![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Molecular and Cellular Biology, July 2004, p. 6419-6429, Vol. 24, No. 14
0270-7306/04/$08.00+0 DOI: 10.1128/MCB.24.14.6419-6429.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Debabrata Biswas, Yaxin Yu, James M. Stewart, and David J. Stillman*
Department of Pathology, University of Utah Health Sciences Center, Salt Lake City, Utah 84132
Received 26 November 2003/ Returned for modification 9 January 2004/ Accepted 20 April 2004
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The Spt3 factor can regulate TBP binding to promoters. Spt3, which is part of the SAGA histone acetyltransferase complex (63), physically interacts with TBP and plays an important role in transcriptional start site selection for RNA Pol II (19). Spt3 can act as a positive or negative transcriptional regulator, depending on the promoter (5, 17, 67). Although Spt3 acts to promote TBP binding at the GAL1 promoter (17), we have shown that Spt3 inhibits TBP binding to HO (67). Genetic interactions have been seen between SPT3 and other regulators of TBP binding (4, 13, 43).
The Saccharomyces cerevisiae Nhp6 protein is similar to the high-mobility-group B class of architectural DNA-binding proteins (1). Nhp6 is an abundant protein (50), and it has multiple roles in transcription, including transcriptional initiation and elongation by Pol II and promoting transcription by Pol III. For its role in elongation, Nhp6 interacts genetically and biochemically with Spt16/Pob3 (10, 22), the yeast equivalent of FACT that promotes elongation through chromatin templates (49). Nhp6 is required for Spt16/Pob3 to bind to nucleosomes (22, 54).
Nhp6 is encoded by two genes, NHP6A and NHP6B, that are functionally redundant, as only the nhp6ab double mutants show any observable phenotype. nhp6ab mutants are unable to grow at 37°C, but this growth defect can be suppressed by a multicopy plasmid with either SNR6 or BRF1 (35). SNR6 encodes the U6 RNA required for mRNA splicing, and it is suggested that a deficiency in SNR6 RNA contributes to the temperature-sensitive growth defect seen in nhp6ab mutants. Brf1 is the limiting component in TFIIIB, a factor required for Pol III transcription (56); therefore, BRF1 overexpression could increase SNR6 expression and facilitate growth of the nhp6ab mutant at 37°C. Overexpression of TBP also suppresses the temperature-sensitive growth defect of an nhp6ab mutant (67). In addition to its well-documented role in Pol II transcription, TBP is also a component of the RNA Pol III factor TFIIIB and is required for Pol III transcription (33). Thus, TBP overexpression could suppress the nhp6ab growth defect by affecting either Pol II or Pol III transcription. Data from Paull et al. (50) suggest that Nhp6 stimulates transcription by promoting formation of preinitiation complexes.
Our genetic studies suggest that Nhp6 and the Gcn5 histone acetyltransferase function in parallel to activate expression of the yeast HO gene (67, 68). A gcn5 nhp6a nhp6b triple mutant is extremely sick, but this growth defect can be suppressed by mutations in SIN4, SPT3, or SPT8. The data suggested that TBP was the critical target, as overexpression of TBP suppresses the temperature-sensitive growth defect of nhp6ab mutants and partially restores HO expression in the absence of either Nhp6 or Gcn5. In this study, we continue the genetic analysis examining the relationship between Nhp6 and TBP. We performed a novel synthetic lethal screen to identify strains with TBP mutations that are unable to grow in the absence of Nhp6. We also find that a multicopy plasmid with SNR6 can suppress some of the TBP nhp6ab synthetic lethalities. Our results suggest that Nhp6 and TBP work together to facilitate transcriptional activation by both Pol II and Pol III.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
|
ChIP. Chromatin immunoprecipitation (ChIP) was performed as described previously (7) using either 9E11 monoclonal antibody to the Myc epitope or polyclonal anti-TBP serum provided by Laurie Stargell. Multiplex PCR was performed with oligonucleotides specific to the HO and PGK1 promoter and the TRA1 open reading frame, and products were visualized on ethidium bromide-stained 2.6% MetaPhor agarose (BioWhittaker) gels. Quantitative ChIP was performed by real-time PCR with a LightCycler (Roche) and primers specific to SNR6 or TRA1. The amounts of specific target DNA regions amplified in immunoprecipitated samples were determined with LightCycler software (version 3.5; Roche) by comparing the PCR logarithmic amplification threshold (crossing point) values for ChIP DNAs versus a standard dilution series of input samples prior to IP. Each PCR was performed in triplicate, and the normalized mean and standard deviation of the ratio of SNR6 to TRA1 values was calculated according to equation 7 of van Kempen and van Vliet (66) to determine the relative enrichment of the specific target versus the nontarget control. Results of at least two independent ChIP reactions are reported here. The sequences of the PCR primers are as follows: for SNR6, CTGGCATGAACAGTGGTAAA and GGGGAACTGCTGATCATCTC; for TRA1, CTGAGTATGCACTATGGGAA and CTTGATCTCCTTTTCTGCTT; and for PGK1, CCAGAGCAAAGTTCGTTCGA and GCTTGTCCTTCAAGTCCAAA.
Other methods. For the SNR6 Northern blot, RNA was separated on an 8% polyacrylamide gel containing 8 M urea, transferred to a Biodyne B nylon membrane (Pall), and probed with labeled oligonucleotides specific for SNR6 (CCTTATGCAGGGGAACTGCTGATC) and SNR128 (CCGAGAGTACTAACGATGGGTTCGTAAGCGTACTCC) RNAs. The Northern blots were quantitated using ImageQuant software and a Molecular Dynamics PhosphorImager. The Hi Lithium method (31) was used for yeast transformations. For dilution plating assays, cells were grown to saturation in either rich or selective medium (depending on the plasmid) and washed with water, and then aliquots of diluted samples (10-fold dilutions) were plated on appropriate medium.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We next examined TBP binding to the SNR6 promoter in the nhp6ab mutant. Reduced expression of SNR6, transcribed by RNA Pol III, in an nhp6ab mutant is at least partially responsible for the 37°C growth defect, as a multicopy plasmid with SNR6 can at least partially suppress this growth defect (35, 42). We constructed isogenic strains with a TBP-Myc-tagged allele, either NHP6 or nhp6ab, and performed ChIP experiments. The experiment was done in duplicate, using cells grown at 30°C. Real-time PCR was used to quantitate the amount of SNR6 DNA in the immunoprecipitated chromatin. As shown in Fig. 1A, TBP-Myc shows strong binding to SNR6, compared to the untagged control strains. Importantly, binding of TBP-Myc to SNR6 was significantly reduced in the nhp6ab mutant.
|
Multicopy SNR6 and BRF1 suppress the 6-AU sensitivity of nhp6ab mutants. The uracil analog 6-azauracil (6-AU) inhibits transcriptional elongation by causing imbalances in the pools of ribonucleotide triphosphates (20, 57), and some believe that mutants sensitive to 6-AU are defective in elongation. An nhp6ab mutant is very sensitive to 6-AU (10, 22), and a concentration of 25 µg of 6-AU per ml is sufficient to effectively inhibit growth (Fig. 2A). We wanted to know whether specific genes on multicopy plasmids will suppress this 6-AU sensitivity.
|
It is possible that reduced SNR6 RNA levels contribute to the sensitivity to 6-AU, as the steady-state levels of SNR6 RNA are lower in an nhp6ab mutant than in wild-type cells (42). To test this idea, we constructed strains with mutations in the SNR6 promoter that reduce expression, and these mutations result in a 6-AU-sensitive phenotype (Fig. 2B). Interestingly, all three of these SNR6 promoter mutations are lethal in the absence of Nhp6 (44). It is possible that the decrease in SNR6 RNA affects mRNA splicing, and this results in 6-AU sensitivity (see Discussion). Nonetheless, these experiments clearly show that sensitivity to 6-AU can result from a mutation in a gene not having a direct role in transcriptional elongation.
Screen for TBP mutations that are lethal in the absence of Nhp6. Cells containing TBP with a hemagglutinin epitope tag, whether the tag is at the N or C terminus, are viable and healthy, but the tagged versions of TBP are lethal in an nhp6ab mutant (67). Similarly, TBP(K138T Y139A), TBP(G174E), and TBP(F237D) mutants are viable in an NHP6+ strain but lethal in an nhp6ab mutant (67). We wondered what other types of TBP mutations would not be tolerated in the absence of Nhp6, and we have taken two approaches. First, we set up a screen to look for TBP point mutations that are specifically lethal in an nhp6ab strain. Second, we tested a variety of TBP mutations that had been characterized in other labs.
We used a red and white sectoring assay (6) to identify specific TBP mutations. We constructed an ade2 ade3 spt15::LEU2 strain containing a YCp plasmid with three genes, the wild-type TBP gene and two nutritional markers, URA3 and ADE3. The SPT15 gene, which encodes TBP, is essential for viability, so this strain cannot lose the YCp-ADE3-URA3-SPT15 plasmid, and the strains are red in color and sensitive to 5-FOA. This strain was transformed with a PCR-mutagenized TBP library on a YCp-TRP1 vector (2), and we screened for solid red (nonsectoring) colonies (Fig. 3). The majority of these nonsectoring colonies contain lethal TBP mutations, and these mutants were eliminated by mating to an NHP6+ strain and testing the resulting NHP6+/nhp6ab diploids for sectoring and 5-FOA sensitivity. Finally, all of the candidate TRP1 plasmids with TBP mutations that were synthetic lethal with nhp6ab were purified and retransformed into nhp6ab spt15 and NHP6+ spt15 strains to verify that the mutations are specifically lethal with nhp6ab.
|
|
|
|
Suppression by multicopy SNR6. TBP interacts with TFIIA and TFIIB, and transcriptional activation requires formation of a TBP-TFIIA-TFIIB-DNA complex. We therefore asked whether a multicopy plasmid with either SUA7, encoding TFIIB, or the two genes encoding the TFIIA subunits, TOA1 and TOA2, could suppress the synthetic lethality of TBP alleles in the nhp6ab mutants. We tested more than half of the TBP mutants for multicopy suppression, but none of them were suppressed by either YEp-TFIIA or YEp-TFIIB. Since the 6-AU sensitivity of nhp6ab mutants could be suppressed by multicopy SNR6 (Fig. 2), we determined whether YEp-SNR6 could suppress the synthetic lethality from combining nhp6ab with TBP point mutations. We tested 12 TBP alleles and found that for 8 alleles a multicopy plasmid with the SNR6 gene allowed cells to grow on 5-FOA (Table 3; examples in Fig. 5B). There is no obvious correlation between the location of the TBP substitution on the structure (Fig. 4) and the ability to be suppressed by YEp-SNR6.
Suppression by spt3 mutation. Spt3 physically interacts with TBP, and Spt3 acts to promote or inhibit TBP binding, depending on the promoter (17, 19, 67). Additionally, an spt3 mutation can suppress growth defects in both nhp6a nhp6b and gcn5 nhp6a nhp6b strains (67). On the basis of these results, we examined whether an spt3 gene disruption can suppress the synthetic lethality observed between nhp6 and mutant TBP alleles, using an spt15 nhp6a nhp6b spt3 strain with wild-type TBP on a YCp-URA3 plasmid. This strain was transformed with the TRP1 plasmids carrying various mutant versions of TBP, and the transformed strains were then plated on medium containing 5-FOA to determine whether the cells were viable after loss of the YCp-URA3 plasmid with wild-type TBP. Although we did not test all of the TBP alleles that are lethal in the nhp6ab mutant, we determined that for 10 of the 19 TBP alleles tested, the spt3 mutation suppressed the synthetic lethality with nhp6ab (Table 3). As shown in Fig. 5C, the synthetic lethality of the F227L mutant with nhp6ab is strongly suppressed by spt3, and the F237L mutant is suppressed to a lesser extent. Again, there is no correlation between suppression by spt3 and the position of the TBP substitution on the structure (Fig. 4).
A number of the TBP mutants show temperature-sensitive growth in an otherwise wild-type (e.g., NHP6+) strain. We decided to determine whether an spt3 mutation would affect the growth characteristics of these TBP mutants. Two isogenic spt15
strains containing the YCp-ADE3-URA3-SPT15 plasmid were constructed, one SPT3+ and the other spt3–. The two strains were transformed with 15 plasmids with TBP alleles and plated at various temperatures on medium containing 5-FOA to assess the ability of these strains to grow in the absence of the plasmid with wild-type TBP. As shown in Fig. 5D, the L114F, N159D, and R220H mutants grow on 5-FOA at 30°C in both SPT3 and spt3 strains, although colony size is reduced in the spt3 mutants. All three of these TBP mutants are unable to grow on 5-FOA at an elevated temperature when the SPT3 gene is present. Interestingly, an spt3 mutation allows these TBP mutants to grow at the higher temperature. Similar suppression of temperature-sensitive growth was also seen for L172P and R173G mutants and the K97R L193S and K120I C164Y double mutants (data not shown). These suppression results are consistent with the suggestion that Nhp6 and Spt3 affect TBP function in opposing ways (67).
Since an spt3 gene disruption can suppress many nhp6ab phenotypes, we also asked whether this suppression extends to the 6-AU sensitivity of nhp6ab mutants. As shown in Fig. 6A, the nhp6ab strain is very sensitive to 6-AU, but this effect is largely suppressed in the nhp6ab spt3 strain. This result is surprising, because the data in Fig. 2 suggest that the 6-AU sensitivity in the nhp6ab strain is largely due to the decreased expression of SNR6, a Pol III-transcribed gene. However, there is no known role of SPT3 in Pol III transcription, although the function of SPT3 in Pol II transcription is well documented. To examine this question, we measured SNR6 RNA levels by Northern hybridization in isogenic strains (Fig. 6B). SNR6 RNA levels are reduced to 23% in the nhp6ab mutant, and this value is unchanged in the nhp6ab spt3 strain. Additionally, SNR6 RNA levels are not increased in the spt3 single mutant, compared to the wild type. In wild-type strains, growth in the presence of 6-AU results in a modest decrease in SNR6 RNA levels (Fig. 6C). In summary, the decrease in SNR6 RNA levels in the nhp6ab strain may contribute to the strong 6-AU sensitivity. However, while the spt3 mutation restores growth of the nhp6ab mutant on 6-AU, spt3 does not suppress the nhp6ab defect in SNR6 RNA levels.
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
TBP substitution mutants. The 43 TBP mutations that are synthetic and lethal in combination with nhp6ab cluster in interesting regions of TBP. Figure 4 shows the structure of the core of TBP, along with TFIIB, TFIIA, and DNA, merged from two separate structure determinations (48, 64) as a top view, a front view, and a 90° rotated view. New substitutions isolated in our screen that are lethal in the absence of Nhp6 are shown in red. The residues that have been previously shown to affect TBP interaction with TFIIA (K133, K138, Y139, and K145) are shown in yellow. In the TBP-TFIIA-DNA crystallographic structures, none of these four TBP residues make direct contact with TFIIA (24, 64). Only a small part of TFIIA was successfully crystallized with TBP and DNA, and it is assumed that full-length TFIIA does indeed touch these contact residues in TBP. We show that all of these previously characterized TBP double mutants (K133L K138L, K133L K145L, and K138T Y139A) that affect interaction with TFIIA are lethal in an nhp6ab mutant but viable in an NHP6 strain. Residue K133 in TBP makes important contacts with TFIIA, as binding to TFIIA is lost in either the K133L K138L or K143 K145L double mutant (11, 62). We also recovered a single substitution at this position, K133R, that is lethal in the absence of Nhp6. On the top surface of TBP, K133 is part of a continuous line of substitutions, E129, K151, F152,F155, I157, and R220, that are synthetic and lethal with nhp6ab, and we describe these mutations as cluster 1 (top view in Fig. 4). Cluster 2 is a group of substitutions surrounding the other residues required for TFIIA interaction, K145 at the right edge of TBP, and slightly to the left are adjacent residues K138 and K139 (front view in Fig. 4). New substitutions at Q144 and G147 are just above K145, and the E108, P109, K110, and I142 mutations surround K138 and K139. The cluster 3 group of mutations, K83, E93, Y94, K97, and I103, are at the interface between TBP and TFIIA defined by the crystallographic studies. Clusters 1, 2, and 3 represent regions that probably interact with TFIIA, and some interesting patterns emerge for substitutions here. An spt3 deletion suppresses the nhp6ab TBP synthetic lethality for two of four mutants tested, and three of five mutants tested can be suppressed by YEp-SNR6. These results show the important role of SPT3 and SNR6 in Nhp6 and TBP function, as discussed below.
Cluster 4 is a group of substitutions lethal in nhp6ab, including Q225, F227, E228, and Y231, that are on the upper left surface of TBP (top view in Fig. 4). Cluster 4 substitutions are adjacent to the P232 and V233 mutations that were identified in a screen for TBP mutations that affect NC2 binding (12) and adjacent to A226 where three mutations that specifically affect Pol II transcription were identified (14). It is not clear what this region of TBP interacts with, but one possibility is this region interacts with factors that regulate TBP binding, such as NC2, Mot1, the Not-Ccr4 complex, and TBP-associated factors (39, 52).
Cluster 5 is a collection of substitutions near G174, a residue that contacts Spt3 (shown in green in Fig. 4). Surrounding G174, we recovered clustered mutations at L172, R173, F237, and K239. Interestingly, we recovered three independent substitutions at K239. There are some interesting phenotypes common to most of the mutations in cluster 5. The synthetic lethality with nhp6ab for most of these TBP mutations can be suppressed by a spt3 deletion. Interestingly, F237L is suppressed by spt3, but not the F237D substitution at the same position. L172P and G174E can be suppressed by spt3, but not the R173G mutant at the intervening position. YEp-SNR6 suppresses the nhp6ab TBP synthetic lethality for all of the cluster 5 substitutions tested. Below cluster 5 are three residues shown in orange. These are positions where site-directed mutations were created on the TBP surface that eliminate interaction with TFIIB (38), based on the TFIIB-TBP-DNA cocrystal. These substitutions had no additional growth defect in an nhp6ab strain.
Nhp6 and Pol III transcription. Experiments suggest that Nhp6 is required for efficient transcription of the SNR6 gene by Pol III (35, 42, 44). SNR6 encodes the U6 RNA required for mRNA splicing, and it is suggested that a deficiency in SNR6 RNA contributes to the temperature-sensitive growth defect seen in nhp6ab mutants. Brf1 is the limiting component in TFIIIB, a factor required for Pol III transcription (56); therefore, BRF1 overexpression could increase SNR6 expression and facilitate growth of the nhp6ab mutant at 37°C. Overexpression of TBP also suppresses the temperature-sensitive growth defect of an nhp6ab mutant (67). Additionally, TBP overexpression suppresses the defect in HO transcription by RNA Pol II in an nhp6ab strain (67). In addition to its well-documented role in Pol II transcription, TBP is also a component of the RNA Pol III factor TFIIIB and is required for Pol III transcription (33). Thus, TBP overexpression could suppress the nhp6ab growth defect by affecting Pol II or Pol III transcription.
Several studies have defined how TBP interacts with Pol III transcription factors. Cormack and Struhl (14) mutagenized TBP, isolated substitutions with a temperature-sensitive phenotype, and identified 65 TBP mutants specifically defective in Pol III transcription. Although some of these residues also showed up in our screen for TBP nhp6ab synthetic lethality, including P65, E129, E133, Q144, F152, F155, I157, R220, Y231, and F237, not all substitutions confer the same phenotypes. For example, while F237P and F237L substitutions specifically affected Pol III transcription, F237R specifically affected Pol II, and the defects of the F237D substitution were not specific to any polymerase. Additional TBP residues important for Pol III transcription were identified through studies examining the interaction of TBP mutants with the Brf1 Pol III transcription factor (58) by the TBP-Brf1 cocrystal (32). Interestingly, all of the residues in TFIIA that are required for TFIIA-TBP interaction (K133, K138, Y139, and K145) are also required for TBP interaction with Brf1. In summary, the regions defined by clusters 1, 2, and 3 are involved in TBP binding to both TFIIA and Brf1. The fact that these substitutions are lethal in an nhp6ab mutant suggests that Nhp6 becomes essential when a substitution reduces that ability of TBP to interact with TFIIA or Brf1.
Several of our experiments reinforce the role for Nhp6 in Pol III transcription. ChIP experiments show strong binding of TBP to the SNR6 gene, transcribed by Pol III, and TBP binding to SNR6 is markedly reduced in the absence of Nhp6. nhp6ab mutants are extremely sensitive to 6-AU, and this could be suppressed by multicopy plasmids with either the Pol III factor BRF1 or the Pol III target gene SNR6. Finally, multicopy plasmids with SNR6 suppress the nhp6ab TBP synthetic lethality for several mutants, suggesting that a defect in Pol III transcription is partially responsible for the nhp6ab TBP synthetic lethality.
The suppression of the 6-AU sensitivity in nhp6ab mutants is particularly interesting. The 6-AU inhibitor affects the ribonucleotide triphosphate pools, and many transcriptional elongation mutants are sensitive to 6-AU (20, 57). Nhp6 interacts with the transcriptional elongation factor yFACT (Spt16/Pob3); therefore, the 6-AU sensitivity of nhp6ab mutants was attributed to a defect in transcriptional elongation (10, 22). We find that this 6-AU sensitivity can be suppressed by either SNR6 or BRF1 on a multicopy plasmid (Fig. 2A) or by disruption of the SPT3 gene (Fig. 6A). Although an spt3 mutation suppresses the 6-AU sensitivity caused by nhp6ab, spt3 does not suppress the nhp6ab defect in SNR6 expression (Fig. 6B).
It is not clear why an spt3 gene deletion can suppress nhp6ab, in terms of sensitivity to 6-AU, but it does not suppress the defect in SNR6 expression. An spt3 mutation does not cause an increase in SNR6 RNA levels, and an spt3 strain is resistant to 6-AU (Fig. 6). However, an spt3 mutation, by itself, has been reported to cause sensitivity to 6-AU in a different strain background (16). Previously, SPT3 has never been shown to have a role in Pol III transcription, and spt3 mutations have been observed to affect only RNA Pol II transcription. Thus, it is possible that the spt3 suppression of the nhp6ab 6-AU sensitivity is an indirect effect of altered gene expression by RNA Pol II.
Nonetheless, our data show clearly that 6-AU sensitivity results from decreased SNR6 expression, whether because of a SNR6 promoter mutation or an nhp6ab mutation. This challenges the widely held belief that mutations affecting transcriptional elongation result in sensitivity to 6-AU. One speculative explanation is that the reduced levels of the U6 splicing factor, produced from the SNR6 gene, affect the efficiency of mRNA splicing, and this in turn has an effect on transcriptional elongation. Several reports have recently suggested a strong link between splicing and elongation. Fong and Zhou (21) report that spliceosomal small nuclear ribonucleoproteins interact with the transcription elongation factor TAT-SF1 and stimulate Pol II elongation. A mutation in the largest subunit of RNA Pol II that slows elongation by RNA Pol II has effects on splicing, in both human and Drosophila cells (15). Additionally, mutations in the SPT4 and SPT5 yeast genes that encode elongation factors result in splicing defects (41), and growth in the presence of 6-AU also affects splicing (30). Additionally, growth of wild-type cells in the presence of 6-AU causes a slight reduction in SNR6 RNA levels. We suggest that the nhp6ab mutation reduces the levels of the U6 splicing factor, produced from the SNR6 gene, and that the reduced levels of splicing factors affect transcriptional elongation, resulting in 6-AU sensitivity. In any case, our studies show that one cannot assume that 6-AU sensitivity results from a defect in transcriptional elongation.
Nhp6 and Pol II transcription. While the lethality of TBP substitution mutants in an nhp6ab strain could be because Nhp6 is required for efficient SNR6 expression by RNA Pol III, we believe Nhp6 plays a role in TBP binding at genes transcribed by RNA Pol II. In vitro binding experiments show that Nhp6 stimulates the formation of a TBP-TFIIA-TFIIB-DNA complex, and in vivo experiments with chimeric promoter constructs suggest that Nhp6 acts at core promoters (50). Nhp6 acts positively to promote activation of the HO gene (68) and negatively to repress FRE2 transcription (23). Nhp6 acts both positively and negatively at the CHA1 gene, because induced levels are reduced and basal levels are increased in an nhp6ab mutant (45). In support of the idea that Nhp6 promotes DNA binding by TBP at genes transcribed by RNA Pol II, in vitro binding experiments show that Nhp6 stimulates formation of a TBP-TFIIA-DNA complex (D. Biswas, A. N. Imbalzano, P. Eriksson, Y. Yu, and D. J. Stillman, submitted for publication). TFIIA is encoded by the TOA1 and TOA2 genes, and a toa2 mutation that eliminates TFIIA interaction with TBP is viable in wild-type cells but lethal in an nhp6ab mutant strain (Biswas et al., submitted). These results suggest that Nhp6 plays a role in formation of the TBP-TFIIA-DNA complex. Additionally, we have found genetic interactions between Nhp6 and factors that regulate TBP binding (D. Biswas and D. J. Stillman, unpublished data). These strong genetic interactions between NHP6 and basal factors exclusively used for Pol II transcription provide strong support for the idea that Nhp6 has an important role in RNA Pol II transcription. Thus, Nhp6 facilitates expression of genes transcribed by both Pol II and Pol III.
|
ACKNOWLEDGMENTS |
|---|
This work was supported in part by a grant from the National Institutes of Health awarded to D.J.S.
|
FOOTNOTES |
|---|
Present address: National Institutes of Health, Bethesda, MD 20892.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Arndt, K. M., S. Ricupero-Hovasse, and F. Winston. 1995. TBP mutants defective in activated transcription in vivo. EMBO J. 14:1490-1497.[Medline]
3. Arndt, K. M., C. R. Wobbe, S. Ricupero-Hovasse, K. Struhl, and F. Winston. 1994. Equivalent mutations in the two repeats of yeast TATA-binding protein confer distinct TATA recognition specificities. Mol. Cell. Biol. 14:3719-3728.
4. Badarinarayana, V., Y. C. Chiang, and C. L. Denis. 2000. Functional interaction of CCR4-NOT proteins with TATAA-binding protein (TBP) and its associated factors in yeast. Genetics 155:1045-1054.
5. Belotserkovskaya, R., D. E. Sterner, M. Deng, M. H. Sayre, P. M. Lieberman, and S. L. Berger. 2000. Inhibition of TATA-binding protein function by SAGA subunits Spt3 and Spt8 at Gcn4-activated promoters. Mol. Cell. Biol. 20:634-647.
6. Bender, A., and J. R. Pringle. 1991. Use of a screen for synthetic lethal and multicopy suppressee mutants to identify two new genes involved in morphogenesis in Saccharomyces cerevisiae. Mol. Cell. Biol. 11:1295-1305.
7. Bhoite, L. T., Y. Yu, and D. J. Stillman. 2001. The Swi5 activator recruits the Mediator complex to the HO promoter without RNA polymerase II. Genes Dev. 15:2457-2469.
8. Boeke, J. D., F. LaCroute, and G. R. Fink. 1984. A positive selection for mutants lacking orotidine-5'-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance. Mol. Gen. Genet. 197:345-346.[CrossRef][Medline]
9. Brachmann, C. B., A. Davies, G. J. Cost, E. Caputo, J. Li, P. Hieter, and J. D. Boeke. 1998. Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast 14:115-132.[CrossRef][Medline]
10. Brewster, N. K., G. C. Johnston, and R. A. Singer. 2001. A bipartite yeast SSRP1 analog comprised of Pob3 and Nhp6 proteins modulates transcription. Mol. Cell. Biol. 21:3491-3502.
11. Buratowski, S., and H. Zhou. 1992. Transcription factor IID mutants defective for interaction with transcription factor IIA. Science 255:1130-1132.
12. Cang, Y., D. T. Auble, and G. Prelich. 1999. A new regulatory domain on the TATA-binding protein. EMBO J. 18:6662-6671.[CrossRef][Medline]
13. Collart, M. A. 1996. The NOT, SPT3, and MOT1 genes functionally interact to regulate transcription at core promoters. Mol. Cell. Biol. 16:6668-6676.[Abstract]
14. Cormack, B. P., and K. Struhl. 1993. Regional codon randomization: defining a TATA-binding protein surface required for RNA polymerase III transcription. Science 262:244-248.
15. de la Mata, M., C. R. Alonso, S. Kadener, J. P. Fededa, M. Blaustein, F. Pelisch, P. Cramer, D. Bentley, and A. R. Kornblihtt. 2003. A slow RNA polymerase II affects alternative splicing in vivo. Mol. Cell 12:525-532.[CrossRef][Medline]
16. Desmoucelles, C., B. Pinson, C. Saint-Marc, and B. Daignan-Fornier. 2002. Screening the yeast "disruptome" for mutants affecting resistance to the immunosuppressive drug, mycophenolic acid. J. Biol. Chem. 277:27036-27044.
17. Dudley, A. M., C. Rougeulle, and F. Winston. 1999. The Spt components of SAGA facilitate TBP binding to a promoter at a post-activator-binding step in vivo. Genes Dev. 13:2940-2945.
18. Dvir, A., J. W. Conaway, and R. C. Conaway. 2001. Mechanism of transcription initiation and promoter escape by RNA polymerase II. Curr. Opin. Genet. Dev. 11:209-214.[CrossRef][Medline]
19. Eisenmann, D. M., K. M. Arndt, S. L. Ricupero, J. W. Rooney, and F. Winston. 1992. SPT3 interacts with TFIID to allow normal transcription in Saccharomyces cerevisiae. Genes Dev. 6:1319-1331.
20. Exinger, F., and F. Lacroute. 1992. 6-Azauracil inhibition of GTP biosynthesis in Saccharomyces cerevisiae. Curr. Genet. 22:9-11.[CrossRef][Medline]
21. Fong, Y. W., and Q. Zhou. 2001. Stimulatory effect of splicing factors on transcriptional elongation. Nature 414:929-933.[CrossRef][Medline]
22. Formosa, T., P. Eriksson, J. Wittmeyer, J. Ginn, Y. Yu, and D. J. Stillman. 2001. Spt16-Pob3 and the HMG protein Nhp6 combine to form the nucleosome-binding factor SPN. EMBO J. 20:3506-3517.[CrossRef][Medline]
23. Fragiadakis, G. S., D. Tzamarias, and D. Alexandraki. 2004. Nhp6 facilitates Aft1 binding and Ssn6 recruitment, both essential for FRE2 transcriptional activation. EMBO J. 23:333-342.[CrossRef][Medline]
24. Geiger, J. H., S. Hahn, S. Lee, and P. B. Sigler. 1996. Crystal structure of the yeast TFIIA/TBP/DNA complex. Science 272:830-836.[Abstract]
25. Gietz, R. D., and A. Sugino. 1988. New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74:527-534.[CrossRef][Medline]
26. Guex, N., and M. C. Peitsch. 1997. SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis 18:2714-2723.[CrossRef][Medline]
27. Hampsey, M. 1998. Molecular genetics of the RNA polymerase II general transcriptional machinery. Microbiol. Mol. Biol. Rev. 62:465-503.
28. Hernandez, N. 1993. TBP, a universal eukaryotic transcription factor? Genes Dev. 7:1291-1308.
29. Hoopes, B. C., J. F. LeBlanc, and D. K. Hawley. 1992. Kinetic analysis of yeast TFIID-TATA box complex formation suggests a multistep pathway. J. Biol. Chem. 267:11539-11547.
30. Howe, K. J., C. M. Kane, and M. Ares, Jr. 2003. Perturbation of transcription elongation influences the fidelity of internal exon inclusion in Saccharomyces cerevisiae. RNA 9:993-1006.
31. Jiang, Y. W., and D. J. Stillman. 1995. Regulation of HIS4 expression by the Saccharomyces cerevisiae SIN4 transcriptional regulator. Genetics 140:103-114.[Abstract]
32. Juo, Z. S., G. A. Kassavetis, J. Wang, E. P. Geiduschek, and P. B. Sigler. 2003. Crystal structure of a transcription factor IIIB core interface ternary complex. Nature 422:534-539.[CrossRef][Medline]
33. Kassavetis, G. A., C. A. Joazeiro, M. Pisano, E. P. Geiduschek, T. Colbert, S. Hahn, and J. A. Blanco. 1992. The role of the TATA-binding protein in the assembly and function of the multisubunit yeast RNA polymerase III transcription factor, TFIIIB. Cell 71:1055-1064.[CrossRef][Medline]
34. Kobayashi, A., T. Miyake, Y. Ohyama, M. Kawaichi, and T. Kokubo. 2001. Mutations in the TATA-binding protein, affecting transcriptional activation, show synthetic lethality with the TAF145 gene lacking the TAF N-terminal domain in Saccharomyces cerevisiae. J. Biol. Chem. 276:395-405.
35. Kruppa, M., R. D. Moir, D. Kolodrubetz, and I. M. Willis. 2001. Nhp6, an HMG1 protein, functions in SNR6 transcription by RNA polymerase III in S. cerevisiae. Mol. Cell 7:309-318.[CrossRef][Medline]
36. Kuras, L., and K. Struhl. 1999. Binding of TBP to promoters in vivo is stimulated by activators and requires Pol II holoenzyme. Nature 399:609-613.[CrossRef][Medline]
37. Lee, M., and K. Struhl. 1995. Mutations on the DNA-binding surface of TATA-binding protein can specifically impair the response to acidic activators in vivo. Mol. Cell. Biol. 15:5461-5469.[Abstract]
38. Lee, M., and K. Struhl. 1997. A severely defective TATA-binding protein-TFIIB interaction does not preclude transcriptional activation in vivo. Mol. Cell. Biol. 17:1336-1345.[Abstract]
39. Lee, T. I., and R. A. Young. 1998. Regulation of gene expression by TBP-associated proteins. Genes Dev. 12:1398-1408.
40. Li, X. Y., A. Virbasius, X. Zhu, and M. R. Green. 1999. Enhancement of TBP binding by activators and general transcription factors. Nature 399:605-609.[CrossRef][Medline]
41. Lindstrom, D. L., S. L. Squazzo, N. Muster, T. A. Burckin, K. C. Wachter, C. A. Emigh, J. A. McCleery, J. R. Yates III, and G. A. Hartzog. 2003. Dual roles for Spt5 in pre-mRNA processing and transcription elongation revealed by identification of Spt5-associated proteins. Mol. Cell. Biol. 23:1368-1378.
42. Lopez, S., M. Livingstone-Zatchej, S. Jourdain, F. Thoma, A. Sentenac, and M. C. Marsolier. 2001. High-mobility-group proteins NHP6A and NHP6B participate in activation of the RNA polymerase III SNR6 gene. Mol. Cell. Biol. 21:3096-3104.
43. Madison, J. M., and F. Winston. 1997. Evidence that Spt3 functionally interacts with Mot1, TFIIA, and TATA-binding protein to confer promoter-specific transcriptional control in Saccharomyces cerevisiae. Mol. Cell. Biol. 17:287-295.[Abstract]
44. Martin, M. P., V. L. Gerlach, and D. A. Brow. 2001. A novel upstream RNA polymerase III promoter element becomes essential when the chromatin structure of the yeast U6 RNA gene is altered. Mol. Cell. Biol. 21:6429-6439.
45. Moreira, J. M., and S. Holmberg. 2000. Chromatin-mediated transcriptional regulation by the yeast architectural factors NHP6A and NHP6B. EMBO J. 19:6804-6813.[CrossRef][Medline]
46. Nikolov, D. B., and S. K. Burley. 1997. RNA polymerase II transcription initiation: a structural view. Proc. Natl. Acad. Sci. USA 94:15-22.
47. Nikolov, D. B., H. Chen, E. D. Halay, A. Hoffman, R. G. Roeder, and S. K. Burley. 1996. Crystal structure of a human TATA box-binding protein/TATA element complex. Proc. Natl. Acad. Sci. USA 93:4862-4867.
48. Nikolov, D. B., H. Chen, E. D. Halay, A. A. Usheva, K. Hisatake, D. K. Lee, R. G. Roeder, and S. K. Burley. 1995. Crystal structure of a TFIIB-TBP-TATA-element ternary complex. Nature 377:119-128.[CrossRef][Medline]
49. Orphanides, G., G. LeRoy, C. H. Chang, D. S. Luse, and D. Reinberg. 1998. FACT, a factor that facilitates transcript elongation through nucleosomes. Cell 92:105-116.[CrossRef][Medline]
50. Paull, T. T., M. Carey, and R. C. Johnson. 1996. Yeast HMG proteins NHP6A/B potentiate promoter-specific transcriptional activation in vivo and assembly of preinitiation complexes in vitro. Genes Dev. 10:2769-2781.
51. Pokholok, D. K., N. M. Hannett, and R. A. Young. 2002. Exchange of RNA polymerase II initiation and elongation factors during gene expression in vivo. Mol. Cell 9:799-809.[CrossRef][Medline]
52. Pugh, B. F. 2000. Control of gene expression through regulation of the TATA-binding protein. Gene 255:1-14.[CrossRef][Medline]
53. Rothstein, R. 1991. Targeting, disruption, replacement, and allele rescue: integrative DNA transformation in yeast. Methods Enzymol. 194:281-302.[CrossRef][Medline]
54. Ruone, S., A. R. Rhoades, and T. Formosa. 2003. Multiple Nhp6 molecules are required to recruit Spt16-Pob3 to form yFACT complexes and to reorganize nucleosomes. J. Biol. Chem. 278:45288-45295.
55. Sayle, R. A., and E. J. Milner-White. 1995. RASMOL: biomolecular graphics for all. Trends Biochem. Sci. 20:374-376.[CrossRef][Medline]
56. Sethy-Coraci, I., R. D. Moir, A. Lopez-de-Leon, and I. M. Willis. 1998. A differential response of wild type and mutant promoters to TFIIIB70 overexpression in vivo and in vitro. Nucleic Acids Res. 26:2344-2352.
57. Shaw, R. J., and D. Reines. 2000. Saccharomyces cerevisiae transcription elongation mutants are defective in PUR5 induction in response to nucleotide depletion. Mol. Cell. Biol. 20:7427-7437.
58. Shen, Y., G. A. Kassavetis, G. O. Bryant, and A. J. Berk. 1998. Polymerase (Pol) III TATA box-binding protein (TBP)-associated factor Brf binds to a surface on TBP also required for activated Pol II transcription. Mol. Cell. Biol. 18:1692-1700.
59. Sherman, F. 1991. Getting started with yeast. Methods Enzymol. 194:1-21.[Medline]
60. Sikorski, R. S., and P. Hieter. 1989. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122:19-27.
61. Stargell, L. A., and K. Struhl. 1996. A new class of activation-defective TATA-binding protein mutants: evidence for two steps of transcriptional activation in vivo. Mol. Cell. Biol. 16:4456-4464.[Abstract]
62. Stargell, L. A., and K. Struhl. 1995. The TBP-TFIIA interaction in the response to acidic activators in vivo. Science 269:75-78.
63. Sterner, D. E., P. A. Grant, S. M. Roberts, L. J. Duggan, R. Belotserkovskaya, L. A. Pacella, F. Winston, J. L. Workman, and S. L. Berger. 1999. Functional organization of the yeast SAGA complex: distinct components involved in structural integrity, nucleosome acetylation, and TATA-binding protein interaction. Mol. Cell. Biol. 19:86-98.
64. Tan, S., Y. Hunziker, D. F. Sargent, and T. J. Richmond. 1996. Crystal structure of a yeast TFIIA/TBP/DNA complex. Nature 381:127-151.[CrossRef][Medline]
65. Thomas, B. J., and R. Rothstein. 1989. Elevated recombination rates in transcriptionally active DNA. Cell 56:619-630.[CrossRef][Medline]
66. van Kempen, G. M., and L. J. van Vliet. 2000. Mean and variance of ratio estimators used in fluorescence ratio imaging. Cytometry 39:300-305.[CrossRef][Medline]
67. Yu, Y., P. Eriksson, L. T. Bhoite, and D. J. Stillman. 2003. Regulation of TATA-binding protein binding by the SAGA complex and the Nhp6 high-mobility-group protein. Mol. Cell. Biol. 23:1910-1921.
68. Yu, Y., P. Eriksson, and D. J. Stillman. 2000. Architectural transcription factors and the SAGA complex function in parallel pathways to activate transcription. Mol. Cell. Biol. 20:2350-2357.
69. Zhao, X., and W. Herr. 2002. A regulated two-step mechanism of TBP binding to DNA: a solvent-exposed surface of TBP inhibits TATA box recognition. Cell 108:615-627.[CrossRef][Medline]
This article has been cited by other articles:
| ||||||
nhp6a nhp6b spt15 ade2 ade3 ura3 with a YCp-URA3-ADE3-SPT15 plasmid) was transformed with a YCp-TRP1 library of TBP mutants. Nonsectoring colonies were identified, and then mated to strain DY7244 (MATa NHP6A NHP6B spt15 ade2 ade3 ura3 with a YCp-URA3-ADE3-SPT15 plasmid), and the resulting diploids were tested for sectoring and 5-FOA growth phenotypes. Diploid strains giving sectoring and 5-FOA-resistant phenotypes contain a TBP plasmid specifically lethal in an nhp6ab mutant.
