directly and functionally interacts with the DNA repair protein XPG suggest a role for PC4 in the repair of oxidative damage. XPG functions in multiple DNA repair pathways in human cells. Both its enzymatic activity as a structure-specific endonuclease and a nonenzymatic function evidently involve interactions with other proteins required in NER (16, 55). In addition, a nonenzymatic function of XPG is required for TCR of oxidative DNA damage, evidently at an early step presumably involving recognition of RNA polymerase stalled at a lesion (34). XPG also both stimulates BER enzymes in vitro through direct interactions (4, 30; B. M. Haltiwanger and P. K. Cooper, unpublished data) and stimulates removal of oxidative lesions in the cell (34). A role for PC4 in NER is unlikely, because we have shown that deletion of its yeast homolog does not affect sensitivity to UV. Thus, the interaction of PC4 with XPG in repair of oxidative damage could conceivably affect either global BER or TCR. The stable, specific binding of XPG to double-strand DNA containing unpaired regions is functionally separate from its structure-specific endonuclease activity (25; Sarker, Tsutakawa, and Cooper, unpublished), and an attractive possibility is that its preferential binding to the transcription-sized bubble is relevant to the TCR function of XPG. In TCR, rapid preferential repair is initiated on transcribed strands after an RNA polymerase is stalled at a DNA lesion, and it is thought that the RNA polymerase must be removed or remodeled in order for the repair enzymes to gain access to the lesion (for a review, see reference 51). XPG is apparently required along with CSB and TFIIH for this early step in TCR (34; S. E. Tsutakawa and P. K. Cooper, unpublished). Our finding that XPG bound to a DNA bubble substrate recruits PC4 to the complex with a resulting displacement of XPG suggests the possibility that PC4 may be involved in TCR at a step immediately following XPG.
The observed reduction of peroxide sensitivity seen when the sub1
rad2
double mutant is compared with the sub1
single mutant strain is consistent with the idea that Rad2 produces a potentially lethal intermediate in repair of oxidative damage that requires Sub1 for efficient further processing. Inability to release Rad2 from the partially repaired lesion (or lesion plus stalled RNA polymerase) may block access to proteins required to complete subsequent steps of repair. According to this model, the accumulation of unrepaired or inefficiently repaired intermediates leads to increased lethality in the sub1
mutant. Blocking production of the intermediates by eliminating Rad2 improves survival because the initial damage is not as lethal as the DNA repair intermediate. It should be noted that the effect of the rad2
mutation is only partial, suggesting that Sub1 may either have additional functions in DNA repair or may perform similar functions for other DNA repair enzymes.
In the context of this model, our finding that PC4 displaces XPG that is stably bound to a DNA bubble structure suggests the possibility that PC4 is required in TCR for release of XPG to allow subsequent processing either of the lesion itself or of the stalled RNA polymerase. Significantly, a requirement for an XPG release factor in NER has recently been suggested by the results of Riedl et al., who found that XPG was not released from the DNA substrate after excision of the lesion in vitro without the addition of an unknown factor present in nuclear extracts (47). While this NER release factor is presumably not PC4, since deletion of SUB1 does not result in sensitivity to UV, it is possible that XPG similarly is not released on its own after its function in TCR but requires PC4 in order to turn over. The observation that PC4 stimulates XPG release is particularly intriguing in light of results demonstrating that PC4 can stimulate DNA synthesis via an interaction with replication protein A (44). A possible explanation combining all these results is that PC4 may function in TCR as an intermediary between RNA polymerase removal or remodeling by XPG together with other TCR proteins, possibly clearing the initial TCR machinery from the damaged region, and subsequent steps including recruitment of repair enzymes and synthesis of the repair patch. The observation that PC4 blocks RNA polymerase elongation in vitro and the ability of TFIIH to alleviate this block (17, 57) raise the possibility that PC4 may also have additional functions in TCR that affect the resumption of transcription. Clearly, the close association of PC4 with other transcriptional processes and components of the transcription machinery makes a possible role for PC4 in transcription-coupled DNA repair processes particularly interesting. However, it is presently unclear if PC4 functions in XPG-stimulated BER, XPG-dependent TCR of oxidative DNA damage, or both, and further experimentation will be required to elucidate its possible roles in these processes. In this connection, it should be noted that the lack of sensitivity of the sub1
mutant to UV does not rule out a requirement for PC4 in TC-NER (TCR of UV damage), since loss of TCR by deletion of RAD26 (the yeast homolog of CSB) does not render yeast sensitive to UV (53). Thus, the postulated role for PC4 in TCR as a release factor for XPG could conceivably apply to TCR of UV and oxidative lesions.
The function of PC4 in XPG-related DNA repair processes does not readily explain the ability of this protein to function in the E. coli oxidative antimutator assay. However, since the highly sensitive E. coli antimutator assay requires only a small number of repair events per cell per generation to reveal suppression of spontaneous mutagenesis, the repair-enhancing activity of PC4 need not be very efficient. The activity we observed could be due to a general effect of PC4 binding to damaged DNA or to unpaired DNA regions produced as intermediates of repair, creating a more accessible environment for additional E. coli DNA repair factors. It is unlikely that protein-protein interactions between human PC4 protein and bacterial DNA repair proteins would be functional, and moreover, E. coli does not encode any proteins homologous to PC4. While the interaction of PC4 with XPG implicates it in an XPG-dependent DNA repair pathway in human cells, it may also function in a more general fashion to stimulate, stabilize, or assist DNA repair by other factors via a direct interaction with DNA, as it evidently can do in E. coli. Expression of human PC4 in either the wild type or the fpg mutY double mutant strain of E. coli does not result in enhanced resistance to the lethal effects of hydrogen peroxide exposure (data not shown). However, since fpg and mutY mutations have little or no effect on peroxide lethality (unpublished observations), it is unclear if this observation indicates a specificity of PC4 for repair of nonlethal lesions, such as 8-oxoG, or that the DNA repair activity required for mutation suppression when PC4 is expressed in bacteria is weak.
Sub1 mutations in yeast result in increased spontaneous and induced oxidative mutagenesis and lethality. Since expression of the PC4 protein in yeast can restore the wild-type phenotype, it suggests that the human PC4 protein may also function to prevent mutations resulting from oxidative DNA damage in human cells. Mutations that cause increased spontaneous and damage-induced mutagenesis cause an increased risk of cancer (24). PC4 maps to chromosome 15p13, a region that frequently suffers from loss of heterozygosity in bladder and lung tumors (5, 58). This has been interpreted to suggest that the regulatory properties of PC4 may be important in tumor suppression, and support for this hypothesis has been presented previously (29). However, our findings suggest an alternative, or additional, mechanism for PC4 in tumor suppression. Loss of PC4 function may also increase the rate of mutagenesis resulting from spontaneous or induced oxidative DNA damage in humans. This can increase the level of mutations leading to transformation or secondary mutations within tumors leading to tumor promotion.
mutant and its corresponding wild type, Michael Meisterernst for the full-length mutant and wild-type human PC4 clones, Yusaka Nakabeppu for the human OGG1 and MYH clones, Patricia Foster for the cloned bacterial fpg gene used to construct the expression vector, Wolfram Siede for the vectors used to construct the rad2
mutants, and Rabindra Roy for human NTH1 protein. We thank Nathan Elliott and Susan Tsutakawa for critical comments and helpful suggestions on the manuscript. This study was supported by a grant from the Worcester Foundation for Biomedical Research to M.R.V. and by NIH grants GM56420 to M.R.V. and CA63503 to P.K.C.
|
|
|---|
TA transversions, is formamidopyrimidine-DNA glycosylase. Nucleic Acids Res. 19:3629-3632.
T · A transversions in Saccharomyces cerevisiae: evidence for endogenous oxidative damage to DNA in eukaryotic cells. Mol. Gen. Genet. 254:171-178.[CrossRef][Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»