![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Molecular and Cellular Biology, August 2004, p. 6581-6591, Vol. 24, No. 15
0270-7306/04/$08.00+0 DOI: 10.1128/MCB.24.15.6581-6591.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Departments of Molecular and Cellular Oncology, University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030
Received 14 November 2003/ Returned for modification 28 January 2004/ Accepted 4 May 2004
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
) is modified by regulatory action and interactions of coactivators and corepressors. Recent studies have shown that the metastasis-associated protein 1 (MTA1) represses estrogen receptor element (ERE)-driven transcription in breast cancer cells. With a yeast two-hybrid screen to clone MTA1-interacting proteins, we identified a known nuclear receptor coregulator (NRIF3) as an MTA1-binding protein. NRIF3 interacted with MTA1 both in vitro and in vivo. NRIF3 bound to the C-terminal region of MTA1, while MTA1 bound to the N-terminal region of NRIF3, containing one nuclear receptor interaction LXXLL motif. We showed that NRIF3 is an ER coactivator, hyperstimulated ER transactivation functions, and associated with the endogenous ER and its target gene promoter. MTA1 repressed NRIF3-mediated stimulation of ERE-driven transcription and interfered with NRIF3's association with the ER target gene chromatin. In addition, NRIF3 deregulation enhanced the responsiveness of breast cancer cells to estrogen-induced stimulation of growth and anchorage independence. Furthermore, we found that NRIF3 is an estrogen-inducible gene and activated ER associated with the ER response element in the NRIF3 gene promoter. These findings suggest that NRIF3, an MTA1-interacting protein, is an estrogen-inducible gene and that regulatory interactions between MTA1 and NRIF3 might be important in modulating the sensitivity of breast cancer cells to estrogen. |
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and ß. ER- is the major estrogen receptor in the mammary epithelium. Like other steroid nuclear receptors, ER- comprises an N-terminal transcriptional activation function (AF1) domain, a central DNA-binding domain, and a C-terminal ligand-binding domain that contains a ligand-dependent transcriptional activation function 2 (AF2) domain (30). Binding of hormone to the ER triggers conformational changes that allow the ER to bind to the responsive elements in the target gene promoters. The ligand-activated ER- then translocates to the nucleus, binds to the 13-bp palindromic estrogen response element (ERE) in the target gene promoters, and stimulates gene transcription, thereby promoting the growth of breast cancer cells. In addition, a series of recent studies also demonstrate other actions of the estrogen receptors, which involve protein-protein interactions (i.e., with AP-1 and SP-1) rather than direct DNA binding. As with hormonal regulation, the transcriptional activity of ER is affected by a number of regulatory cofactors, including chromatin-remodeling complexes, coactivators, and corepressors (4, 9, 10, 20, 23). Coactivators generally do not bind to the DNA but are recruited to the target gene promoters through protein-protein interactions with the ER. Examples of ER coactivators include members of the p160 family, SRC1-3, AIBI, TRAM1, RAC3, CREB binding protein (CBP), and p300 (21). Corepressors preferentially associate with antagonist-occupied ER (8, 26, 35). Among the ER corepressors, NCoR and SMRT are widely characterized molecules that have been implicated in transcriptional silencing in the absence of ligands (16).
Evidence suggests that multiprotein complexes containing coactivators, ERs, and transcriptional regulators assemble in response to hormone binding and that they activate transcription. The molecular mechanisms of ER, the composition of the ER coactivator proteins, and the way these hormones elicit tissue or cell type-specific responses are active areas of investigation. A structural analysis of the ER coactivators has identified a five-amino-acid nuclear receptor (NR) LXXLL (where X is any amino acid) motif that can mediate coregulator binding to liganded ERs (11, 29, 34).
For transcription factors to access DNA, the repressive chromatin structure must be remodeled. Dynamic alterations in the chromatin structure resulting from the acetylation of histones can facilitate or suppress access of the transcription factors to nucleosomal DNA, leading to transcriptional regulation (17, 25). Hyperacetylated chromatin is generally associated with transcriptional activation, whereas hypoacetylated chromatin is associated with transcriptional repression (1, 6). Coactivators such as SRC1-3 and CBP/p300 have been shown to possess intrinsic histone acetyltransferase activity (12), while corepressors such as NCoR and metastasis-associated protein 1 (MTA1) are associated with histone deacetylases (7, 12, 18). The MTA1 gene was originally identified by differential expression in rat mammary adenocarcinoma metastatic cells and is shown to correlate well with the metastatic potential of several human cell lines and tissues (18, 28, 29). MTA1 has also been shown to repress ER--driven transcription in breast cancer cells (18). In spite of the corepressor function of MTA1, the nature of its target(s) remains unidentified.
To better understand the cellular functions of MTA1 in breast cancer cells, we performed a yeast two-hybrid screen to clone MTA1-interacting proteins and identified a relatively new nuclear receptor coregulator (NRIF3). Previous studies involving in vitro and transient expression assays have shown a potentiating role of NRIF3 in the transactivation functions of thyroid receptor and retinoid X receptor (14, 15). The NRIF3 protein consists of three major motifs, the C-terminal LXXIL (receptor-interacting domain, RID1), the N-terminal LXXLL (RID2), and the central coiled-coil region containing a putative leucine zipper-like motif (14). In this study, we have shown that NRIF3 is an MTA1-interacting protein. In addition, NRIF3 deregulation in breast cancer cells stimulated anchorage-independent growth, the expression of estrogen-inducible genes, as well as recruitment of NRIF3 to ER target gene promoter chromatin. Furthermore, we have provided evidence that NRIF3 itself is an estrogen-inducible gene as it contains an ER-responsive motif and that NRIF3 association with ERE-chromatin was inhibited by MTA1. These findings reveal a novel mechanism of ER transactivation functions involving NRIF3 and its regulatory feedback interactions with MTA1 in breast cancer cells.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In vitro transcription, translation, and GST pulldown assays. In vitro transcription and translation of the test proteins were performed with the TNT-transcription-translation system (Promega). One microgram of desired DNA in the pcDNA3.1 vector (Invitrogen) was translated in the presence of [35S]methionine in a reaction volume of 50 µl with the T7-TNT reaction mixture. The reaction mixture was diluted to 1 ml with NP-40 lysis buffer, and an aliquot (250 µl) was used for each glutathione S-transferase (GST) pulldown assay. Two microliters of the translated reaction mixture was verified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and autoradiography. The GST pulldown assays were performed by incubating equal amounts of GST or GST fusion protein immobilized to glutathione-Sepharose beads (Amersham) with in vitro-translated 35S-labeled test protein. The mixtures were incubated for 2 h at 4°C and washed six times with NP-40 lysis buffer. Bound proteins were eluted with 2x SDS buffer, separated by SDS-PAGE, and visualized by fluorography (33).
Transient transfection, immunoprecipitation, and Western blotting. MCF-7 cells were transiently transfected with 1 µg of T7-NRIF3 and c-Myc-MTA1 or pcDNA (control vector) and T7-NRIF3 in a 70% confluent 100-mm plate with the Fugene method (Roche). Cells were lysed at 48 h posttransfection in high-salt buffer to get the nuclear extract and immunoprecipitated with c-Myc antibody (NeoMarker) for 4 h at 4°C. Rabbit anti-mouse antibody-Sepharose beads were added for 1 h. After 1 h, beads were centrifuged down, washed three times with washing buffer, boiled for 5 min in 2X SDS loading buffer, run on SDS-12% PAGE, transferred to a nitrocellulose blot overnight at 4°C, and developed against T7 antibody (mouse) or c-Myc antibody (mouse).
Deletion constructs of MTA1 and of NRIF3. Seven MTA1 deletion constructs were generated to map the binding site(s) of MTA1 with NRIF3 by a PCR-based procedure (29). Starting from the N-terminal region, the constructs were named N1-MTA1 to N7-MTA1. All the forward (F) primers including the ATG start codon primer contain an EcoRI site, and all the reverse (R) primers including the stop codon (TAG) primer contain a SalI site. The ATG start codon primer is 5'-GCCGCCGGAATTCACATGGCCGCCAACA-3', and the stop codon (TAG) primer was 5'-AGGTGGGGGTCGACCCTAGTCCTCCCG-3'. The construction of N1-MTA1 through N5-MTA1 used the ATG start codon primer plus N1R 5'-ACTCGAATGTCGACTTTATCTGCCA-3', N2R 5'-AGGCCCGGCCGTCGACAGGGCTCTGGCCCGG-3', N3R 5'-ACTGCGGTGTCGACCTGGCCTCTCTCCA-3', N4R 5'-ACCGAAGCACGTCGACCAGCGGCTT-3', and N5R 5'-TCAGGCGCACGTCGACGGGGTAGGACT-3', respectively. For the construction of N6-MTA1 (amino acids422 to 715) and N7-MTA1 (amino acids542 to 715), we used the stop codon primer and N6F 5'-TGATGGAGGAATTCCAGGACCAAAC-3' and N7F 5'-GAAGCCGTGCGAATTCATCTTGAGA-3', respectively. All the PCR products were run in a 0.8% agarose gel, purified by Gene Clean or Mermaid (Bio 101), cut with EcoRI plus SalI, and ligated to the pGEX-5X vector at the EcoRI and Xho1 sites. After confirming the sequences, these constructs were cut at the EcoRI and NotI sites and ligated with pcDNA3.1A vector at the EcoR1 and NotI sites for T7 tag protein (24).
A similar PCR-based procedure was used to generate three deletion constructs of NRIF3 with either the start codon primer 5'-ACCCGAGGATCCGAATGCCTGTTAAAAGA-3' or the stop codon primer 5'-TGCATTTCTTGCGGCCGCCTCAGTTTAAAATGGC-3'. The following constructs were made by PCR with the start codon primer plus 161R (amino acids 1 to 161), 5'-GTCAAGATGAGCGGCCGCTTTGTGAGGAGGTCCT-3' and 94R (1 to 94 amino acids) 5'-TGATTTCTTCTGGCGGCCGCTCAACTTTTGATAAC-3', and with stop codon primer plus 29F (amino acids 29 to 177), 5'-CAAGGAGGATCCGTGTTATAACTTATTCTCC-3'. After Gene Clean, the PCR products were digested with BamHI and NotI and ligated to a pcDNA3.1A vector at the same site. For site-directed mutagenesis of the LXXLL (amino acids 9 to 13) motif of full-length NRIF3, we used forward primer 5'-GGATGGTCAGTTTGAAGAAAATTCA-3' and reverse primer 5'-TGAATTTTCTTCAAACTGACCATCC-3'. We changed the last two leucine residues of the LXXLL motif to LXXQF by changing CTG to CAG and TTA to TTT with Stratagene's QuickChange site-directed mutagenesis kit.
Cell cultures and reagents. Human breast cancer cells were cultured in Dulbecco's modified Eagle's medium (DMEM)/F12 medium supplemented with 10% fetal bovine serum. For estrogen treatment experiments, regular medium was replaced by medium containing 3% DCC (charcoal-stripped serum). Antibody against the c-Myc tag was purchased from MBL International, Watertown, Mass. Anti-ER antibody was from Upstate Biotechnology, whereas anti-mouse and anti-rabbit antibody-horseradish peroxidase conjugates were from Amersham, Piscataway, N.J.
Stable cell lines and Northern blotting. MCF-7 cells were transfected with T7-tagged NRIF3. After 48 h, G418 (500 µg/ml, final concentration) was added and selection pressure was maintained for 3 weeks. Clones from each plate were pooled and maintained as individual clones. Expression of T7-NRIF3 was verified by Northern blot (30 µg of total RNA/lane) and Western blot with anti-T7 monoclonal antibody.
Transfection and promoter assays. Cells were maintained in DMEM/F12 (1:1) supplemented with 10% fetal calf serum. For reporter gene transient transfections, cells were cultured in medium without phenol red and containing 3% charcoal-stripped (DCC) serum for 24 to 36 h, and promoter assays were performed at 48 h posttransfection as previously described (28).
Total RNA isolation and cDNA microarray. Total RNA was isolated from cell lines stably transfected with pcDNA and NRIF3 (clone 19) with Trizol (Life Technologies, Inc., Rockville, Md.) purification. Human estrogen signaling pathway GE array (hGEA9914010) was purchased from Super Array Inc., Bethesda, Md. After checking the RNA quality, 10 µg of total RNA was used to synthesize cDNA in presence of [P32]dCTP according to the manufacturer's instruction. Both the cDNA probes were purified and equal counts of probes were hybridized with two identical microarray blots and detected with phosphorimage scanning. The signal of the two blots was normalized with ß-actin.
Chromatin immunoprecipitation assay. The T7-NRIF3 stable clone and pcDNA control vector clone were used for the chromatin immunoprecipitation study. The cells were kept for 48 h prior to estrogen or ICI 182,780 (ICI) treatment, and ICI was added 1 h before estrogen treatment. The chromatin immunoprecipitation assay was performed as described (18). Approximately 106 cells were treated with 1% formaldehyde (final concentration) for 10 min at 37°C to cross-link histones to DNA and washed twice with phosphate-buffered saline containing protease inhibitors cocktail. Cells were lysed by sonication and immunoprecipitated with T7 monoclonal antibody (Novagen). The immunoprecipitates were washed, the DNA was eluted off the beads, and purified DNA (phenol-chloroform extraction) was subjected to PCR.
The sequences of the forward and reverse primers for pS2 promoter used in this study were 5'GAATTAGCTTAGGCCTAGACGGAATG-3' and 5'AGGATTTGCTGATAGACAGAGACGAC-3', respectively. 17ß-Estradiol, ICI-182780, and stock chemicals were from Sigma (23, 28, 35). The sequences of the forward and reverse primers for the NRIF3 promoter were 5'ACTACCTTTCTCAGCCTCTGGTAACC-3' (spanning region –5193 to –5218) and 5'GGGAACCCTCTTACACTGTTGGTAG-3' (spanning region –4730 to –755), respectively. The other pair of primers for NRIF3 promoter did not work.
Interference with NRIF3 expression by siRNA. We used four sets of small interfering RNAs (siRNAs) designed by Qiagen to target human NRIF3 sequences. Among the four sets, one pair (forward and reverse sequence are same) worked the best and was used here. The sequence of NRIF3 siRNA was r(UCUCCUGUGCAAUCACAUUU)d(TT). As a control, we used a commercially available nonspecific random siRNA. MCF-7 cells were seeded at 30% density the day before transfection in six-well plates. On the day of transfection, cells were changed to antibiotic-free 10% serum or 3% DCC medium (for estrogen treatment). Transfections were performed with the Oligofectamine reagent (Invitrogen) according to the manufacturer's instructions with 12 µl of 20 µM siRNA and 4 µl of Oligofectamine reagent/well in six-well plates (50 nM final concentration). For estrogen treatment, cells were transfected with siRNA in 3% DCC serum. After 60 h, cells were treated for 8 h with estrogen (10–9 M), and total RNA was analyzed by Northern hybridization. For luciferase assay, cells were retransfected after 24 h of siRNA transfection with ERE-luciferase or GAL4-luciferase plus other plasmids in 3% DCC medium and kept for another 48 h, including treatment with estrogen during the last 8 h before harvesting.
Proliferation and soft agar assays. Cell proliferation assays were performed with the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) dye method as described (27). Colony growth assays were performed as described previously (14). Briefly 1 ml of solution of 0.6% Difco agar in DMEM supplemented with 10% fetal bovine serum with insulin was layered onto tissue culture plates (60 by 15 mm). Stable clones of pcDNA and NRIF3 (50,000 cells/plate) were mixed with 1 ml of 0.36% Bactoagar solution in DMEM prepared in a similar manner and layered on top of the 0.6% Bactoagar layer. Plates were incubated for 28 days. For treatment with estrogen, cells were replaced with DCC serum and then 10–9 M estrogen was added.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
NRIF3 interacts with MTA1 in vivo. To demonstrate the interaction of NRIF3 and MTA1 in breast cancer cells, we transfected c-Myc-MTA1 and T7-NRIF3 or a pcDNA control vector in MCF7 cells (Fig. 1D). Immunoprecipitation of cell lysates with an anti-c-Myc monoclonal antibody was followed by immunoblotting with T7 or c-Myc monoclonal antibodies. The results showed specific interaction of c-Myc-MTA1 and T7-NRIF3 (Fig. 1D, right lane).
NRIF3 interacts with the C-terminal regions of MTA1. Next, we defined the minimal region of MTA1 required for its interaction with NRIF3. MTA1 has several important domains involved in protein-protein interactions, DNA binding, and signal transduction (Fig. 2A). Several C- and N-terminal MTA1 deletion constructs were generated and expressed as 35S-labeled proteins; they were then subjected to GST pulldown assays with the GST-NRIF3 fusion protein. The results suggested that NRIF3 binds amino acids 165 to 387 and amino acids 442 to 542 of MTA1, which contain the DNA binding domain and SH3 binding site, respectively (Fig. 2B). To define the binding region(s) of NRIF3 that are important for MTA1 interaction, we generated a series of NRIF3 deletion constructs. The results of the GST pulldown assays indicated that NRIF3 uses amino acids 1 to 28, which contain the LXXLL motif, to interact with MTA1 (Fig. 2C and D).
|
.
The presence of an LXXLL motif in NRIF3 and the known importance of the LXXLL motif in interaction with nuclear receptors raised the possibility of a potential role for NRIF3 in the ER pathway. To explore this notion, we examined the potential ability of NRIF3 to influence transcription from an ERE-luciferase reporter system with ER-positive ZR-75 breast cancer cells. Coexpression of NRIF3 in ZR-75 cells potentiated the stimulation of ERE-driven transcription in the cells treated with E2 compared with control vector-transfected cells (Fig. 3A). The expression of NRIF3 alone in ZR-75 cells had a modest but reproducible stimulatory effect on reporter activity in the absence of estrogen.
|
) and Gal4-luciferase reporter, and luciferase activation depends on E2 stimulation of the AF2 domain. In this assay, E2-mediated activation of the AF2 function was further stimulated by NRIF3 expression (Fig. 3B), suggesting that NRIF3 expression hyperstimulates ER transactivation function. Similar results were obtained when these experiments were performed with MCF-7 cells stably expressing NRIF3 (see below). These results suggest that NRIF3 may respond differently to different transactivation reporter assays in different cellular contexts, as a previous study showed no effect of NRIF3 on ERE-luciferase activity in HeLa cells (14)
LXXLL motif of NRIF3 required for interaction and modulation of ER transactivation functions.
Since MTA1 interacted with amino acids 1 to 28 of NRIF3, which contain the NR binding motif LXXLL (Fig. 2D), we next examined the role of amino acids 1 to 28 in the observed NRIF3 regulation of ER transactivation. As illustrated in Fig. 3C, transient expression of the T7-NRIF3 but not the T7-NRIF3 mutant lacking the first 1 to 28 amino acids stimulated ER transactivation activity. To show an essential role of the first 28 amino acids (containing the LXXLL motif) of NRIF3 for its binding with the AF2 domain of ER, we next performed GST pulldown assays with GST-AF2 and newly synthesized NRIF3 or –28 NRIF3 (lacking the LXXLL motif) or point-mutated NRIF3 (LXXLL 
LXXQF) (Fig. 3D). The results indicated that GST-AF2 could effectively bind with the in vitro-translated full-length NRIF3 but not with –28 NRIF3 (lacking the LXXLL motif) or with point-mutated NRIF3 (Fig. 3D). These results suggest that the LXXLL motif plays an important role in the interaction of NRIF3 with ER and NRIF3's ER transactivation function.
NRIF3 stimulates the expression of estrogen-responsive genes. To explore the potential role of NRIF3 in the ER pathway and the biology of breast cancer cells, we next generated pooled MCF-7 clones overexpressing T7-NRIF3 or pcDNA. Expression of T7-NRIF3 was determined by immunoblotting the lysates from exponentially growing cells with an anti-T7 monoclonal antibody (Fig. 4A, upper panel). In general, these clones expressed two- to fourfold elevated levels of exogenous T7-NRIF3 over the endogenous level of NRIF3 as analyzed by Northern hybridization with the NRIF3 cDNA (Fig. 4A, lower panels). We next examined the effect of NRIF3 on the status of the ER pathway. cDNA probes from both pcDNA and NRIF3-expressing MCF-7 clones were generated by reverse transcription-PCR, and equal amounts of probe for each clone were hybridized with two identical human estrogen signaling pathway GE array cDNA blots.
|
NRIF3 associates with the ERE-responsive promoters in vivo. To demonstrate the potential importance of NRIF3 in ERE transcription, we used the chromatin immunoprecipitation assay to analyze whether T7-NRIF3 associates with the endogenous ERE-containing promoters. Stable clones of T7-NRIF3 or pcDNA3.1A in MCF-7 cells were treated with E2 with or without antiestrogen ICI-182780 and processed for immunoprecipitation with specific antibodies against T7. Genomic DNA fragments bound to T7-NRIF3 were analyzed by PCR with primers spanning the ERE elements present in the promoter of the pS2 sequence, for a potential E2-triggered association of T7-NRIF3 with the promoter of the ER target gene (Fig. 4E). The results indicated that E2 treatment triggered a significant increase in the amount of pS2 target gene promoter chromatin associated with T7-NRIF3 (Fig. 4E). These findings suggest that NRIF3 interacts with the ER target gene chromatin and facilitates ligand-dependent transcription from the ERE-containing promoter.
MTA1 inhibits NRIF3 stimulation of ERE transcription. Since MTA1 acts as a corepressor of the ER pathway (18) and since NRIF3 is both an ER coactivator and an MTA1-interacting protein (this study), we next investigated the potential impact of MTA1 deregulation on NRIF3-mediated stimulation of ERE transcription. MCF-7 breast cancer cells were cotransfected with ERE-luciferase, MTA1, or pcDNA (control vector), and with or without T7-NRIF3. Coexpression of MTA1 suppressed ERE-driven transcription (Fig. 5A). Similarly, MTA1 deregulation in MCF-7 cells stably expressing T7-NRIF3 also prevented the ability of E2 to stimulate ERE transcription (Fig. 5B). Conversely, coexpression of NRIF3 in MCF-7 cells stably expressing T7-MTA1 showed hyperstimulation of ERE transcription (Fig. 5C). Consistent with these results, coexpression of MTA1 resulted in a substantial inhibition in the amount of pS2 target gene promoter chromatin associated with NRIF3 (Fig. 5D), suggesting that the hyperactivation function of NRIF3 may be linked with its recruitment to the target gene promoter chromatin and MTA1 overexpression represses NRIF3 regulation of the ER pathway. Collectively, these results suggest that regulatory interactions between MTA1 and NRIF3 might influence ERE-driven transactivation.
|
|
Modulation of ER-responsive pathways by the status of endogenous NRIF3. To understand the effect of endogenous NRIF3 upon ER responsiveness, we next limited the endogenous levels of NRIF3 in MCF-7 cells with NRIF3-specific siRNA. Exponentially growing MCF-7 cells were transfected either with NRIF3-specific siRNA or with control siRNA. We found that downregulation of NRIF3 expression in MCF-7 cells resulted in a substantial reduction in the expression of pS2 and HMG1, two ER-regulated genes (Fig. 7A). To determine whether the status of the endogenous NRIF3 influences the ability of estrogen to induce ER-responsive genes, we repeated the above experiments with MCF-7 cells grown in phenol red-free medium supplemented with 3% charcoal-stripped serum and treated with or without estrogen (Fig. 7B). These findings suggest that depletion of endogenous NRIF3 reduces the ability of estrogen to induce ER-regulated genes.
|
Effect of NRIF3 on the biology of breast cancer cells. To understand the potential influence of NRIF3 in breast cancer cells, we first examined the effect of estrogen on the proliferation of pooled clones of MCF-7 cells stably expressing T7-NRIF3 or pcDNA (control vector). The results indicated that NRIF3 overexpression promoted the baseline as well as E2-induced growth rates of MCF-7 cells (Fig. 8A), suggesting a potential role of NRIF3 in the E2 responsiveness of breast cancer cells. Consistent with these results, E2 stimulation of MCF-7 and NRIF3 cells was also accompanied by increased ability to grow in an anchorage-independent manner that was further induced by E2 treatment (Fig. 8B).
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
are regulated by the combined action of coregulators, including coactivators and corepressors. Since the target gene promoter chromatin is a highly dynamic structure, the transactivating functions of coactivators are likely to be influenced by corepressors and any potential deregulation of one component will have functional implications for the action of other components. In this context, we found that a corepressor, MTA1, can influence the ability of the NRIF3 coactivator to confer estrogen hypersensitivity on breast cancer cells. This could be an important way of regulating ER transactivation in breast cancer cells. The results presented here identified NRIF3, a novel bifunctional nuclear receptor coregulator, as an MTA1-interacting protein by yeast two-hybrid screening. We showed that MTA1 interacted with NRIF3 and that NRIF3 interacted with MTA1, which contains SH3 and DNA binding domains. Interestingly, a newly discovered variant of MTA1 with an identical N-terminal region, MTA1s, showed no such interaction with NRIF3, suggesting that NRIF3 is a specific binding protein for MTA1.
In addition, the results presented here also provide evidence that NRIF3 interacted with the AF2 domain of the ER, stimulated the ER transactivation function, and associated with the ER target gene promoter chromatin. Structural and functional analyses of several coactivators reveals that coactivators interact with the ligand-bound AF2 domain through the LXXLL motif and are sufficient to mediate the binding of coactivators to ligand-bound NRs. A single LXXLL motif is enough to allow activation of ER by estrogen. Interestingly, the N-terminal region of NRIF3 contains one LXXLL motif, and deletion of this region abolished the ability of NRIF3 to interact with the ER and modulate ER transactivation functions. In the context of MTA1, we showed that NRIF3 associates with the ER target gene pS2 promoter chromatin and that MTA1 inhibits NRIF3 recruitment to the pS2 gene chromatin.
Our finding that the ER coregulator NRIF3 interacts with MTA1, an ER corepressor, was interesting, as it raised the possibility that the final outcome of the ER transactivation function was influenced by complex protein-protein interactions rather than by isolated interaction with one class of proteins. From our results, it appeared that MTA1 has inhibitory activity against NRIF3-mediated interaction with ER and stimulation of ER transactivation. A modest but significant reversal of MTA1-NRIF3 recruitment on one of the E2 target genes, i.e., the pS2 promoter, was achieved by E2 stimulation of cells. We also found that the ER association with NRIF3 was abolished when NRIF3 interacted with the MTA1 complex. Modest but distinct withdrawal of NRIF3 from the pS2 promoter in the presence of MTA1 may provide clues about the dominance of MTA1's corepressive function.
The finding that NRIF3 overexpression was sufficient to induce the expression of ER target gene pS2 and promote the stimulation of cell growth and anchorage-independent growth of breast cancer cells was surprising, as it reveals a potential role of NRIF3 in amplifying the action of estrogen. In fact, it was also discovered that NRIF3 itself is an estrogen-responsive gene. The putative promoter of NRIF3 contains an ERE motif, and activated ER is recruited to the NRIF3 gene chromatin. The significance of our findings is based on the observation of MTA1 association of NRIF3 with the ER target gene promoter chromatin. Since the level of MTA1 might be upregulated in some breast cancer cells (18), our current findings imply a potential suppression of the ER coregulator functions of NRIF3 by a pathological level of MTA1 and suggest that these events may modulate the hormonal response in breast cancer cells. In addition, it is also possible that the observed NRIF3-MTA1 interaction might provide a negative-feedback regulation of E2 regulation of the expression and functions of NRIF3 in breast cancer cells.
In summary, the present study identified NRIF3 as an MTA1-interacting protein, established the coactivator function of NRIF3, revealed the E2-inducible nature of NRIF3, and provided new evidence to suggest that the transactivation function of NRIF3 is influenced by regulatory interactions between NRIF3 and MTA1.
|
ACKNOWLEDGMENTS |
|---|
This study was supported in part by NIH grants CA098823, CA80066, and CA65746 (R.K.).
|
FOOTNOTES |
|---|
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Borrmann, L., I. Kim, I. The, D. Schultheiss, P. Rogalla, and J. Bullerdiek. 2001. Regulation of the expression of HMG1, a coactivator of the estrogen receptor. Anticancer Res. 21:301-305.[Medline]
3. Chau, K. Y., H. Y. Lam, and K. L. Lee. 1998. Estrogen treatment induces elevated expression of HMG1 in MCF-7 cells. Exp. Cell Res. 241:269-272.[CrossRef][Medline]
4. Chen, J. D., and Evans, R. M. 1995. A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature 377:454-457.[CrossRef][Medline]
5. Cox, A. D., and C. J. Der. 1994. Biological assays for cellular transformation. Methods Enzymol. 238:277-294.[Medline]
6. Espinos, E., V. Le, A. Thai, C. Pomies, and M. J. Weber. 1999. Cooperation between phosphorylation and acetylation processes in transcriptional control. Mol. Cell. Biol. 19:3474-3484.
7. Fischle, W., F. Dequiedt, M. J. Hendzel, M. G. Guenther, M. A. Lazar, W. Woelter, and E. Verdin. 2002. Enzymatic activity associated with class II HDACs is dependent on a multiprotein complex containing HDAC3 and SMRT/N-CoR. Mol. Cell 9:45-57.[CrossRef][Medline]
8. Graham, J. D., D. L. Bain, J. K. Richer, T. A. Jackson, L. Tung, and K. B. Horwitz. 2000. Nuclear receptor conformation, coregulators, and tamoxifen-resistant breast cancer. Steroids 65:579-584.[CrossRef][Medline]
9. Heery, D. M., E. Kalkhoven, S. Hoare, and M. G. Parker. 1997. A signature motif in transcriptional co-activators mediates binding to nuclear receptors. Nature 387:733-736.[CrossRef][Medline]
10. Heinzel, T., R. M. Lavinsky, T. M. Mullen, et al. 1997. A complex containing N-CoR, mSin3 and histone deacetylase mediates transcriptional repression. Nature 387:43-48.[CrossRef][Medline]
11. Huang, N., E. Vom Baur, J. M. Garnier, T. Lerouge, J. L. Vonesch, Y. Lutz, P. Chambon, and R. Losson. 1998. Two distinct nuclear receptor interaction domains in NSD1, a novel SET protein that exhibits characteristics of both corepressors and coactivators. EMBO J. 17:3398-3412.[CrossRef][Medline]
12. Jepsen, K., and M. G. Rosenfeld. 2002. Biological roles and mechanistic actions of co-repressor complexes. J. Cell Sci. 115:689-698.
13. Kumar, R., R.-W, Wang, A. Mazumdar, et al. 2002. A naturally occurring MTA1 variant sequesters estrogen receptor in the cytoplasm. Nature 418:654-657.[CrossRef][Medline]
14. Li, D., V. Desai-Yajnik, E. Lo, M. Schapira, R. Abagyan, and H. H. Samuels. 1999. NRIF3 is a novel coactivator mediating functional specificity of nuclear hormone receptors. Mol. Cell. Biol. 19:7191-7202.
15. Li, D., F. Wang, and H. H. Samuels. 2001. Domain structure of the NRIF3 family of coregulators suggests potential dual roles in transcriptional regulation. Mol. Cell. Biol. 21:8371-8384.
16. Lin, R. J., L. Nagy, S. Inoue, W. Shao, W. H. Miller, Jr., and R. M. Evans. 1998. Role of the histone deacetylase complex in acute promyelocytic leukaemia. Nature 391:811-814.[CrossRef][Medline]
17. Lomvardas, S., and D. Thanos, 2002. Opening chromatin. Mol. Cell 9:209-211.[CrossRef][Medline]
18. Mazumdar, A., R. A. Wang, S. K. Mishra, L. Adam, Bagheri-Yarmand, R., M. Mandal, R. K. Vadlamudi, and R. Kumar. 2001. Transcriptional repression of oestrogen receptor by metastasis-associated protein 1 corepressor. Nat. Cell Biol. 3:30-37.[CrossRef][Medline]
19. McInerney, E. M., D. W. Rose, S. E. Flynn, et al. 1998. Determinants of coactivator LXXLL motif specificity in nuclear receptor transcriptional activation. Genes Dev. 12:3357-3368.
20. McKenna, N. J., R. B. Lanz, and B. W. O'Malley. 1999. Nuclear receptor coregulators: cellular and molecular biology. Endocrinol. Rev. 2:321-344.
21. McMahon, C., T. Suthiphongchai, J. DiRenzo, and M. E. Ewen. 1999. P/CAF associates with cyclin D1 and potentiates its activation of the estrogen receptor. Proc. Natl. Acad. Sci. USA 96:5383-5387.
22. Mishra, S. K., M. Mandal, A. Mazumdar, and R. Kumar. 2001. Dynamic chromatin remodeling on the HER2 promoter in human breast cancer cells. FEBS Lett. 507:88-94.[CrossRef][Medline]
23. Nagy, L., H. Y. Kao, D. Chakravarti, R. J. Lin, C. A. Hassig, D. E. Ayer, S. L. Schreiber, and R. M. Evans. 1997. Nuclear receptor repression mediated by a complex containing SMRT, mSin3A, and histone deacetylase. Cell 89:373-380.[CrossRef][Medline]
24. Romine, L. E., J. R. Wood, L. A. Lamia, P. Prendergast, D. P. Edwards, and A. M. Nardulli. 1998. The high mobility group protein 1 enhances binding of the estrogen receptor DNA binding domain to the estrogen response element. Mol. Endocrinol. 12:664-674.
25. Sassone-Corsi, P. 2002. Unique chromatin remodeling and transcriptional regulation in spermatogenesis. Science 296:2176-2178.
26. Smith, C. L., Z. Nawaz, and B. W. O'Malley. 1997. Coactivator and corepressor regulation of the agonist/antagonist activity of the mixed antiestrogen, 4-hydroxytamoxifen. Mol. Endocrinol. 11:657-666.
27. Talukder, A. H., S. K. Mishra, M. Mandal, S. Balasenthil, S. Mehta, A. A. Sahin, C. J. Barnes, and R. Kumar. 2003. MTA1 interacts with MAT1, a cyclin-dependent kinase-activating kinase complex ring finger factor, and regulates estrogen receptor transactivation functions. J. Biol. Chem. 278:11676-11685.
28. Toh. Y., S. D. Pencil, and G. L. Nicolson. 1994. A novel candidate metastasis-associated gene, mta1, differentially expressed in highly metastatic mammary adenocarcinoma cell lines. cDNA cloning, expression, and protein analyses. J. Biol. Chem. 269:22958-22963.
29. Toh. Y., S. D. Pencil, and G. L. Nicolson. 1995. Analysis of the complete sequence of the novel metastasis-associated candidate gene, mta1, differentially expressed in mammary adenocarcinoma and breast cancer cell lines. Gene 159:97-104.[CrossRef][Medline]
30. Tora, L., J. White, C. Brou, D. Tasset, N. Webster, E. Scheer, and P. Chambon. 1989. The human estrogen receptor has two independent nonacidic transcriptional activation functions. Cell 59:477-487.[CrossRef][Medline]
31. Tsai, M. J., and B. W. O'Malley. 1994. Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu. Rev. Biochem. 63:451-486.[CrossRef][Medline]
32. Vadlamudi, R., L. Adam, B. Tseng, L. Costa, and R. Kumar. 1999. Transcriptional up-regulation of paxillin expression by heregulin in human breast cancer cells. Cancer Res. 59:2843-2846.
33. Vadlamudi, R. K., F. Li, L. Adam, D. Nguyen, Y. Ohta, T. P Stossel,., and R. Kumar. 2002. Filamin is essential in actin cytoskeletal assembly mediated by p21-activated kinase. Nat. Cell Biol. 4:681-690.[CrossRef][Medline]
34. Voegel, J. J., M. J. Heine, M. Tini, V. Vivat, P. Chambon, and H. Gronemeyer. 1998. The coactivator TIF2 contains three nuclear receptor-binding motifs and mediates transactivation through CBP binding-dependent and -independent pathways. EMBO J. 17:507-519.[CrossRef][Medline]
35. Zhang, X., M. Jeyakumar, S. Petukhov, and M. K. Bagchi. 1998. A nuclear receptor corepressor modulates transcriptional activity of antagonist-occupied steroid hormone receptor. Mol. Endocrinol. 12:513-524.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|
