![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Molecular and Cellular Biology, July 2004, p. 6379-6392, Vol. 24, No. 14
0270-7306/04/$08.00+0 DOI: 10.1128/MCB.24.14.6379-6392.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Makoto Umeda,3, Wolfgang Faigle,4 Damarys Loew,4 Shelley Sazer,3 and Valérie Doye1*
UMR 144 CNRS,1 Laboratoire de Spectrométrie de Masse Protéomique, Institut Curie, 75248 Paris Cedex 05,4 Laboratoire de Biologie Moléculaire Eucaryote (UMR 5099-CNRS), Université Paul Sabatier, 31062 Toulouse Cedex, France,2 Department of Biochemistry and Molecular Biology, Baylor College of Medicine, Houston, Texas 770303
Received 19 November 2003/ Returned for modification 26 January 2004/ Accepted 26 April 2004
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
nup120 and nup133b mutant strains, indicating a functional and genetic link between constituents of the S. pombe Nup107-120 complex and of the RanSp/Spi1 pathway. |
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In recent years, extensive progress has been made in the identification and characterization of all NPC components, using proteomic and genomic approaches. Saccharomyces cerevisiae and vertebrate NPCs are composed of roughly 30 nucleoporins, of which about two-thirds have been conserved during evolution (14, 51). While the molecular dissection of NPCs is nearly complete in these organisms, only a few nucleoporins have been definitively identified so far in fission yeast. As Schizosaccharomyces pombe and S. cerevisiae are evolutionary distant, interspecies comparisons should allow the dissection of conserved functions with more precision, thereby improving our understanding of NPC function during evolution. Indeed, comparisons of a few S. cerevisiae and S. pombe nucleoporin orthologues have revealed unexpected functional divergences (71, 73).
In this paper, therefore, we have undertaken the functional analysis of the S. pombe orthologues of S. cerevisiae Nup84 (ScNup84)/vertebrate Nup107-160 complex constituents. In S. cerevisiae, this complex is composed of Nup84, Nup85, Nup120, Nup145-C, Seh1, Sec13, and Nup133 (2, 38, 58, 59, 65). In this organism, single mutations in members of the Nup84 complex are not lethal (although double mutations cause synthetic lethality), but most of them lead to a temperature-sensitive growth defect, to nuclear poly(A)+ RNA accumulation at the restrictive temperature, and to NPC clustering at all temperatures. The vertebrate counterpart of the ScNup84 complex, named the Nup107-160 complex (7, 67), has also been demonstrated to be involved in mRNA export and NPC assembly (9, 28, 67, 68). Our study revealed major differences in the viability phenotypes of the corresponding S. cerevisiae and S. pombe deletion mutants and some differences in the behaviors of these nucleoporins during biochemical fractionation. Functional studies also suggested that the involvement of the complex in NPC distribution and poly(A)+ RNA export has been at least partly conserved between these highly divergent yeasts. However, our study also revealed cell division defects in some of these S. pombe mutant strains. The involvement of the S. pombe Ran (RanSp)/Spi1 pathway with respect to the various phenotypes associated with perturbations of the functions of the S. pombe Nup107-120 (SpNup107-120) complex is discussed.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
S. pombe strains, media, and genetic techniques. The strains used in this study are listed in Table 1. Standard cell culture procedures and media were used (44). The strains were grown in rich nonselective yeast extract medium (YE5S) or in synthetic Edinburgh minimal medium (EMM), appropriately supplemented. Sporulation was performed in malt extract medium at 25 or 30°C. Yeast transformation was achieved by the lithium acetate-dimethyl sulfoxide method (6). The thiamine-regulable nmt1 promoter, in expression vector pREP (43), was repressed by the addition of 5 µg of thiamine/ml of EMM. Phloxine B solution (Bio 101 Systems, Qbiogen, Carlsbad, Calif.) was used at 0.25 ml/liter. Sensitivity to thiabendazole (TBZ) (Sigma) was monitored at 23°C by 10-fold serial-dilution colony spotting on YE5S plates containing the microtubule drug at the appropriate concentrations.
|
nupX::kanMX6/nupX+ sporulating colonies were identified by iodine exposure, and tetrads were microdissected. N-terminal tagging of Nup85 and Seh1 expressed under the control of the nmt1 promoter in their chromosomal locations was accomplished by an analogous method (6) using the pFA6a-kanMX6-P3nmt1-GFP vector. Plasmids. An XhoI-SmaI fragment corresponding to the nup133a ORF was first PCR amplified from genomic DNA using the Sp133a-Xho1F and Sp133a-SmaIR oligonucleotides (sequences of all oligonucleotides used are available upon request) and cloned into pBluescript. The XhoI-SmaI fragment was then subcloned into the pREP3 vector (43), in which the GFPmut2 ORF (13) had been previously inserted as an XhoI/SalI fragment, to generate pREP3-GFP(mut2)-Nup133a and into the pSLF173 vector (21) digested with SalI and SmaI to generate pREP4X-HA3-Nup133a.
A cDNA encoding the N-terminal domain of Nup133b and obtained by reverse transcription-PCR and a DNA fragment corresponding to the C-terminal domain of Nup133b, PCR amplified from genomic DNA, were ligated in pASCyHA to generate pASCyHA-Nup133b (7). For the construction of pREP4X-GFP-Nup133b or pREP4X-HA3-Nup133b, an NcoI-blunt-ended/SmaI fragment of pASCyHA-Nup133b was cloned at the SmaI site of pSGP573 (http://pingu.salk.edu/
forsburg/vectors.html) or pSLF173, respectively.
The nup120 ORF was PCR amplified from genomic DNA and was cloned in the pSLF173 vector. To construct the pREP4X-GFP-Nup120 plasmid, the NotI-SmaI insert of pREP4X-HA3-Nup120 was subcloned into pSGP573.
The NLS-GFP-LacZ-containing fragment from the S. cerevisiae plasmid pPS817 (36) was subcloned into pREP4X (20). Plasmids pREP82X-GFP-nsp1 (74), pREP3X-Spi1 (42), and pREP41X-Spi1-GFP (63) were previously described.
Immunoprecipitation experiments.
S. pombe nupX/GFP-tagged NupY strains expressing HA3-tagged nupX (nupX is nup133a, nup133b, or nup120; nupY is nup85, nup107, or seh1) were constructed by genetic crossing. The strains were grown at 30°C to log phase in supplemented EMM in the presence of thiamine to avoid overexpression of the tagged nucleoporins. For whole-cell lysate preparation, 109 cells were washed in stop buffer and resuspended in immunoprecipitation buffer as previously described (60), with the following changes: Triton was replaced by 1% NP-40, and aprotinin and pepstatin were replaced by a protease inhibitor cocktail (Roche). The cells were then broken with glass beads in a Fastprep (Bio 101 Systems) and spun, and the supernatants were recovered. Protein G-Sepharose beads (Amersham Biosciences) were loaded with anti-GFP antibodies (Roche) in A buffer (50 mM HEPES, pH 7.5, 100 mM NaCl, 1 mM EDTA) at 4°C for 2 h. After four washes in A buffer, the beads were incubated with the extracts at 4°C for 3 h, washed five times in A buffer supplemented with 1% NP-40 and then once in A buffer, and resuspended in loading buffer. The resulting samples were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by Western blotting using anti-GFP or -HA (12CA5) antibodies. The antibodies were detected using horseradish-peroxidase-conjugated goat anti-mouse secondary antibodies. Immunoblots were visualized using enhanced-chemiluminescence reagents (Pierce).
For mass spectrometry analysis, after coloration with colloidal Coomassie blue (G250; Bio-Rad), the protein spots were excised from the gel, reduced using dithiothreitol, and alkylated using iodoacetamide. The proteins were subjected to digestion with trypsin (Sigma) following the protocol of Shevchenko et al. modified by overnight digestion at 30°C (57). The extracted peptides were analyzed by matrix-assisted laser desorption-ionization-time of flight mass spectrometry (Voyager-DETM PRO; Applied Biosystems). Peptide masses obtained by this analysis were used to search the National Center for Biotechnology Information database to identify the full-length proteins.
Fluorescence and electron microscopy. Fluorescence in situ hybridization (FISH) for poly(A)+ RNA was performed as described by Brown et al. (10), with the following modifications: spheroplasts were obtained by digestion with 0.1 mg of Zymolyase-100T (Seikagaku)/ml in PEM buffer {50 mM PIPES [piperazine-N,N'-bis(2-ethanesulfonic acid)], pH 6.9, 0.5 mM EGTA, 0.5 mM MgSO4} plus 1 M sorbitol, and the 50-nucleotide oligo(dT) probe was directly coupled to Cy3 (Amersham Pharmacia Biotech). To detect the distribution of the pre-60S ribosomal particles, FISH was also performed using a probe complementary to the 25S rRNA, conserved from S. cerevisiae to S. pombe (5' CCCGTTCCCTTGGCTGTGGTTTCGCTAGAT*A 3', where the asterisk represents amino-purified nucleotides coupled with Cy3) (26).
Stainings of the cell walls and septa and the nuclei of formaldehyde-fixed cells were carried out using calcofluor (2 µg/ml; Sigma) and DAPI (4',6'-diamidino-2-phenylindole; 1 µg/ml) (48). Tubulin immunofluorescence of formaldehyde-fixed cells was performed as described previously (48), using a TAT1 monoclonal antibody (72) together (when indicated) with an anti-Mid1 rabbit antibody (48). Spi1p was localized using affinity-purified rabbit anti-Spi1p antibody (41), and NPCs were visualized using mAb414 (BAbCO) as previously described (16).
Images of fixed cells and of live cells expressing GFP- or cyan fluorescent protein (CFP)-tagged proteins were acquired with an upright motorized wide-field microscope (DMRA2; Leica), using an oil immersion objective (100x PL APO HCX; 1.4 numerical aperture) and a high-sensitivity cooled interlined charge-coupled device camera (CoolSnap HQ; Roper). For some observations, stacks were acquired using a piezo-electric motor (LVDT; Physik Instrument) mounted underneath the objective lens. The whole system was controlled with Metamorph 5 software (Universal Imaging Corp.). Z sections of DAPI signals (see Fig. 7) were converted into single two-dimensional images by taking the maximum signal at each pixel position in the images. The length of the mitotic spindle (see Fig. 8) was determined based on a two-dimensional projection of Z sections, and used to determine approximate classes as follows: premetaphase, <2 µm; metaphase, 2 to 3 µm; early anaphase, 3 to 5 µm; late anaphase, >5 µm. For deconvolution (see Fig. 5A and 9D), image stacks were acquired without camera binning, with a plane spacing of 0.2 µm, leading to a voxel size of 64.5 by 64.5 by 200 nm3. Deconvolution was performed by the three-dimensional deconvolution module from Metamorph (Universal Imaging Corp.), using the fast iterative constrained PSF-based algorithm. Images in Fig. 10A were obtained with a Zeiss Axioskop microscope, and digitized images were captured with a DVC 1300 charge-coupled device camera and QED software.
|
|
|
|
|
Fluorescence-activated cell-sorting (FACS) analysis. The DNA content was analyzed as described previously (62), using a Becton Dickinson FACSCalibur with the following modifications: buffer A was replaced by 50 mM sodium citrate, pH 7.5, and RNase A was added to a final concentration of 0.5 mg/ml and incubated at 37°C for 3 h. Propidium iodide was then added to a final concentration of 5 µg/ml.
Chromosome loss assays.
The YP10.22 strain, containing a 550-kb minichromosome (47), was crossed with a haploid nup120 strain carrying the pREP4X-HA3-Nup120 plasmid (ura4+ marker). After dissection, a nup120 strain carrying pREP4X-HA3-Nup120 and containing or lacking the minichromosome were isolated and then spotted at 23°C onto EMM plates supplemented with 1 mg of 5-fluoroorotic acid (5-FOA)/ml and 50 mg of uracil/liter to select for cells able to lose the ura4+-containing plasmid. Chromosome loss was also monitored in ade6-M210/ade6-M216 h+/h+ diploid strains. For scoring Ade– phenotypes, cells from 10 small colonies were plated after dilution on yeast extract medium and cultured at 30 or 36°C for 3 days. The percentage of pink colonies (chromosome loss event) was determined, taking the average of four independent experiments.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
|
|
75-kDa polypeptide present solely in the GFP-Seh1 purified fraction as Nup85. The 110-kDa polypeptide, reproducibly detected in both the GFP-Nup85 and GFP-Seh1 fractions, was identified as the C-terminal domain of an S. pombe nucleoporin similar to S. cerevisiae Nup145 and mammalian Nup98/96 and designated Nup189 in fission yeast (61). Nup189 was previously shown to be cleaved in vivo, most likely by autoproteolysis, as demonstrated in S. cerevisiae and mammals (19, 64), leading to a 95-kDa N-terminal product that interacted with Ned1 in a two-hybrid screen (61). In contrast, the protein identified in our complex corresponds to the S. pombe orthologue of ScNup145-C. Therefore, there are two stable subcomplexes in S. pombe, one consisting of Nup120, Nup85, Seh1, and Nup145-C and another comprising Nup107 associated with Nup133a and/or Nup133b (Fig. 2C). Our results thus corroborate the structural model proposed for the S. cerevisiae Nup84 complex (38) (Fig. 2C). However, unlike in S. cerevisiae or human cells, we were not able to demonstrate a stable interaction between Nup107 or Nup133 and the Nup120-containing subcomplex under the biochemical fractionation employed here. Conversely, ScNup133 appears to be loosely associated with the ScNup84 complex (2, 38). Despite this difference, we will subsequently designate this subset of nucleoporins as constituents of the S. pombe Nup107-120 complex by analogy to the vertebrate Nup107-160 complex.
The S. pombe null mutant strains display different viability phenotypes than their S. cerevisiae counterparts.
To investigate the functions of constituents of the SpNup107-120 complex, null alleles were generated (see Materials and Methods). As in S. cerevisiae, deletion of S. pombe nup120 leads to a temperature-sensitive phenotype (Fig. 3B, right). In contrast, spores carrying the nup107 or nup85 allele, while able to germinate at 25°C, formed microcolonies of only 20 to 60 cells (equivalent to four to six divisions) (Fig. 3A). This indicated that, unlike their S. cerevisiae counterparts, nup107 and nup85 are required for vegetative growth in S. pombe. Conversely, while deletion of S. cerevisiae SEH1 leads to a cold-sensitive phenotype (59), analysis of S. pombe seh1 cells did not reveal any detectable growth defect in a range of temperatures from 16 to 36°C (Fig. 3B and data not shown). Single or combined deletion of the nup133a and nup133b genes did not lead to any major growth defect at any temperature tested (16 to 36°C). However, phloxine B-containing plates revealed an increased intracellular accumulation of this vital dye in cells disrupted for nup133b but not nup133a, indicating that deletion of nup133b slightly impairs cell viability at all temperatures (Fig. 3B).
|
nup133a strain. In contrast, a clear clustering phenotype was observed with Nup107-GFP, GFP-Nup85, or GFP-Seh1 in nup133b cells, which was more pronounced in the nup133b strain expressing Nup107-GFP. This nup133b/nup107-GFP strain also displays growth defects at 36°C, a temperature at which the individual nup107-GFP and nup133b strains grow very well (Fig. 4B). In contrast, the nup133a/nup107-GFP, nup133b/GFP-nup85, and nup133b/GFP-seh1 strains are not temperature sensitive (Fig. 4B and data not shown). It thus appears that GFP tagging of Nup107 at its C terminus, although capable of complementing the lethal phenotype of nup107 and allowing biochemical interactions with at least Nup133a and Nup133b, may slightly impair its function. The temperature-sensitive phenotype of the nup133b/nup107-GFP strain could be complemented by HA- or GFP-tagged Nup133b (Fig. 4B and data not shown), but surprisingly, also by HA- or GFP-tagged Nup133a expressed under the control of the nmt1 promoter in the presence of thiamine, which does not completely eliminate expression (i.e., conditions similar to those used for Fig. 2). This suggests that endogenous Nup133a is expressed at very low levels in wild-type cells and indicates that its mild overexpression can overcome some of the defects caused by the nup133b deletion (see Discussion).
|
nup120 strains carrying an integrated copy of Nup107-GFP or GFP-Nup85 revealed mild and severe synthetic lethality, respectively. As an alternative approach to follow NPC distribution, mutant strains were transformed with a plasmid encoding a fusion between GFP and the S. pombe homologue of ScNsp1p (Nsp1Sp) (74). As shown in Fig. 5A, a homogeneous ring-like staining of the nuclear periphery was observed in wild-type, seh1, and nup133a strains. In contrast, nup133b and nup133a/nup133b cells gave a discontinuous, patchy ring around the NE, and an even stronger phenotype was observed in nup120 cells, in which fewer bright spots were observed at the nuclear periphery in most cells grown at 25°C, and to a lesser extent at 36°C (Fig. 5A). In these strains, a more pronounced phenotype was observed when cells were grown on plates, suggesting that, as previously reported for several S. cerevisiae mutants (8, 27, 45), the extent of NPC clustering depends on growth conditions. Finally, thin-section electron microscopy confirmed the nonhomogeneous NPC distribution in nup120 cells and revealed, in some cases, minor alterations of NE structure (Fig. 5B).
Mutations in the SpNup107-120 complex affect the export of poly(A)+ RNAs.
To analyze the subcellular distribution of poly(A)+ RNAs in the various mutant strains, FISH experiments were performed. In wild-type and nup133b cells, poly(A)+ RNAs were uniformly distributed throughout the cells at both 25 and 36°C (Fig. 6A). In contrast, nup120 cells grown at 25°C already accumulate poly(A)+ RNA inside their nuclei. In these cells, a clear nuclear poly(A)+ RNA signal was observed in 30% of the cells within 10 min at 36°C (data not shown) and in most cells by 30 min (Fig. 6A). A similar, albeit less severe, phenotype was also observed in nup133b/nup107-GFP cells, in which nuclear accumulation of poly(A)+ RNA could be observed in 40% of the cells following a 1-h shift to 36°C (data not shown) and in most of these cells after 4 h at 36°C (Fig. 6A). Therefore, both nup120 and nup133b/nup107-GFP strains exhibit a poly(A)+ RNA export defect.
|
nup120, nup133b/nup107-GFP, or nup133a/b strain (Fig. 6B). Although one cannot formally exclude a minor defect in pre-60S rRNA export, this result suggests that the poly(A)+ RNA export defect observed in the S. pombe Nup107-120 mutant strains is specific and does not reflect a general impairment of nucleocytoplasmic transport in these strains.
nup120 and nup133b/nup107-GFP mutant strains exhibit severe cell division defects at restrictive temperature.
Unexpectedly, microscopic analyses of nup120 cells, and to a lesser extent nup133b/nup107-GFP cells, revealed cell division defects at the restrictive temperature. In these cells, calcofluor staining of asynchronous cultures showed an increase of the septation index upon incubation at 36°C. In nup120 cells, 40% had a septum after a 3- or 6-h shift to 36°C compared to 10% of wild-type cells or nup120 cells grown at 25°C (Fig. 7A). Moreover, nup120 cells exhibited septation defects (i.e., widened, misplaced, or occasionally, multiple septa) even at 25°C (10% of the septa) and more frequently at 36°C (20% of the septa at 3 h and 40% at 6 h) (Fig. 7A). To further characterize this cytokinesis defect, wild-type or nup120 cells synchronized in G1/S at 25°C using hydroxyurea were released at 36°C upon hydroxyurea washout. Under these conditions, we observed an 1-h delay of septation onset in nup120 cells compared to wild-type cells and the aberrant persistence of septated cells (data not shown).
DAPI staining also revealed aberrant mitoses, such as unequally segregated chromosomes and lagging chromosomes, in nup120 cells shifted for 3 or 6 h to 36°C (Fig. 7A and 8; see below). We also detected many mononucleated nup120 cells showing hypercondensed chromatin, suggesting a lag at metaphase in the nup120 mutant. In binucleated and septated nup120 cells that accumulate at 36°C, atypical DAPI staining patterns were frequently observed (Fig. 7A). Flow cytometry analyses showed that while nup120 cells mainly have a 2C DNA content at 25°C, 4C-containing cells accumulated at 36°C (Fig. 7B), indicating that DNA replication had occurred. Finally, the NLS-GFP-ß-galactosidase reporter accumulated efficiently in the nuclei of nup120 cells at both permissive and restrictive temperatures (Fig. 7C), indicating that unlike several mutant alleles defective in the RanSp/Spi1pathway (53), NE integrity is not impaired in nup120 cells.
Altogether, our results indicate that nup120 cells shifted to 36°C are at least transiently blocked at metaphase, leading to a delay in septation onset. After the first nuclear division, these cells can proceed to septum formation, replicate their DNA, and accumulate as septated cells with an intact NE but an atypical chromatin structure.
To further characterize these mitotic defects, nup120 and wild-type cells grown at 25°C or shifted to 36°C for 3 or 6 h were analyzed by immunofluorescence using an anti-tubulin antibody and DAPI. Analysis of the various stages of mitosis, assessed by the length of the mitotic spindle, revealed an increased proportion of nup120 cells in premetaphase and metaphase after 3 h at 36°C compared to wild-type cells or nup120 cells grown at permissive temperature (Fig. 8A and C). In addition, this study revealed that even in cells grown at 25°C, 20% of the mitotic nup120 cells had undergone aberrant mitoses. At 36°C, this proportion reached 70% of the mitotic cells after a 6-h shift to 36°C (Fig. 8B and D) (P 
0.01). Aberrant mitoses included displaced positioning of the nucleus and microtubule spindle relative to the long axis of the cell, with the three condensed chromosomes displaced from the center of the cell (Fig. 8D, a and f); unequal sister chromatid segregation; lagging or unattached chromosomes (Fig. 8D, b, c, and d); and compromised microtubule structures (monopolar spindles and misshaped spindles) (Fig. 8D, e and f).
Accurate chromosome transmission is defective in a nup120 strain.
As many mutants with altered spindle assembly and function show hypersensitivity to microtubule-depolymerizing agents, such as TBZ, we performed serial cell dilutions on rich medium containing various concentrations of TBZ. As shown in Fig. 9A, 10 µg of TBZ/ml severely inhibited the growth of the nup120 mutant at permissive temperature (23°C) compared to wild-type cells, indicating that nup120 deletion affects, most likely indirectly, microtubule integrity or spindle function. We then determined if the spindle checkpoint, which monitors mitotic spindle integrity and attachment of the kinetochores to the spindle, was required for the viability of the nup120 strain. Strains with both nup120 and either of the spindle checkpoint genes, mph1 (29) or mad2 (30), deleted were viable. Unlike single mutants, nup120/mph1 cells were sensitive to 5 µg of TBZ/ml at 23°C, indicating a synergistic effect of the two mutations (Fig. 9A). In contrast, sensitivity to TBZ was indistinguishable in nup120 and nup120/mad2 mutants. This pattern of synthetic interaction with mph1 but not with mad2 is similar to that seen with a point mutant of spi1 (18) and likely reflects differences in the severities of the spindle checkpoint defects in the two mutant strains.
To analyze chromosome segregation in nup120 cells in more detail, we monitored the presence of a nonessential minichromosome (47) whose loss results in adenine auxotrophy and the subsequent appearance of pink colonies on plates containing low adenine. However, attempts to isolate an S. pombe nup120 strain containing this minichromosome were not successful. Furthermore, while the nup120 strain transformed by a complementing pUra4-Nup120 plasmid was able to lose the plasmid and thus to grow on 5-FOA-containing plates at the permissive temperature, nup120 cells carrying pUra4-Nup120 and a minichromosome failed to grow on 5-FOA (Fig. 9B). Accordingly, the presence of an additional chromosome in a nup120 mutant severely impairs cell viability. Similar results were previously reported in the case of the alp14 mutant and were interpreted as resulting from extreme instability of the minichromosome (25).
As an alternative approach, we followed chromosome segregation in a heterozygous nup120/nup120+ h+/h+ ade6-M210/ade6-M216 (Ade+) diploid by monitoring the loss of one ade6 mutant allele that leads to the appearance of pink colonies. This diploid strain is homozygous at the mating-type locus and consequently is incompetent for meiosis. Interestingly, a significant increase in the number of pink (Ade–) colonies was observed in a nup120/nup120+ diploid grown at 36°C compared to a wild-type nup120+/nup120+ strain or a nup120/nup120+ diploid grown at 30°C (Fig. 9C). Flow cytometric analysis of the DNA content revealed that the pink-colony cells had mainly a 2C DNA content, in contrast to the white-colony cells, which were 4C (data not shown). Such a "haploidization" phenotype (loss of the disomic state for all three chromosomes as a consequence of initial loss of one chromosome in S. pombe diploids) was previously described (46) and is very similar to that previously reported in the case of a spi1/spi1+ diploid (40, 53). Our data thus demonstrate that Nup120 is essential for genome stability and integrity during mitosis.
Because several constituents of the human Nup107 complex are localized at kinetochores during mitosis (7, 28), it was tempting to link these defects in chromosome segregation to a possible function of this complex at kinetochores. To determine whether the S. pombe Nup107 complex is similarly localized at kinetochores during mitosis, we analyzed the localization of GFP-Nup85 in metaphase-arrested cells, taking advantage of the nuc2-663 mutation (32). In addition, we used the Nuf2-CFP marker (24) to visualize kinetochore positioning. In the resulting GFP-nup85/nuf2-CFP/nuc2-663 cells, intranuclear Nuf2-CFP dots were clearly detected in metaphase. However, while GFP-Nup85 gave a bright localization at the nuclear rim, no specific labeling could be observed at kinetochores (Fig. 9B). Although the presence of undetectable amounts of GFP-Nup85 at kinetochores cannot be excluded, this result suggests that kinetochore localization of the Nup107 complex might be restricted to higher eukaryotes.
The SpNup107-120 complex is functionally and genetically linked to the RanSp/Spi1 pathway.
While this study was in progress, Gao and coworkers reported that nuclear accumulation of the small GTPase RanSc/Gsp1p was impaired in S. cerevisiae nup133, nup120-1/rat2-1, and nup85 mutant strains (23). These results, together with the similarity of cell cycle defects observed in the S. pombe nup120 strain and several mutants defective in the RanSp/Spi1 pathway, prompted us to analyze whether alteration of the Spi1 pathway could be responsible for some of the defects observed in nup120 mutant cells. We therefore investigated the expression level and distribution of Spi1 in nup120 strains grown at permissive temperature or shifted for 4 h to 36°C. Western blot analysis did not reveal any significant alteration of the expression level of endogenous Spi1 in nup120 cells grown at 36°C (Fig. 10B, compare R. 25°C and R. 36°C, lanes 1 and 4). Upon fluorescence analysis, both the Spi1 and mAb414 signals were reproducibly fainter in the nup120 strain at 36°C (Fig. 10A). However, since (i) NE targeting of GFP-Nsp1Sp is not significantly altered in nup120 cells at 36°C (Fig. 5A) and (ii) the expression level of neither endogenous Spi1 nor the major 65-kDa protein (most likely Nsp1Sp) recognized by the mAb414 antibody is affected (Fig. 10B), this decreased staining most likely reflects technical limitations associated with the efficiency of fixing or spheroplasting these cells once they are grown at 36°C. Despite the weaker overall staining, fluorescence analysis revealed moderate changes in the distribution of Spi1 in nup120 cells shifted to the restrictive temperature: although a nuclear signal remained detectable in most cells, the relative signal for Spi1 in the nucleus relative to the cytoplasm was lower in cells grown at the restrictive temperature (Fig. 10A).
It has been reported that mutations in several genes of the RanSp/Spi1 pathway, such as pim1 and mog1, are rescued by overexpression of wild-type Spi1 (40, 56, 63). Using the pREP3X-Spi1 plasmid (42), we could not observe any rescue of either cell growth or septation defects of nup120 cells at 36°C (data not shown). However, this study revealed that expression of Spi1-GFP under the control of the medium-strength nmt1 (nmt1*) promoter (Fig. 10B) enhanced the growth defect of nup120 cells and decreased the viability of nup133b mutant cells (Fig. 10C). In contrast, the growth properties of wild-type and nup133a cells were not altered by Spi1-GFP expression. As the Spi1-GFP fusion is not functional (63), its expression, although not affecting wild-type cell growth, may lead to a competition with endogenous Spi1 in nup120 and nup133b mutants. Most likely correlated with this toxicity, we reproducibly found that the expression level of Spi1-GFP was lower in both nup133b and nup120 cells (Fig. 10B). These data thus strengthen the functional link between the Nup107-120 complex and the Spi1/Ran pathway.
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
nup120, or nup184 (whose product is the S. pombe homologue of ScNup188p [71]) (Fig. 4 and data not shown); and (iii) toxicity of Spi1-GFP expression. Despite the lack of any detectable function of the nup133a gene, its overexpression was able to complement the phenotypes induced by nup133b deletion. Although Nup133a may have a specific function that was not revealed by our assays, a more likely explanation is that, under some conditions, the protein may provide a backup pool for Nup133 function. In this respect, it is noteworthy that Nup133a appears to be mildly induced (2- to 2.5-fold) under several stress conditions (H2O2, cadmium, or heat), a feature that is not shared by any other constituent of the Nup107-120 complex (11; http://www.sanger.ac.uk/PostGenomics/S_pombe/projects/stress/). Another unexpected result arising from this study was the lack of a major growth defect induced by Spnup133a/b deletions that differs from the temperature-sensitive phenotype induced by NUP133 deletion in S. cerevisiae (17, 37, 50) and the essential function of Nup133 in vertebrate NPC assembly (68). Yet, Nup133 inactivation in Caenorhabditis elegans does not lead to any major defect (reference 22 and references therein). More generally, comparison of the phenotypes obtained upon deletion of S. cerevisiae and S. pombe genes, or induced by RNA interference in C. elegans (reference 22 and references therein) or in human cells (9, 28, 68), revealed major divergences among these organisms. The fact that the viability phenotypes were as divergent between the two yeasts as with either C. elegans or vertebrates suggests that these differences reflect the evolution of individual nucleoporins within the ScNup84, SpNup107-120, and metazoan Nup107-160 complexes rather than specific features of evolutionarily divergent organisms (i.e., both of the yeasts that undergo a closed mitosis versus metazoans with an open mitosis).
In summary, although in certain instances some of its individual constituents might be dispensable for cell viability or less tightly associated with other subunits, the evolutionarily conserved ScNup84/SpNup107-120/metazoan Nup107-160 complex appears to be required, as an entity, for cell viability in all organisms tested to date.
The major functions of the ScNup84/SpNup107-120 complexes have been evolutionary conserved.
Despite the divergence observed at the level of individual nucleoporins, functional analysis of several of the S. pombe mutant strains revealed a disturbed NPC distribution, similar to the phenotypes previously reported for S. cerevisiae constituents of the Nup84 complex. Although the NPC clustering phenotype is not as pronounced in S. pombe as in several S. cerevisiae mutants, these newly identified S. pombe mutants provide a useful tool to discriminate NE- from NPC-associated proteins. In addition, FISH studies revealed nuclear accumulation of poly(A)+ RNA at the restrictive temperature in the nup120 and nup133b/nup107-GFP mutants. Our study also revealed major mitotic defects associated with mutations within the Nup107-120 complex. Although not extensively characterized, mitotic defects were also previously reported in S. cerevisiae nup120 (1) and nup84 strains (59). It is noteworthy that the dual function of the SpNup107-120/ScNup84 complex in mRNA export and the cell cycle represents an additional example of potential linkage between these two pathways: while Rae1, initially identified as an mRNA export factor, was also shown to be required for proper mitosis in both S. pombe (10, 70) and higher eukaryotes (5), mutations in the cut1 and cut2 genes, involved in sister chromatid separation, were recently reported to impair mRNA export in S. pombe (4). How these different pathways are connected thus remains to be elucidated.
Mitotic defects of nup120 mutants are consistent with a mild alteration of the Ran pathway.
In S. pombe, the multiple Ran-dependent cellular processes are differentially sensitive to the level of active Ran (53). Among these processes, those most sensitive to the level of functional Ran (i.e., microtubule dynamics and chromosome transmission) were also impaired in the nup120 mutant grown at restrictive temperature. In contrast, phenotypes associated with more severe defects in the Ran pathway (accumulation of septated cells in G1 with hypercondensed unreplicated chromosomes and a fragmented NE) were not detected in this mutant. Accordingly, the nup120 mutant behaves in S. pombe like strains carrying weak loss-of-function alleles of the Ran pathway.
Gao et al. (23) recently reported that several members of the S. cerevisiae Nup84 complex are required for the nuclear accumulation of RanSc/Gsp1, a phenotype that could be correlated with an altered association of Ntf2 (the nuclear transport factor of Ran) with the NE. Immunofluorescence analyses performed in S. pombe nup120 cells suggest that the nuclear accumulation of Spi1 might be slightly diminished at 36°C. Consistently, we also found that expression of nonfunctional Spi1-GFP was specifically toxic in nup120 and in nup133b cells, but not in wild-type or nup133a cells. These data suggest that some of the phenotypes of Nup107-120 complex mutants may reflect a disturbance of the Ran GTPase system. Whether an alteration of nuclear import of RanSp/Spi1 in these mutant cells is primarily responsible for the subsequent mitotic-spindle and chromosome segregation defects remains to be determined, and further experimentation will be necessary to establish the mechanism by which the RanSp/Spi1 pathway and cell cycle progression are affected.
While poly(A)+ RNAs strongly accumulate within the entire nucleus in nup120 and nup133b/nup107-GFP mutants, export of most mRNAs appears to be independent of the Ran-GTPase (12, 63). Accordingly, defects in mRNA export occurring in the Nup107-120 complex mutants are likely to be uncoupled from those induced by alterations of the Ran pathway. In contrast, it is tempting to speculate that the clustering defects observed upon alteration of the ScNup84 and SpNup107-120 complex could somehow be linked to the previously reported requirement for Ran in NE and NPC integrity in both S. pombe (16, 41) and S. cerevisiae (52).
In conclusion, the data presented here provide functional and genetic links between the S. pombe Nup107-120 subcomplex and Ran-dependent mitotic processes. In vertebrates, recent studies suggest additional links between the Nup107-160 complex and Ran: this GTPase was shown to regulate interactions between Nup107 and other nucleoporins that may be required for NPC formation (69). In addition, a fraction of mammalian Nup107, Nup133, and Nup85 localizes at kinetochores in mitosis (7, 28), and Ran was recently shown to regulate kinetochore function (3). Whether these independent studies reflect a general function of the Nup107 complex during mitosis in both yeasts and vertebrates remains quite speculative.
|
ACKNOWLEDGMENTS |
|---|
V.D. was funded by the Institut Curie, the Centre National de la Recherche Scientifique, the Association pour la Recherche contre le Cancer, and La Ligue Contre le Cancer (Comité de Paris). S. W. Baï and J. Rouquette were supported by the French Ministry for Research and Technology and La Ligue contre le Cancer, respectively. S.S. and M.U. were funded by the National Institutes of Health (GM49119).
|
FOOTNOTES |
|---|
J.R. and M.U. contributed equally to this work.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Allen, N. P. C., S. S. Patel, L. Huang, R. J. Chalkley, A. Burlingame, M. Lutzmann, E. C. Hurt, and M. Rexach. 2002. Deciphering networks of protein interactions at the nuclear pore complex. Mol. Cell. Proteomics 1:930-946.
3. Arnaoutov, A., and M. Dasso. 2003. The Ran GTPase regulates kinetochore function. Dev. Cell 5:99-111.[CrossRef][Medline]
4. Azad, A. K., T. Ideue, Y. Ohshima, and T. Tani. 2003. A mutation in the gene involved in sister chromatid separation causes a defect in nuclear mRNA export in fission yeast. Biochem. Biophys. Res. Commun. 310:176-181.[CrossRef][Medline]
5. Babu, J. R., K. B. Jeganathan, D. J. Baker, X. Wu, N. Kang-Decker, and J. M. Van Deursen. 2003. Rae1 is an essential mitotic checkpoint regulator that cooperates with Bub3 to prevent chromosome missegregation. J. Cell Biol. 160:341-353.
6. Bähler, J., J. Wu, M. S. Longtine, N. G. Shah, A. McKenzie, A. B. Steever, A. Wach, P. Philippsen, and J. R. Pringle. 1998. Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast 14:943-951.[CrossRef][Medline]
7. Belgareh, N., G. Rabut, S. W. Bai, M. van Overbeek, J. Beaudouin, N. Daigle, O. V. Zatsepina, F. Pasteau, V. Labas, M. Fromont-Racine, J. Ellenberg, and V. Doye. 2001. An evolutionarily conserved NPC subcomplex, which redistributes in part to kinetochores in mammalian cells. J. Cell Biol. 154:1147-1160.
8. Belgareh, N., C. Snay-Hodge, F. Pasteau, S. Dagher, C. N. Cole, and V. Doye. 1998. Functional characterization of a Nup159p-containing nuclear pore subcomplex. Mol. Biol. Cell 9:3475-3492.
9. Boehmer, T., J. Enninga, S. Dales, G. Blobel, and H. Zhong. 2003. Depletion of a single nucleoporin, Nup107, prevents the assembly of a subset of nucleoporins into the nuclear pore complex. Proc. Natl. Acad. Sci. USA 100:981-985.
10. Brown, J. A., A. Bharathi, A. Ghosh, W. Whalen, E. Fitzgerald, and R. Dhar. 1995. A mutation in the Schizosaccharomyces pombe rae1 gene causes defects in poly(A)+ RNA export and in the cytoskeleton. J. Biol. Chem. 270:7411-7419.
11. Chen, D., W. M. Toone, J. Mata, R. Lyne, G. Burns, K. Kivinen, A. Brazma, N. Jones, and J. Bahler. 2003. Global transcriptional responses of fission yeast to environmental stress. Mol. Biol. Cell 14:214-229.
12. Clouse, K. N., M. J. Luo, Z. Zhou, and R. Reed. 2001. A Ran-independent pathway for export of spliced mRNA. Nat. Cell Biol. 3:97-99.[CrossRef][Medline]
13. Cormack, B. P., R. H. Valdivia, and S. Falkow. 1996. FACS-optimized mutants of the green fluorescent protein (GFP). Gene 173:33-38.[CrossRef][Medline]
14. Cronshaw, J. M., A. N. Krutchinsky, W. Zhang, B. T. Chait, and M. J. Matunis. 2002. Proteomic analysis of the mammalian nuclear pore complex. J. Cell Biol. 158:915-927.
15. Dasso, M. 2002. The Ran GTPase: theme and variations. Curr. Biol. 12:R502-R508.[CrossRef][Medline]
2 procedure was applied for statistical analysis (wt/
