MCB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Talukder, A. H.
Right arrow Articles by Kumar, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Talukder, A. H.
Right arrow Articles by Kumar, R.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, August 2004, p. 6581-6591, Vol. 24, No. 15
0270-7306/04/$08.00+0     DOI: 10.1128/MCB.24.15.6581-6591.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Metastasis-Associated Protein 1 Interacts with NRIF3, an Estrogen-Inducible Nuclear Receptor Coregulator

Amjad H. Talukder, Anupama Gururaj, Sandip K. Mishra, Ratna K. Vadlamudi, and Rakesh Kumar*

Departments of Molecular and Cellular Oncology, University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030

Received 14 November 2003/ Returned for modification 28 January 2004/ Accepted 4 May 2004


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The transcriptional activity of estrogen receptor alpha (ER-{alpha}) is modified by regulatory action and interactions of coactivators and corepressors. Recent studies have shown that the metastasis-associated protein 1 (MTA1) represses estrogen receptor element (ERE)-driven transcription in breast cancer cells. With a yeast two-hybrid screen to clone MTA1-interacting proteins, we identified a known nuclear receptor coregulator (NRIF3) as an MTA1-binding protein. NRIF3 interacted with MTA1 both in vitro and in vivo. NRIF3 bound to the C-terminal region of MTA1, while MTA1 bound to the N-terminal region of NRIF3, containing one nuclear receptor interaction LXXLL motif. We showed that NRIF3 is an ER coactivator, hyperstimulated ER transactivation functions, and associated with the endogenous ER and its target gene promoter. MTA1 repressed NRIF3-mediated stimulation of ERE-driven transcription and interfered with NRIF3's association with the ER target gene chromatin. In addition, NRIF3 deregulation enhanced the responsiveness of breast cancer cells to estrogen-induced stimulation of growth and anchorage independence. Furthermore, we found that NRIF3 is an estrogen-inducible gene and activated ER associated with the ER response element in the NRIF3 gene promoter. These findings suggest that NRIF3, an MTA1-interacting protein, is an estrogen-inducible gene and that regulatory interactions between MTA1 and NRIF3 might be important in modulating the sensitivity of breast cancer cells to estrogen.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The steroid hormone 17ß-estradiol (E2) plays an important role in controlling the expression of genes involved in a wide variety of biological processes, including reproduction, development, and breast tumor progression (31). The biological effects of estrogen are mediated by its binding to the structurally and functionally distinct estrogen receptors (ERs), {alpha} and ß. ER-{alpha} is the major estrogen receptor in the mammary epithelium. Like other steroid nuclear receptors, ER-{alpha} comprises an N-terminal transcriptional activation function (AF1) domain, a central DNA-binding domain, and a C-terminal ligand-binding domain that contains a ligand-dependent transcriptional activation function 2 (AF2) domain (30). Binding of hormone to the ER triggers conformational changes that allow the ER to bind to the responsive elements in the target gene promoters. The ligand-activated ER-{alpha} then translocates to the nucleus, binds to the 13-bp palindromic estrogen response element (ERE) in the target gene promoters, and stimulates gene transcription, thereby promoting the growth of breast cancer cells. In addition, a series of recent studies also demonstrate other actions of the estrogen receptors, which involve protein-protein interactions (i.e., with AP-1 and SP-1) rather than direct DNA binding.

As with hormonal regulation, the transcriptional activity of ER is affected by a number of regulatory cofactors, including chromatin-remodeling complexes, coactivators, and corepressors (4, 9, 10, 20, 23). Coactivators generally do not bind to the DNA but are recruited to the target gene promoters through protein-protein interactions with the ER. Examples of ER coactivators include members of the p160 family, SRC1-3, AIBI, TRAM1, RAC3, CREB binding protein (CBP), and p300 (21). Corepressors preferentially associate with antagonist-occupied ER (8, 26, 35). Among the ER corepressors, NCoR and SMRT are widely characterized molecules that have been implicated in transcriptional silencing in the absence of ligands (16).

Evidence suggests that multiprotein complexes containing coactivators, ERs, and transcriptional regulators assemble in response to hormone binding and that they activate transcription. The molecular mechanisms of ER, the composition of the ER coactivator proteins, and the way these hormones elicit tissue or cell type-specific responses are active areas of investigation. A structural analysis of the ER coactivators has identified a five-amino-acid nuclear receptor (NR) LXXLL (where X is any amino acid) motif that can mediate coregulator binding to liganded ERs (11, 29, 34).

For transcription factors to access DNA, the repressive chromatin structure must be remodeled. Dynamic alterations in the chromatin structure resulting from the acetylation of histones can facilitate or suppress access of the transcription factors to nucleosomal DNA, leading to transcriptional regulation (17, 25). Hyperacetylated chromatin is generally associated with transcriptional activation, whereas hypoacetylated chromatin is associated with transcriptional repression (1, 6). Coactivators such as SRC1-3 and CBP/p300 have been shown to possess intrinsic histone acetyltransferase activity (12), while corepressors such as NCoR and metastasis-associated protein 1 (MTA1) are associated with histone deacetylases (7, 12, 18). The MTA1 gene was originally identified by differential expression in rat mammary adenocarcinoma metastatic cells and is shown to correlate well with the metastatic potential of several human cell lines and tissues (18, 28, 29). MTA1 has also been shown to repress ER-{alpha}-driven transcription in breast cancer cells (18). In spite of the corepressor function of MTA1, the nature of its target(s) remains unidentified.

To better understand the cellular functions of MTA1 in breast cancer cells, we performed a yeast two-hybrid screen to clone MTA1-interacting proteins and identified a relatively new nuclear receptor coregulator (NRIF3). Previous studies involving in vitro and transient expression assays have shown a potentiating role of NRIF3 in the transactivation functions of thyroid receptor and retinoid X receptor (14, 15). The NRIF3 protein consists of three major motifs, the C-terminal LXXIL (receptor-interacting domain, RID1), the N-terminal LXXLL (RID2), and the central coiled-coil region containing a putative leucine zipper-like motif (14). In this study, we have shown that NRIF3 is an MTA1-interacting protein. In addition, NRIF3 deregulation in breast cancer cells stimulated anchorage-independent growth, the expression of estrogen-inducible genes, as well as recruitment of NRIF3 to ER target gene promoter chromatin. Furthermore, we have provided evidence that NRIF3 itself is an estrogen-inducible gene as it contains an ER-responsive motif and that NRIF3 association with ERE-chromatin was inhibited by MTA1. These findings reveal a novel mechanism of ER transactivation functions involving NRIF3 and its regulatory feedback interactions with MTA1 in breast cancer cells.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Plasmid construction and screening of the two-hybrid library. The full-length MTA1 (amino acids1 to 715 [18]) was digested at the BamHI and XbaI (blunt end) sites and ligated to the pGBKT7 vector, which expresses proteins fused to amino acids 1 to 147 of the GAL4-DNA binding domain (DNA-BD) (Clontech), at the BamHI and PstI (blunt end) sites. MTA1 baits were constructed by deleting amino acids 1 to 254 from the N terminus of MTA1 by cutting and self-ligating with NcoI, which cleaves the first 254 amino acids. The remaining amino acids 255 to 715 of the C-terminal MTA1 was used as bait to screen a mammary gland cDNA library fused to the GAL4 activation domain according to the manufacturer's (Clontech) instructions. Positive clones were verified by one-on-one transformations and selection on agar plates lacking leucine and tryptophan (-LT) or adenine, histidine, leucine, and tryptophan (-AHLT) and also processed for a ß-galactosidase assay (33).

In vitro transcription, translation, and GST pulldown assays. In vitro transcription and translation of the test proteins were performed with the TNT-transcription-translation system (Promega). One microgram of desired DNA in the pcDNA3.1 vector (Invitrogen) was translated in the presence of [35S]methionine in a reaction volume of 50 µl with the T7-TNT reaction mixture. The reaction mixture was diluted to 1 ml with NP-40 lysis buffer, and an aliquot (250 µl) was used for each glutathione S-transferase (GST) pulldown assay. Two microliters of the translated reaction mixture was verified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and autoradiography. The GST pulldown assays were performed by incubating equal amounts of GST or GST fusion protein immobilized to glutathione-Sepharose beads (Amersham) with in vitro-translated 35S-labeled test protein. The mixtures were incubated for 2 h at 4°C and washed six times with NP-40 lysis buffer. Bound proteins were eluted with 2x SDS buffer, separated by SDS-PAGE, and visualized by fluorography (33).

Transient transfection, immunoprecipitation, and Western blotting. MCF-7 cells were transiently transfected with 1 µg of T7-NRIF3 and c-Myc-MTA1 or pcDNA (control vector) and T7-NRIF3 in a 70% confluent 100-mm plate with the Fugene method (Roche). Cells were lysed at 48 h posttransfection in high-salt buffer to get the nuclear extract and immunoprecipitated with c-Myc antibody (NeoMarker) for 4 h at 4°C. Rabbit anti-mouse antibody-Sepharose beads were added for 1 h. After 1 h, beads were centrifuged down, washed three times with washing buffer, boiled for 5 min in 2X SDS loading buffer, run on SDS-12% PAGE, transferred to a nitrocellulose blot overnight at 4°C, and developed against T7 antibody (mouse) or c-Myc antibody (mouse).

Deletion constructs of MTA1 and of NRIF3. Seven MTA1 deletion constructs were generated to map the binding site(s) of MTA1 with NRIF3 by a PCR-based procedure (29). Starting from the N-terminal region, the constructs were named N1-MTA1 to N7-MTA1. All the forward (F) primers including the ATG start codon primer contain an EcoRI site, and all the reverse (R) primers including the stop codon (TAG) primer contain a SalI site. The ATG start codon primer is 5'-GCCGCCGGAATTCACATGGCCGCCAACA-3', and the stop codon (TAG) primer was 5'-AGGTGGGGGTCGACCCTAGTCCTCCCG-3'. The construction of N1-MTA1 through N5-MTA1 used the ATG start codon primer plus N1R 5'-ACTCGAATGTCGACTTTATCTGCCA-3', N2R 5'-AGGCCCGGCCGTCGACAGGGCTCTGGCCCGG-3', N3R 5'-ACTGCGGTGTCGACCTGGCCTCTCTCCA-3', N4R 5'-ACCGAAGCACGTCGACCAGCGGCTT-3', and N5R 5'-TCAGGCGCACGTCGACGGGGTAGGACT-3', respectively. For the construction of N6-MTA1 (amino acids422 to 715) and N7-MTA1 (amino acids542 to 715), we used the stop codon primer and N6F 5'-TGATGGAGGAATTCCAGGACCAAAC-3' and N7F 5'-GAAGCCGTGCGAATTCATCTTGAGA-3', respectively. All the PCR products were run in a 0.8% agarose gel, purified by Gene Clean or Mermaid (Bio 101), cut with EcoRI plus SalI, and ligated to the pGEX-5X vector at the EcoRI and Xho1 sites. After confirming the sequences, these constructs were cut at the EcoRI and NotI sites and ligated with pcDNA3.1A vector at the EcoR1 and NotI sites for T7 tag protein (24).

A similar PCR-based procedure was used to generate three deletion constructs of NRIF3 with either the start codon primer 5'-ACCCGAGGATCCGAATGCCTGTTAAAAGA-3' or the stop codon primer 5'-TGCATTTCTTGCGGCCGCCTCAGTTTAAAATGGC-3'. The following constructs were made by PCR with the start codon primer plus 161R (amino acids 1 to 161), 5'-GTCAAGATGAGCGGCCGCTTTGTGAGGAGGTCCT-3' and 94R (1 to 94 amino acids) 5'-TGATTTCTTCTGGCGGCCGCTCAACTTTTGATAAC-3', and with stop codon primer plus 29F (amino acids 29 to 177), 5'-CAAGGAGGATCCGTGTTATAACTTATTCTCC-3'. After Gene Clean, the PCR products were digested with BamHI and NotI and ligated to a pcDNA3.1A vector at the same site. For site-directed mutagenesis of the LXXLL (amino acids 9 to 13) motif of full-length NRIF3, we used forward primer 5'-GGATGGTCAGTTTGAAGAAAATTCA-3' and reverse primer 5'-TGAATTTTCTTCAAACTGACCATCC-3'. We changed the last two leucine residues of the LXXLL motif to LXXQF by changing CTG to CAG and TTA to TTT with Stratagene's QuickChange site-directed mutagenesis kit.

Cell cultures and reagents. Human breast cancer cells were cultured in Dulbecco's modified Eagle's medium (DMEM)/F12 medium supplemented with 10% fetal bovine serum. For estrogen treatment experiments, regular medium was replaced by medium containing 3% DCC (charcoal-stripped serum). Antibody against the c-Myc tag was purchased from MBL International, Watertown, Mass. Anti-ER antibody was from Upstate Biotechnology, whereas anti-mouse and anti-rabbit antibody-horseradish peroxidase conjugates were from Amersham, Piscataway, N.J.

Stable cell lines and Northern blotting. MCF-7 cells were transfected with T7-tagged NRIF3. After 48 h, G418 (500 µg/ml, final concentration) was added and selection pressure was maintained for 3 weeks. Clones from each plate were pooled and maintained as individual clones. Expression of T7-NRIF3 was verified by Northern blot (30 µg of total RNA/lane) and Western blot with anti-T7 monoclonal antibody.

Transfection and promoter assays. Cells were maintained in DMEM/F12 (1:1) supplemented with 10% fetal calf serum. For reporter gene transient transfections, cells were cultured in medium without phenol red and containing 3% charcoal-stripped (DCC) serum for 24 to 36 h, and promoter assays were performed at 48 h posttransfection as previously described (28).

Total RNA isolation and cDNA microarray. Total RNA was isolated from cell lines stably transfected with pcDNA and NRIF3 (clone 19) with Trizol (Life Technologies, Inc., Rockville, Md.) purification. Human estrogen signaling pathway GE array (hGEA9914010) was purchased from Super Array Inc., Bethesda, Md. After checking the RNA quality, 10 µg of total RNA was used to synthesize cDNA in presence of [P32]dCTP according to the manufacturer's instruction. Both the cDNA probes were purified and equal counts of probes were hybridized with two identical microarray blots and detected with phosphorimage scanning. The signal of the two blots was normalized with ß-actin.

Chromatin immunoprecipitation assay. The T7-NRIF3 stable clone and pcDNA control vector clone were used for the chromatin immunoprecipitation study. The cells were kept for 48 h prior to estrogen or ICI 182,780 (ICI) treatment, and ICI was added 1 h before estrogen treatment. The chromatin immunoprecipitation assay was performed as described (18). Approximately 106 cells were treated with 1% formaldehyde (final concentration) for 10 min at 37°C to cross-link histones to DNA and washed twice with phosphate-buffered saline containing protease inhibitors cocktail. Cells were lysed by sonication and immunoprecipitated with T7 monoclonal antibody (Novagen). The immunoprecipitates were washed, the DNA was eluted off the beads, and purified DNA (phenol-chloroform extraction) was subjected to PCR.

The sequences of the forward and reverse primers for pS2 promoter used in this study were 5'GAATTAGCTTAGGCCTAGACGGAATG-3' and 5'AGGATTTGCTGATAGACAGAGACGAC-3', respectively. 17ß-Estradiol, ICI-182780, and stock chemicals were from Sigma (23, 28, 35). The sequences of the forward and reverse primers for the NRIF3 promoter were 5'ACTACCTTTCTCAGCCTCTGGTAACC-3' (spanning region –5193 to –5218) and 5'GGGAACCCTCTTACACTGTTGGTAG-3' (spanning region –4730 to –755), respectively. The other pair of primers for NRIF3 promoter did not work.

Interference with NRIF3 expression by siRNA. We used four sets of small interfering RNAs (siRNAs) designed by Qiagen to target human NRIF3 sequences. Among the four sets, one pair (forward and reverse sequence are same) worked the best and was used here. The sequence of NRIF3 siRNA was r(UCUCCUGUGCAAUCACAUUU)d(TT). As a control, we used a commercially available nonspecific random siRNA. MCF-7 cells were seeded at 30% density the day before transfection in six-well plates. On the day of transfection, cells were changed to antibiotic-free 10% serum or 3% DCC medium (for estrogen treatment). Transfections were performed with the Oligofectamine reagent (Invitrogen) according to the manufacturer's instructions with 12 µl of 20 µM siRNA and 4 µl of Oligofectamine reagent/well in six-well plates (50 nM final concentration). For estrogen treatment, cells were transfected with siRNA in 3% DCC serum. After 60 h, cells were treated for 8 h with estrogen (10–9 M), and total RNA was analyzed by Northern hybridization. For luciferase assay, cells were retransfected after 24 h of siRNA transfection with ERE-luciferase or GAL4-luciferase plus other plasmids in 3% DCC medium and kept for another 48 h, including treatment with estrogen during the last 8 h before harvesting.

Proliferation and soft agar assays. Cell proliferation assays were performed with the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) dye method as described (27). Colony growth assays were performed as described previously (14). Briefly 1 ml of solution of 0.6% Difco agar in DMEM supplemented with 10% fetal bovine serum with insulin was layered onto tissue culture plates (60 by 15 mm). Stable clones of pcDNA and NRIF3 (50,000 cells/plate) were mixed with 1 ml of 0.36% Bactoagar solution in DMEM prepared in a similar manner and layered on top of the 0.6% Bactoagar layer. Plates were incubated for 28 days. For treatment with estrogen, cells were replaced with DCC serum and then 10–9 M estrogen was added.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Identification of NRIF3 as an MTA1-interacting protein. MTA1 is expressed in a wide range of tissues, yet the nature of its downstream targets remains unknown. To identify novel MTA1-interacting proteins, we performed a yeast two-hybrid screening of the mammary gland cDNA expression library with the C-terminal MTA1 (amino acids 255 to 715) as the bait. Yeast cells expressing the Gal4 fusion protein were transformed with the above bait. Screening of 2 x 106 transformants resulted in the isolation of several positive clones. Sequencing of several isolates from one such positive clone identified a previously known novel nuclear receptor coregulator (NRIF3) assigned to chromosome 1p31.3 (GenBank accession number AF175306.1). To further confirm NRIF3's interaction with MTA1, we cotransformed C-terminal or N-terminal MTA1 or MTA1 constructs with NRIF3. The transformed colonies showed the ability to grow in medium lacking adenosine, histidine, tryptophan, and leucine (-AHTL) and to turn blue in a ß-galactosidase assay, while cells cotransformed with the control GBK vector did not do so (Fig. 1A).



View larger version (43K):
[in this window]
[in a new window]
 
FIG. 1. Identification of NRIF3 as an MTA1 binding protein. (A) Yeast cells were cotransfected with the GAD-NRIF3 and GBD control vector or GBD-MTA1 (amino acids 1 to 715) or GBD-C-terminal MTA1 (ctMTA1, amino acids 255 to 715), GBD-N-terminal MAT1 (amino acids 1 to 173), or GBD-MTA1s. Cotransformants were plated on selection plates lacking leucine and tryptophan (-LT) (bottom panel) or lacking adenine, histidine, leucine, and tryptophan (-AHLT) (middle panel). Growth was recorded after 72 h. For the ß-galactosidase assay, filter lift assays were performed. Blue indicates specific interaction of two proteins (upper panel, second lane). (B and C) MTA1 interact with NRIF3 in vitro in GST pulldown assays. In vitro-translated, 35S-labeled MTA1 protein was incubated with either GST-NRIF3 or GST alone (B) or in vitro-translated, 35S-labeled NRIF3 protein was incubated with either GST-MTA1 or GST alone (C) and analyzed by SDS-PAGE and autoradiography. (D) MCF-7 cells were cotransfected with c-Myc-MTA1 and T7-NRIF3 or T7-MTA1 and the pcDNA vector. Cells were lysed after 36 h, immunoprecipitated with anti-c-Myc monoclonal antibody to pull down the c-Myc-MTA1 immune complex, resolved on SDS-12% PAGE, and immunoblotted with anti-T7 and anti-c-Myc antibodies.

 
NRIF3 interacts with MTA1 in vitro. To confirm the interaction between NRIF3 and MTA1, we next examined the ability of in vitro-translated MTA1 protein to bind with GST-NRIF3 in vitro. NRIF3 interacted efficiently with GST-MTA1 but not with GST alone in GST pulldown assays. Conversely, in vitro-translated NRIF3 protein also interacted with GST-MTA1 (Fig. 1B and C).

NRIF3 interacts with MTA1 in vivo. To demonstrate the interaction of NRIF3 and MTA1 in breast cancer cells, we transfected c-Myc-MTA1 and T7-NRIF3 or a pcDNA control vector in MCF7 cells (Fig. 1D). Immunoprecipitation of cell lysates with an anti-c-Myc monoclonal antibody was followed by immunoblotting with T7 or c-Myc monoclonal antibodies. The results showed specific interaction of c-Myc-MTA1 and T7-NRIF3 (Fig. 1D, right lane).

NRIF3 interacts with the C-terminal regions of MTA1. Next, we defined the minimal region of MTA1 required for its interaction with NRIF3. MTA1 has several important domains involved in protein-protein interactions, DNA binding, and signal transduction (Fig. 2A). Several C- and N-terminal MTA1 deletion constructs were generated and expressed as 35S-labeled proteins; they were then subjected to GST pulldown assays with the GST-NRIF3 fusion protein. The results suggested that NRIF3 binds amino acids 165 to 387 and amino acids 442 to 542 of MTA1, which contain the DNA binding domain and SH3 binding site, respectively (Fig. 2B). To define the binding region(s) of NRIF3 that are important for MTA1 interaction, we generated a series of NRIF3 deletion constructs. The results of the GST pulldown assays indicated that NRIF3 uses amino acids 1 to 28, which contain the LXXLL motif, to interact with MTA1 (Fig. 2C and D).



View larger version (50K):
[in this window]
[in a new window]
 
FIG. 2. Mapping of minimum interacting domains of MTA1 and NRIF3. (A) Schematic representations of MTA1 deletion constructs. Fl (full-length; amino acids 1 to 715), N1 (amino acids 1 to 164), N2 (amino acids 1 to 387), N3 (amino acids 1 to 441), N4 (amino acids 1 to 535), N5 (amino acids 1 to 630), N6 (amino acids 442 to 715), and N7 (amino acids 542 to 515). (B) GST pulldown assays with 35S-labeled in vitro-translated MTA1 polypeptides and GST-NRIF3 protein. The C-terminal amino acids 165 to 387 and 442 to 542 of MTA1 are required for binding with NRIF3. (C and D) Mapping of NRIF3 interaction domains of MTA1. (C) Schematic representation of NRIF3 deletion constructs representing amino acids 1 to 161 and amino acids 1 to 94, amino acids 29 to 177, and the LXXQF mutation of full-length MTA1. (D) GST pulldown assays with 35S-labeled in vitro-translated NRIF3 polypeptides and GST-MTA1 protein.

 
NRIF3 acts as a coactivator of ER-{alpha}. The presence of an LXXLL motif in NRIF3 and the known importance of the LXXLL motif in interaction with nuclear receptors raised the possibility of a potential role for NRIF3 in the ER pathway. To explore this notion, we examined the potential ability of NRIF3 to influence transcription from an ERE-luciferase reporter system with ER-positive ZR-75 breast cancer cells. Coexpression of NRIF3 in ZR-75 cells potentiated the stimulation of ERE-driven transcription in the cells treated with E2 compared with control vector-transfected cells (Fig. 3A). The expression of NRIF3 alone in ZR-75 cells had a modest but reproducible stimulatory effect on reporter activity in the absence of estrogen.



View larger version (33K):
[in this window]
[in a new window]
 
FIG. 3. NRIF3 acts as a coactivator of ER-{alpha}. (A) NRIF3 can induce ERE-luciferase activity. ZR-75 cells were transfected with ERE-luciferase on six-well plates (200 ng/well) in the absence or presence of NRIF3 (150 ng/well) treated with or without estrogen for 15 h. The luciferase assay was done 48 h posttransfection (n = 3). (B) NRIF3 induces activation function domain 2 (AF2) of the ER. HeLa cells were cotransfected with GAL4-luciferase (200 ng/well) and GAL4-AF2 (200 ng/well) in the absence or presence of NRIF3 (50 ng/well) (n = 3). (C) The N-terminal amino acids 1 to 28 of NRIF3 are required for the induction of ERE-luciferase activity. MCF-7 cells were transfected with ERE-luciferase (200 ng/well) in a six-well plate in the absence or presence of NRIF3 or –28NRIF3 (150 ng/well). The luciferase assay was done 48 h posttransfection (n = 3). The inset shows expression of transfected gene products by Western blotting with an anti-T7 monoclonal antibody. (D) The N-terminal LXXLL (amino acids 9 to 13) motif of NRIF3 is required for interaction with ER. The GST pulldown assay involved in vitro-translated 35S-labeled NRIF3 (amino acids 1 to 177, amino acids 29 to 177, or full-length mutant) incubated with GST-AF2 or GST alone and analyzed by SDS-PAGE and autoradiography.

 
We also tested this interaction by examining the recruitment of NRIF3 complexes to ER elements with a Gal4-ER/Gal4-luciferase assay system (28). This system involves transient transfection of two plasmids, Gal4-AF2 (ligand-binding domain of ER-{alpha}) and Gal4-luciferase reporter, and luciferase activation depends on E2 stimulation of the AF2 domain. In this assay, E2-mediated activation of the AF2 function was further stimulated by NRIF3 expression (Fig. 3B), suggesting that NRIF3 expression hyperstimulates ER transactivation function. Similar results were obtained when these experiments were performed with MCF-7 cells stably expressing NRIF3 (see below). These results suggest that NRIF3 may respond differently to different transactivation reporter assays in different cellular contexts, as a previous study showed no effect of NRIF3 on ERE-luciferase activity in HeLa cells (14)

LXXLL motif of NRIF3 required for interaction and modulation of ER transactivation functions. Since MTA1 interacted with amino acids 1 to 28 of NRIF3, which contain the NR binding motif LXXLL (Fig. 2D), we next examined the role of amino acids 1 to 28 in the observed NRIF3 regulation of ER transactivation. As illustrated in Fig. 3C, transient expression of the T7-NRIF3 but not the T7-NRIF3 mutant lacking the first 1 to 28 amino acids stimulated ER transactivation activity. To show an essential role of the first 28 amino acids (containing the LXXLL motif) of NRIF3 for its binding with the AF2 domain of ER, we next performed GST pulldown assays with GST-AF2 and newly synthesized NRIF3 or –28 NRIF3 (lacking the LXXLL motif) or point-mutated NRIF3 (LXXLL -> LXXQF) (Fig. 3D). The results indicated that GST-AF2 could effectively bind with the in vitro-translated full-length NRIF3 but not with –28 NRIF3 (lacking the LXXLL motif) or with point-mutated NRIF3 (Fig. 3D). These results suggest that the LXXLL motif plays an important role in the interaction of NRIF3 with ER and NRIF3's ER transactivation function.

NRIF3 stimulates the expression of estrogen-responsive genes. To explore the potential role of NRIF3 in the ER pathway and the biology of breast cancer cells, we next generated pooled MCF-7 clones overexpressing T7-NRIF3 or pcDNA. Expression of T7-NRIF3 was determined by immunoblotting the lysates from exponentially growing cells with an anti-T7 monoclonal antibody (Fig. 4A, upper panel). In general, these clones expressed two- to fourfold elevated levels of exogenous T7-NRIF3 over the endogenous level of NRIF3 as analyzed by Northern hybridization with the NRIF3 cDNA (Fig. 4A, lower panels). We next examined the effect of NRIF3 on the status of the ER pathway. cDNA probes from both pcDNA and NRIF3-expressing MCF-7 clones were generated by reverse transcription-PCR, and equal amounts of probe for each clone were hybridized with two identical human estrogen signaling pathway GE array cDNA blots.



View larger version (56K):
[in this window]
[in a new window]
 
FIG. 4. NRIF3 stimulates the expression of E2-responsive genes and associates with the ERE-responsive chromatin. (A) NRIF3 stable cell lines. Upper panels show expression of T7-NRIF3 protein by Western blotting with T7 monoclonal antibody. Vinculin expression was used as a loading control. Lower panels show Northern blot analysis of NRIF3 mRNA expression. Glyceraldehhyde-3-phosphate dehydrogenase (GAPDH) and total RNA agarose gel picture were used as loading controls. (B) Equal amounts of cDNA probes from pcDNA and NRIF3 clone 19 were generated by reverse transcription-PCR, hybridized with two identical human estrogen signaling pathway GE array blots, and detected by phosphorimager scanning. The signals of the two blots were normalized to ß-actin. Relative expression of E2-responsive genes in the NRIF3 clone was compared with that of the pcDNA clone. (C) Total RNA was made from MCF-7 stable pooled clones expressing pcDNA and NRIF3, hybridized with pS2 cDNA (upper panel), and reprobed with the HMG1 cDNA probe (middle panel). The same blot was hybridized with the glyceraldehhyde-3-phosphate dehydrogenase cDNA probe (bottom panel). (D) E2 induces while tamoxifen inhibits the expression of PS2 and HMG1 mRNA expression. (E) Recruitment of NRIF3 to estrogen target gene promoter. Stable clones expressing either T7-NRIF3 or control vector in MCF-7 cells were treated with estrogen (10–9 M) or with ICI (10–7 M) or both for the indicated times. Cells were cross-linked and processed for the chromatin immunoprecipitation assay by immunoprecipitation with anti-T7 antibody, and PCR was performed on the pS2 promoter.

 
Figure 4B profiles the estrogen-inducible genes affected by NRIF3 overexpression in breast cancer cells. PS2 and HMG1 were induced in the NRIF3 clone compared with the pcDNA clone (Fig. 4B). Northern blot hybridization of RNA from MCF-7/T7-NRIF3 clones revealed upregulation of estrogen-inducible gene pS2 mRNA and HMG1 mRNA, two known estrogen-induced genes (Fig. 4C). PS2 mRNA as well as HMG1 mRNA were upregulated in MCF-7 cells treated with estrogen and downregulated by 4-hydroxy-tamoxifen (Fig. 4D). These results suggest that NRIF3-mediated stimulation of ERE transcription is accompanied by increased steady-state levels of ER target genes.

NRIF3 associates with the ERE-responsive promoters in vivo. To demonstrate the potential importance of NRIF3 in ERE transcription, we used the chromatin immunoprecipitation assay to analyze whether T7-NRIF3 associates with the endogenous ERE-containing promoters. Stable clones of T7-NRIF3 or pcDNA3.1A in MCF-7 cells were treated with E2 with or without antiestrogen ICI-182780 and processed for immunoprecipitation with specific antibodies against T7. Genomic DNA fragments bound to T7-NRIF3 were analyzed by PCR with primers spanning the ERE elements present in the promoter of the pS2 sequence, for a potential E2-triggered association of T7-NRIF3 with the promoter of the ER target gene (Fig. 4E). The results indicated that E2 treatment triggered a significant increase in the amount of pS2 target gene promoter chromatin associated with T7-NRIF3 (Fig. 4E). These findings suggest that NRIF3 interacts with the ER target gene chromatin and facilitates ligand-dependent transcription from the ERE-containing promoter.

MTA1 inhibits NRIF3 stimulation of ERE transcription. Since MTA1 acts as a corepressor of the ER pathway (18) and since NRIF3 is both an ER coactivator and an MTA1-interacting protein (this study), we next investigated the potential impact of MTA1 deregulation on NRIF3-mediated stimulation of ERE transcription. MCF-7 breast cancer cells were cotransfected with ERE-luciferase, MTA1, or pcDNA (control vector), and with or without T7-NRIF3. Coexpression of MTA1 suppressed ERE-driven transcription (Fig. 5A). Similarly, MTA1 deregulation in MCF-7 cells stably expressing T7-NRIF3 also prevented the ability of E2 to stimulate ERE transcription (Fig. 5B). Conversely, coexpression of NRIF3 in MCF-7 cells stably expressing T7-MTA1 showed hyperstimulation of ERE transcription (Fig. 5C). Consistent with these results, coexpression of MTA1 resulted in a substantial inhibition in the amount of pS2 target gene promoter chromatin associated with NRIF3 (Fig. 5D), suggesting that the hyperactivation function of NRIF3 may be linked with its recruitment to the target gene promoter chromatin and MTA1 overexpression represses NRIF3 regulation of the ER pathway. Collectively, these results suggest that regulatory interactions between MTA1 and NRIF3 might influence ERE-driven transactivation.



View larger version (43K):
[in this window]
[in a new window]
 
FIG. 5. Modulation of transactivation function of ER by NRIF3 and MTA1. (A) MCF-7 cells were cotransfected with ERE-luciferase on six-well plates (200 ng/well) and pcDNA vector or T7-MTA1 (500 ng/well) in the absence or presence of NRIF3 (150 ng/well). The luciferase assay was done 48 h posttransfection (n = 3). (B) MTA1 represses f E2-mediated induction of ERE-luciferase. Stable clones of pcDNA or NRIF3 were transfected with ERE-luciferase in the absence or presence of T7-MTA1 (500 ng/well) and treated with E2 (10–9 M) or ICI (10–8 M) for 15 h, and luciferase activity was measured 48 h after transfection (n = 3). (C) NRIF3 promotes ERE-luciferase activity in stable clones of pcDNA and T7-MTA1. Cells were cotransfected with ERE-luciferase in the absence or in presence of NRIF3 (500 ng/well) plus E2, and luciferase activity was measured 48 h posttransfection (n = 3). (D) MTA1 modifies NRIF3's association with the target chromatin. MCF7 cells were transfected with T7-NRIF3 or Myc-MTA1 or both. Subsequently, cells were treated with or without E2 (10–9 M) for 3 h; chromatin immunoprecipitation analysis of the pS2 (304 bp) promoter was performed.

 
Estrogen-inducible nature of NRIF3. The results from the above studies raised the possibility that NRIF3 itself could be regulated by estrogen. To test this hypothesis, we next examined the effect of anti-estrogen ICI-182780 on the levels of NRIF3 mRNA in MCF-7 breast cancer cells. As shown in Fig. 6A, inclusion of ICI in the culture medium resulted in almost complete downregulation of NRIF3 mRNA, suggesting the E2-inducible nature of NRIF3. Accordingly, E2 treatment of MCF-7 cells led to a significant upregulation of NRIF3 mRNA (Fig. 6B). Both the baseline and the E2-induced levels of NRIF3 were effectively blocked by the transcription inhibitor actinomycin D (Fig. 6C).



View larger version (55K):
[in this window]
[in a new window]
 
FIG. 6. Modulation of NRIF3 mRNA expression by estrogen and antiestrogen. (A and B) MCF-7 cells were treated with E2 (10–9 M) in the absence or presence of ICI or 4-hydroxytamoxifen (10–8 M) for the indicated times. Total RNA (20 µg) was analyzed by Northern blotting with an NRIF3 cDNA probe. Glyceraldehhyde-3-phosphate dehydrogenase (GAPDH) and total RNA agarose gel picture were used as loading controls. (C) Estrogen induces NRIF3 transcription. MCF-7 cells were treated with cycloheximide (50 µg/ml) or actinomycin D (10 µg/ml) in the presence or absence of E2 (10–9 M) for 3 h. Total RNA was isolated, and the levels of NRIF3 mRNA were detected by Northern blotting. (D) E2 signaling promotes NRIF3 interaction with the endogenous ER pathway. Schematic presentation of the tentative NRIF3 promoter (upper panel). MCF-7 cells were treated for 3 h with or without estrogen (10–9 M). Subsequently, the cells were processed for the chromatin immunoprecipitation assay with anti-ER-{alpha} antibody, and PCR was performed with the primers from the NRIF3 promoter. The bottom panel shows PCR analysis of the input DNA. The middle panel demonstrates PCR analysis of the NRIF3 promoter fragments associated with ER-{alpha}. The other two pair of primers did not work.

 
To gain a deeper view of E2 regulation of NRIF3, we carefully analyzed the regulatory region of the genomic NRIF3 clone (GenBank no. NT_032977). It was interesting that there were three potential ER-responsive half-sites at bp –2864, –4237, and –5078 of the putative NRIF3 promoter. To explore whether activated ER was recruited to the NRIF3 promoter chromatin around one or more of these ERE sites, we carried out a chromatin immunoprecipitation assay with anti-ER antibody and analyzed the potential increased association of the NRIF3 promoter region or regions with specific primers spanning the ERE elements present in the promoter of the NRIF3 sequence. The results indicated that estrogen treatment triggered a significant increase in the association of ER with the NRIF3 target gene promoter specifically around bp –4730 to –5218 from the transcriptional start site chromatin associated with ER (ER-responsive half-site at bp –5078 of the NRIF3 promoter) (Fig. 6D). These findings suggest that activated ER interacts with the ERE region in the NRIF3 gene chromatin and thus facilitates E2-dependent increased expression of NRIF3.

Modulation of ER-responsive pathways by the status of endogenous NRIF3. To understand the effect of endogenous NRIF3 upon ER responsiveness, we next limited the endogenous levels of NRIF3 in MCF-7 cells with NRIF3-specific siRNA. Exponentially growing MCF-7 cells were transfected either with NRIF3-specific siRNA or with control siRNA. We found that downregulation of NRIF3 expression in MCF-7 cells resulted in a substantial reduction in the expression of pS2 and HMG1, two ER-regulated genes (Fig. 7A). To determine whether the status of the endogenous NRIF3 influences the ability of estrogen to induce ER-responsive genes, we repeated the above experiments with MCF-7 cells grown in phenol red-free medium supplemented with 3% charcoal-stripped serum and treated with or without estrogen (Fig. 7B). These findings suggest that depletion of endogenous NRIF3 reduces the ability of estrogen to induce ER-regulated genes.



View larger version (30K):
[in this window]
[in a new window]
 
FIG. 7. Interference with NRIF3 expression reduces ER-responsive pathways. (A) Interference with NRIF3 expression decrease the expression of PS2 and HMG1. MCF-7 cells were treated with control siRNA or NRIF3 siRNA for 72 h, total RNA was isolated, and expression of NRIF3, PS2, and HMG1 mRNAs was determined by Northern hybridization. ß-Actin and total RNA agarose gel picture were used as loading controls. (B) Downregulation of endogenous NRIF3 severely inhibits the ability of estrogen to induce ER-inducible genes. MCF-7 cells grown in the presence of 3% DCC serum were treated with control siRNA or NRIF3 siRNA for 72 h, total RNA was isolated, and expression of NRIF3, PS2, and HMG1 mRNAs was determined by Northern hybridization. (C) Effect of endogenous NRIF3 on ER transactivation. ZR-75 cells were transfected with control or NRIF3 siRNA. After 24 h, cells were transfected with ERE-luciferase (200 ng/well) on six-well plates in the absence or presence of NRIF3 (150 ng/well) and treated with or without estrogen for 15 h, and ERE-luciferase activity was measured (n = 3). (D) NRIF3 induces activation function domain 2 (AF2)-driven transactivation. HeLa cells were transfected with control or NRIF3 siRNA. After 24 h, cells were transfected with GAL4-luciferase (200 ng/well) and GAL4-AF2 (200 ng/well) in the absence or presence of NRIF3 (50 ng/well) and treated with or without estrogen for 15 h, and luciferase activity was measured (n = 3).

 
To further delineate the role of the endogenous NRIF3, we also examined the effect of NRIF3 downregulation on the estrogen-stimulated ERE-luciferase activity in MCF-7 cells (Fig. 7C). We found that downregulation of endogenous NRIF3 blocks the observed potentiating effect of NRIF3 upon ligand-induced ER transactivation (Fig. 7C). Similar results were obtained when these studies were performed in HeLa cells with the Gal4-Luc and Gal4-AF2 system (Fig. 7D). In brief, these results clearly demonstrate the significance of NRIF3 in influencing ER transactivation functions.

Effect of NRIF3 on the biology of breast cancer cells. To understand the potential influence of NRIF3 in breast cancer cells, we first examined the effect of estrogen on the proliferation of pooled clones of MCF-7 cells stably expressing T7-NRIF3 or pcDNA (control vector). The results indicated that NRIF3 overexpression promoted the baseline as well as E2-induced growth rates of MCF-7 cells (Fig. 8A), suggesting a potential role of NRIF3 in the E2 responsiveness of breast cancer cells. Consistent with these results, E2 stimulation of MCF-7 and NRIF3 cells was also accompanied by increased ability to grow in an anchorage-independent manner that was further induced by E2 treatment (Fig. 8B).



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 8. NRIF3 modulates the growth of breast cancer cells. (A) NRIF3 promotes cell proliferation. MCF-7 pooled clones expressing NRIF3 or pcDNA were plated onto six-well plates (10,000 cells/well) in triplicate. After 24 h, the medium was replaced by 3% phenol red-free medium supplemented with charcoal-stripped serum for another 24 h and treated with E2 (10–9 M) for 24 h. Cell growth was measured by the MTT assay. (B) NRIF3 enhances anchorage-independent growth. Colony growth assays were performed as described in the text. ZR-75 stable pooled cells were plated in triplicate and maintained for 28 days in the absence or presence of E2 (10–9 M), and the total number of colonies was recorded.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
It is increasingly accepted that the transactivating functions of ER-{alpha} are regulated by the combined action of coregulators, including coactivators and corepressors. Since the target gene promoter chromatin is a highly dynamic structure, the transactivating functions of coactivators are likely to be influenced by corepressors and any potential deregulation of one component will have functional implications for the action of other components. In this context, we found that a corepressor, MTA1, can influence the ability of the NRIF3 coactivator to confer estrogen hypersensitivity on breast cancer cells. This could be an important way of regulating ER transactivation in breast cancer cells.

The results presented here identified NRIF3, a novel bifunctional nuclear receptor coregulator, as an MTA1-interacting protein by yeast two-hybrid screening. We showed that MTA1 interacted with NRIF3 and that NRIF3 interacted with MTA1, which contains SH3 and DNA binding domains. Interestingly, a newly discovered variant of MTA1 with an identical N-terminal region, MTA1s, showed no such interaction with NRIF3, suggesting that NRIF3 is a specific binding protein for MTA1.

In addition, the results presented here also provide evidence that NRIF3 interacted with the AF2 domain of the ER, stimulated the ER transactivation function, and associated with the ER target gene promoter chromatin. Structural and functional analyses of several coactivators reveals that coactivators interact with the ligand-bound AF2 domain through the LXXLL motif and are sufficient to mediate the binding of coactivators to ligand-bound NRs. A single LXXLL motif is enough to allow activation of ER by estrogen. Interestingly, the N-terminal region of NRIF3 contains one LXXLL motif, and deletion of this region abolished the ability of NRIF3 to interact with the ER and modulate ER transactivation functions. In the context of MTA1, we showed that NRIF3 associates with the ER target gene pS2 promoter chromatin and that MTA1 inhibits NRIF3 recruitment to the pS2 gene chromatin.

Our finding that the ER coregulator NRIF3 interacts with MTA1, an ER corepressor, was interesting, as it raised the possibility that the final outcome of the ER transactivation function was influenced by complex protein-protein interactions rather than by isolated interaction with one class of proteins. From our results, it appeared that MTA1 has inhibitory activity against NRIF3-mediated interaction with ER and stimulation of ER transactivation. A modest but significant reversal of MTA1-NRIF3 recruitment on one of the E2 target genes, i.e., the pS2 promoter, was achieved by E2 stimulation of cells. We also found that the ER association with NRIF3 was abolished when NRIF3 interacted with the MTA1 complex. Modest but distinct withdrawal of NRIF3 from the pS2 promoter in the presence of MTA1 may provide clues about the dominance of MTA1's corepressive function.

The finding that NRIF3 overexpression was sufficient to induce the expression of ER target gene pS2 and promote the stimulation of cell growth and anchorage-independent growth of breast cancer cells was surprising, as it reveals a potential role of NRIF3 in amplifying the action of estrogen. In fact, it was also discovered that NRIF3 itself is an estrogen-responsive gene. The putative promoter of NRIF3 contains an ERE motif, and activated ER is recruited to the NRIF3 gene chromatin. The significance of our findings is based on the observation of MTA1 association of NRIF3 with the ER target gene promoter chromatin. Since the level of MTA1 might be upregulated in some breast cancer cells (18), our current findings imply a potential suppression of the ER coregulator functions of NRIF3 by a pathological level of MTA1 and suggest that these events may modulate the hormonal response in breast cancer cells. In addition, it is also possible that the observed NRIF3-MTA1 interaction might provide a negative-feedback regulation of E2 regulation of the expression and functions of NRIF3 in breast cancer cells.

In summary, the present study identified NRIF3 as an MTA1-interacting protein, established the coactivator function of NRIF3, revealed the E2-inducible nature of NRIF3, and provided new evidence to suggest that the transactivation function of NRIF3 is influenced by regulatory interactions between NRIF3 and MTA1.


    ACKNOWLEDGMENTS
 
We thank Mahitosh Mandal for initial characterization of stable clones.

This study was supported in part by NIH grants CA098823, CA80066, and CA65746 (R.K.).


    FOOTNOTES
 
* Corresponding author. Mailing address: Departments of Molecular and Cellular Oncology, University of Texas M. D. Anderson Cancer Center, Houston, TX 77030. Phone: (713) 745-3558. Fax: (713) 745-3558. E-mail: rkumar{at}mdanderson.org. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Blanco, J. C., S. Minucci, J. Lu, X. J. Yang, K. K. Walker, H. Chen, R. M. Evans, Y. Nakatani, and K. Ozato. 1998. The histone acetylase PCAF is a nuclear receptor coactivator. Genes Dev. 12:1638-1651.[Abstract/Free Full Text]

2. Borrmann, L., I. Kim, I. The, D. Schultheiss, P. Rogalla, and J. Bullerdiek. 2001. Regulation of the expression of HMG1, a coactivator of the estrogen receptor. Anticancer Res. 21:301-305.[Medline]

3. Chau, K. Y., H. Y. Lam, and K. L. Lee. 1998. Estrogen treatment induces elevated expression of HMG1 in MCF-7 cells. Exp. Cell Res. 241:269-272.[CrossRef][Medline]

4. Chen, J. D., and Evans, R. M. 1995. A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature 377:454-457.[CrossRef][Medline]

5. Cox, A. D., and C. J. Der. 1994. Biological assays for cellular transformation. Methods Enzymol. 238:277-294.[Medline]

6. Espinos, E., V. Le, A. Thai, C. Pomies, and M. J. Weber. 1999. Cooperation between phosphorylation and acetylation processes in transcriptional control. Mol. Cell. Biol. 19:3474-3484.[Abstract/Free Full Text]

7. Fischle, W., F. Dequiedt, M. J. Hendzel, M. G. Guenther, M. A. Lazar, W. Woelter, and E. Verdin. 2002. Enzymatic activity associated with class II HDACs is dependent on a multiprotein complex containing HDAC3 and SMRT/N-CoR. Mol. Cell 9:45-57.[CrossRef][Medline]

8. Graham, J. D., D. L. Bain, J. K. Richer, T. A. Jackson, L. Tung, and K. B. Horwitz. 2000. Nuclear receptor conformation, coregulators, and tamoxifen-resistant breast cancer. Steroids 65:579-584.[CrossRef][Medline]

9. Heery, D. M., E. Kalkhoven, S. Hoare, and M. G. Parker. 1997. A signature motif in transcriptional co-activators mediates binding to nuclear receptors. Nature 387:733-736.[CrossRef][Medline]

10. Heinzel, T., R. M. Lavinsky, T. M. Mullen, et al. 1997. A complex containing N-CoR, mSin3 and histone deacetylase mediates transcriptional repression. Nature 387:43-48.[CrossRef][Medline]

11. Huang, N., E. Vom Baur, J. M. Garnier, T. Lerouge, J. L. Vonesch, Y. Lutz, P. Chambon, and R. Losson. 1998. Two distinct nuclear receptor interaction domains in NSD1, a novel SET protein that exhibits characteristics of both corepressors and coactivators. EMBO J. 17:3398-3412.[CrossRef][Medline]

12. Jepsen, K., and M. G. Rosenfeld. 2002. Biological roles and mechanistic actions of co-repressor complexes. J. Cell Sci. 115:689-698.[Abstract/Free Full Text]

13. Kumar, R., R.-W, Wang, A. Mazumdar, et al. 2002. A naturally occurring MTA1 variant sequesters estrogen receptor in the cytoplasm. Nature 418:654-657.[CrossRef][Medline]

14. Li, D., V. Desai-Yajnik, E. Lo, M. Schapira, R. Abagyan, and H. H. Samuels. 1999. NRIF3 is a novel coactivator mediating functional specificity of nuclear hormone receptors. Mol. Cell. Biol. 19:7191-7202.[Abstract/Free Full Text]

15. Li, D., F. Wang, and H. H. Samuels. 2001. Domain structure of the NRIF3 family of coregulators suggests potential dual roles in transcriptional regulation. Mol. Cell. Biol. 21:8371-8384.[Abstract/Free Full Text]

16. Lin, R. J., L. Nagy, S. Inoue, W. Shao, W. H. Miller, Jr., and R. M. Evans. 1998. Role of the histone deacetylase complex in acute promyelocytic leukaemia. Nature 391:811-814.[CrossRef][Medline]

17. Lomvardas, S., and D. Thanos, 2002. Opening chromatin. Mol. Cell 9:209-211.[CrossRef][Medline]

18. Mazumdar, A., R. A. Wang, S. K. Mishra, L. Adam, Bagheri-Yarmand, R., M. Mandal, R. K. Vadlamudi, and R. Kumar. 2001. Transcriptional repression of oestrogen receptor by metastasis-associated protein 1 corepressor. Nat. Cell Biol. 3:30-37.[CrossRef][Medline]

19. McInerney, E. M., D. W. Rose, S. E. Flynn, et al. 1998. Determinants of coactivator LXXLL motif specificity in nuclear receptor transcriptional activation. Genes Dev. 12:3357-3368.[Abstract/Free Full Text]

20. McKenna, N. J., R. B. Lanz, and B. W. O'Malley. 1999. Nuclear receptor coregulators: cellular and molecular biology. Endocrinol. Rev. 2:321-344.

21. McMahon, C., T. Suthiphongchai, J. DiRenzo, and M. E. Ewen. 1999. P/CAF associates with cyclin D1 and potentiates its activation of the estrogen receptor. Proc. Natl. Acad. Sci. USA 96:5383-5387.

22. Mishra, S. K., M. Mandal, A. Mazumdar, and R. Kumar. 2001. Dynamic chromatin remodeling on the HER2 promoter in human breast cancer cells. FEBS Lett. 507:88-94.[CrossRef][Medline]

23. Nagy, L., H. Y. Kao, D. Chakravarti, R. J. Lin, C. A. Hassig, D. E. Ayer, S. L. Schreiber, and R. M. Evans. 1997. Nuclear receptor repression mediated by a complex containing SMRT, mSin3A, and histone deacetylase. Cell 89:373-380.[CrossRef][Medline]

24. Romine, L. E., J. R. Wood, L. A. Lamia, P. Prendergast, D. P. Edwards, and A. M. Nardulli. 1998. The high mobility group protein 1 enhances binding of the estrogen receptor DNA binding domain to the estrogen response element. Mol. Endocrinol. 12:664-674.[Abstract/Free Full Text]

25. Sassone-Corsi, P. 2002. Unique chromatin remodeling and transcriptional regulation in spermatogenesis. Science 296:2176-2178.[Abstract/Free Full Text]

26. Smith, C. L., Z. Nawaz, and B. W. O'Malley. 1997. Coactivator and corepressor regulation of the agonist/antagonist activity of the mixed antiestrogen, 4-hydroxytamoxifen. Mol. Endocrinol. 11:657-666.[Abstract/Free Full Text]

27. Talukder, A. H., S. K. Mishra, M. Mandal, S. Balasenthil, S. Mehta, A. A. Sahin, C. J. Barnes, and R. Kumar. 2003. MTA1 interacts with MAT1, a cyclin-dependent kinase-activating kinase complex ring finger factor, and regulates estrogen receptor transactivation functions. J. Biol. Chem. 278:11676-11685.[Abstract/Free Full Text]

28. Toh. Y., S. D. Pencil, and G. L. Nicolson. 1994. A novel candidate metastasis-associated gene, mta1, differentially expressed in highly metastatic mammary adenocarcinoma cell lines. cDNA cloning, expression, and protein analyses. J. Biol. Chem. 269:22958-22963.[Abstract/Free Full Text]

29. Toh. Y., S. D. Pencil, and G. L. Nicolson. 1995. Analysis of the complete sequence of the novel metastasis-associated candidate gene, mta1, differentially expressed in mammary adenocarcinoma and breast cancer cell lines. Gene 159:97-104.[CrossRef][Medline]

30. Tora, L., J. White, C. Brou, D. Tasset, N. Webster, E. Scheer, and P. Chambon. 1989. The human estrogen receptor has two independent nonacidic transcriptional activation functions. Cell 59:477-487.[CrossRef][Medline]

31. Tsai, M. J., and B. W. O'Malley. 1994. Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu. Rev. Biochem. 63:451-486.[CrossRef][Medline]

32. Vadlamudi, R., L. Adam, B. Tseng, L. Costa, and R. Kumar. 1999. Transcriptional up-regulation of paxillin expression by heregulin in human breast cancer cells. Cancer Res. 59:2843-2846.[Abstract/Free Full Text]

33. Vadlamudi, R. K., F. Li, L. Adam, D. Nguyen, Y. Ohta, T. P Stossel,., and R. Kumar. 2002. Filamin is essential in actin cytoskeletal assembly mediated by p21-activated kinase. Nat. Cell Biol. 4:681-690.[CrossRef][Medline]

34. Voegel, J. J., M. J. Heine, M. Tini, V. Vivat, P. Chambon, and H. Gronemeyer. 1998. The coactivator TIF2 contains three nuclear receptor-binding motifs and mediates transactivation through CBP binding-dependent and -independent pathways. EMBO J. 17:507-519.[CrossRef][Medline]

35. Zhang, X., M. Jeyakumar, S. Petukhov, and M. K. Bagchi. 1998. A nuclear receptor corepressor modulates transcriptional activity of antagonist-occupied steroid hormone receptor. Mol. Endocrinol. 12:513-524.[Abstract/Free Full Text]


Molecular and Cellular Biology, August 2004, p. 6581-6591, Vol. 24, No. 15
0270-7306/04/$08.00+0     DOI: 10.1128/MCB.24.15.6581-6591.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Talukder, A. H.
Right arrow Articles by Kumar, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Talukder, A. H.
Right arrow Articles by Kumar, R.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. J. Virol. Eukaryot. Cell
Microbiol. Mol. Biol. Rev. Clin. Vaccine Immunol. All ASM Journals