This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Aravin, A. A.
Right arrow Articles by Gvozdev, V. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Aravin, A. A.
Right arrow Articles by Gvozdev, V. A.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, August 2004, p. 6742-6750, Vol. 24, No. 15
0270-7306/04/$08.00+0     DOI: 10.1128/MCB.24.15.6742-6750.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Dissection of a Natural RNA Silencing Process in the Drosophila melanogaster Germ Line

Alexei A. Aravin,1,{dagger} Mikhail S. Klenov,1 Vasilii V. Vagin,1 Frédéric Bantignies,2 Giacomo Cavalli,2 and Vladimir A. Gvozdev1*

Department of Animal Molecular Genetics, Institute of Molecular Genetics, Moscow 123182, Russia,1 Chromatin and Cell Biology Laboratory, Institute of Human Genetics, Centre National de la Recherche Scientifique, 34396 Montpellier, France2

Received 12 November 2003/ Returned for modification 31 December 2003/ Accepted 6 April 2004


arrow
ABSTRACT
 
To date, few natural cases of RNA-silencing-mediated regulation have been described. Here, we analyzed repression of testis-expressed Stellate genes by the homologous Suppressors of Stellate [Su(Ste)] repeats that produce sense and antisense short RNAs. The Stellate promoter is dispensable for suppression, but local disturbance of complementarity between the Stellate transcript and the Su(Ste) repeats impairs silencing. Using in situ RNA hybridization, we found temporal control of the expression and spatial distribution of sense and antisense Stellate and Su(Ste) transcripts in germinal cells. Antisense Su(Ste) transcripts accumulate in the nuclei of early spermatocytes before the appearance of sense transcripts. The sense and antisense transcripts are colocalized in the nuclei of mature spermatocytes, placing the initial step of silencing in the nucleus and suggesting formation of double-stranded RNA. Mutations in the aubergine and spindle-E genes, members of the Argonaute and RNA helicase gene families, respectively, impair silencing by eliminating the short Su(Ste) RNA, but have no effect on microRNA production. Thus, different small RNA-containing complexes operate in the male germ line.


arrow
INTRODUCTION
 
The silencing of genes by homologous double-stranded (ds) RNA (RNA interference [RNAi]) was discovered in artificial systems where dsRNA is introduced by injection or by expression of transgenic constructs (11, 25, 43). RNAi is widely used as a powerful technique for switching off specific genes and as a tool of whole-genome screening (12, 22). The first case of natural dsRNA-mediated silencing was found in Drosophila melanogaster, where suppression of a euchromatic locus by homologous testis-expressed heterochromatic repeats has been shown to be necessary for male fertility (2, 26, 27). In testes of wild-type males, hyperexpression of the X-linked Stellate genes is prevented by the closely homologous, bidirectionally transcribed, Y-linked Supressor of Stellate [Su(Ste)] repeats (2, 26), and deletion of Su(Ste) leads to abnormalities of spermatogenesis (7, 35).

Twenty-one- to 23-nucleotide (nt) short interfering (si) RNAs formed by processing of long dsRNA molecules by the RNase Dicer play a central role in dsRNA-mediated silencing (4, 46, 55). siRNA is assumed to act as a guide for the RNase complex (RISC) that degrades homologous mRNAs (9, 17, 33). microRNAs are involved in the control of expression of cellular genes (14, 19, 20, 29). microRNAs are transcribed as precursors with a stem-loop structure that are processed by Dicer into single-stranded RNAs of a size similar to that of siRNA. Recent experiments suggest that siRNAs and microRNAs can be loaded into a common RISC (20, 28, 29, 32). The Argonaute family of proteins represents the conserved core component of siRNA- and microRNA-containing complexes isolated from both D. melanogaster and mammals (18, 21, 29, 32).

The repression of Stellate in D. melanogaster by the closely homologous Su(Ste) repeats shares a number of traits with artificial RNAi. Bidirectional transcription of Su(Ste) repeats leads to formation of short sense and antisense RNAs (2). Derepression of Stellate occurs in aubergine (aub) and spindle-E (spn-E) mutants, genes that encode an Argonaute-family protein and a DExH RNA helicase, respectively (2, 40, 44). Recently, a requirement for the Aub and Spn-E proteins for dsRNA-injection-provoked RNAi was shown in D. melanogaster embryos (23). In the fission yeast, Schizosaccharomyces pombe, components of the RNAi machinery are involved in natural repression of centromeric heterochromatin, which contains remnants of transposable elements that are transcribed bidirectionally (51). Short RNAs complementary to centromeric repeats have been found (38), and mutations in genes encoding the Argonaute protein and the dsRNA-processing enzyme Dicer lead to derepression of centromeric repeats (15, 51). Antisense transcription of Su(Ste) repeats in D. melanogaster is thought to be caused by a hoppel transposon insertion (2). Thus, two systems of natural silencing, one in D. melanogaster and one in S. pombe, evolved as a result of heterochromatic genome rearrangements and use of the RNAi machinery.

Here, we extended the study of natural dsRNA-mediated silencing in D. melanogaster. Using in situ hybridization, we examined the order of steps that lead to Su(Ste) dsRNA formation. We found that (i) accumulation of antisense Su(Ste) RNA is followed by formation of dsRNA in the nuclei of spermatocytes at successive stages of spermatogenesis, (ii) mutations in the aub and spn-E genes lead to disappearance of short Su(Ste) RNA, but (iii) these mutations have no effect on microRNA formation, indicating that different protein complexes are involved in the formation of microRNA and Su(Ste) short RNA in testes. We also show that the Stellate promoter is dispensable for silencing and propose a posttranscriptional mechanism for Stellate repression.


arrow
MATERIALS AND METHODS
 
Reporter construct design. A plasmid template containing six full-length Ste genes was used for PCR amplification. For the Ste134mut-lacZ construct, the 134-bp Ste fragment was amplified by using a 5'-GAGTCTAGAGTTCCCATCTGGAAGGGCAT-3' and 5'-TAGGATCCATGTTGCCAGTTCTGATGTTCACAGAAATATG-3' primer pair, digested with XbaI and BamHI, and ligated into the CaSpeR-ß-galactosidase (ß-Gal) vector (47) opened with XbaI and BamHI. For the ß2tub-Ste-lacZ construct, the 592-bp Ste fragment was amplified by using a 5'-GAGAATTCATATTTCTGTGAACAAGTGAACTGGCA-3' and 5'-ACGGATCCAGGGGCGATCTCAAGTTCG-3' primer pair, digested with EcoRI and BamHI, and ligated into the CaSpeR-ß-Gal vector downstream of the previously cloned ß2tub promoter. The selected clones were sequenced to confirm correct fusion.

Drosophila strains, transformation, and genetic crosses. P-element-mediated germ line transformation of Df (1)w67c23(2), y embryos was performed according to standard protocol (39). For remobilization of the P{Ste134mut-lacZ} element, the yw; Sb[2-3]/TM6B stock was used. The number of insertions was determined by Southern blot analysis. The cry1Y strain, with a deletion of most Su(Ste) repeats, has been described (35). To produce males carrying the cry1Y chromosome, Df (1)w67c23(2), y females were crossed to X/Bs cry1Yy+ males. The strains carrying the aub and spn-E mutations were y1 ac1 sc1 w1 Ste+; P{lacW}aubsting-1/Cy and Ste+; ru1 st1 spn-E1 e1 ca1/TM3, Sb1 es.

Detection of transcripts by in situ hybridization. DNA fluorescent in situ hybridization (FISH) experiments on whole-mount embryos was performed as described previously (3). A plasmid template containing a full-length Stellate gene (1,150 bp) was used for PCR amplification to produce 631-bp PCR products containing a Stellate open reading frame and either T3 or T7 RNA polymerase promoter sequences. PCR products were cleaned before transcription, using a PCR purification kit (QIAGEN), and probes were transcribed by T7 or T3 RNA polymerase. About 1 µg of template was used in a 10- to 20-µl transcription reaction mixture with a nucleotide mix containing either digoxigenin (DIG)-UTP or biotin-UTP. The labeled RNA was partially hydrolyzed by incubation at 60°C in a 40 mM NaHCO3-60 mM Na2CO3 solution. After neutralization and ethanol precipitation, RNA was dissolved in 20 µl of water and 80 µl of hybridization solution HS (50% formamide, 5x SSC [1x SSC is 0.15 M NaCl plus0.015 M sodium citrate], 0.1% Tween 20, 5 mg of torula RNA/ml, 50 µg of heparin/ml) was added.

Testes were dissected in 1x phosphate-buffered saline (PBS), fixed for 20 min in 4% paraformaldehyde in 1x PBS, washed three times for 5 min in PBT (1x PBS, 0.1% Tween 20), treated with a solution of 50 µg of proteinase K/ml in 1x PBS for 8 min, washed with a solution of 2 mg of glycine/ml in PBT for 2 min and two times for 5 min in PBT, refixed for 20 min in 4% paraformaldehyde in 1x PBS, and washed two times for 5 min in PBT and finally with 50% HS in PBT. After prehybridization in HS at 60°C for 1 to 3 h, samples were hybridized overnight at 60°C in 150 to 200 µl of HS containing 2.5 to 5 ng of riboprobe/µl. After hybridization, samples were washed three times for 30 min in HS at 60°C, 15 min in 50% HS in PBT at 60°C, two times for 15 min in 2x SSC-0.1% Tween 20 at 60°C, two times for 15 min in 0.2x SSC-0.1% Tween 20 at 60°C, and two times for 15 min in PBT at room temperature. Samples were incubated for 1 to 2 h in 1x PBS-0.3% Triton X-100-1% bovine serum albumin-10% goat serum for blocking and in the same solution with antibodies for 1 h. The following antibody concentrations were used: 1:2,000 for anti-DIG-alkaline phosphatase (AP) (Roche), 1:50 for anti-rhodamine (Roche), and 1:500 for anti-biotin-fluorescein isothiocyanate (Vector). Samples were washed two times for 15 min in 1x PBS-0.3% Triton X-100, once for 15 min in PBS-250 mM NaCl-0.2% NP-40-0.2% Tween 20, and two times for 15 min in 1x PBS-0.3% Triton X-100.

For fluorescence detection, DNA was counterstained with 0.2 µg of 4',6'-diamidino-2-phenylindole (DAPI)/ml in PBT for 10 min, washed in PBT, washed in 1x PBS, and mounted in 30 to 40 µl of ProLong antifade (Molecular Probes). For AP reactions, samples were washed for 10 min in AP buffer (100 mM NaCl, 50 mM MgCl2, 100 mM Tris [pH 9.5], 0.1% Tween 20) and incubated with 1 ml of AP buffer with 20 µl of nitroblue tetrazolium-5-bromo-4-chloro-3-indolylphosphate (NBT/BCIP) stock solution (Roche) added. Development of the reaction was observed visually, and the reaction was stopped after 0.5 to 1 h. Samples were washed two times for 3 min with PBT and mounted in 70% glycerol in 1x PBS.

For DNA and RNA FISH experiments, images were acquired with a cooled charge-coupled device camera (Micromax YHS 1300; Roper Scientific) mounted on a DMRXA Leica microscope with a 100x Plan/Apo objective (numerical aperture, 1.4) mounted on a Roper Scientific piezo electric z-axis actuator. For Fig. 2, single slices from z stacks were deconvolved by a Huygens MLE single-TIF procedure (Scientific Volume Imaging).



View larger version (42K):
[in this window]
[in a new window]
 
FIG. 2. FISH detection of sense and antisense transcripts in wild-type spermatocytes. (a) Sense and antisense RNAs in the nuclei of early (EPS) and mature (MPS) primary spermatocytes of wild-type males. DIG-labeled probes were visualized by using rhodamine-coupled antibodies (red); DNA was stained with DAPI (blue). Staining in the cytoplasm is due to tissue autofluorescence. (b) Simultaneous detection of sense and antisense transcripts in mature primary spermatocyte nuclei. The DIG-labeled probe for sense RNA was visualized with rhodamine-coupled antibodies (red), and the biotin-labeled probe for antisense RNA was visualized with fluorescein isothiocyanate-coupled antibodies (green). DNA was stained with DAPI (blue). Images obtained from separate channels (upper line) and the composite image (bottom) are shown.

dsRNA processing in vitro. PCR products of the lacZ or Su(Ste) gene carrying T7 promoters on both ends were used as transcription templates. RNA was transcribed by using T7 RNA polymerase (Boehringer) according to the manufacturer's instructions. RNA was heated to 65°C for 10 min and then slowly cooled to room temperature for 1 h. Cell lysates of Schneider 2 cells were prepared as described previously (4). To obtain testis extract, 50 testis pairs were dissected on ice in PBS solution and centrifuged at 6,000 x g, PBS was removed, and an equal volume (25 µl) of buffer was added (25 mM HEPES [pH 7.4], 100 mM CH3COOK, 2 mM MgCl2, 6 mM ß-mercaptoethanol, 1 mg of AEBSF protease inhibitor and Complete protease inhibitor [Roche]/ml). Tissue grinder homogenization was followed by centrifugation at 20,000 x g for 20 min. Internally [{alpha}-32P]UTP-labeled dsRNA (50 nM) was incubated at 25°C for 1 h in a 50-µl reaction volume containing 25 µl of lysate, 1 mM ATP, 10 mM creatine phosphate, and 30 µg of creatine phosphokinase/ml. Reactions were stopped by the addition of Trizol reagent (GIBCO BRL). RNA was isolated by using the standard Trizol protocol and was analyzed by electrophoresis in a 15% polyacrylamide gel. [{gamma}-32P]ATP-labeled RNA size markers were prepared by using T4 polynucleotide kinase (New England Biolabs).

ß-Gal activity assay. Eight pairs of hand-dissected testes were added to 200 µl of Z buffer (60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4, 0.35% ß-mercaptoethanol). Testes were homogenized with a tissue grinder, and 100 µl of 0.4% ONPG (o-nitrophenyl-ß-D-galactopyranoside) (Sigma) in Z buffer was added. Samples were incubated at 37°C for 3 h, and the reaction was stopped by adding 1 ml of 0.52 M Na2CO3. The extracts were centrifuged at 20,000 x g for 1 min. ß-Gal activity was calculated from absorbance measured at 420 and 550 nm.

Detection of Su(Ste) small RNA and X-Gal (5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside) staining of testes were performed as described previously (2). The detection of miR-304 and miR-12 was carried out by hybridization (30) with the oligonucleotides CTCACATTTACAAATTGAGATTA and ACCAGTACCTGATGTAATACTCA, respectively, labeled with [{gamma}-32P]ATP, using T4 polynucleotide kinase (New England Biolabs).


arrow
RESULTS
 
Nuclear localization of Stellate and Su(Ste) transcripts in germ cells. To determine the subcellular localization of Stellate and Su(Ste) transcripts, we used in situ hybridization with sense and antisense Stellate single-stranded RNA probes. These probes hybridize to both Stellate and Su(Ste) RNAs due to a high level of sequence identity between them. The specificity of hybridization was first tested by DNA FISH to salivary gland polytene chromosomes and to embryonic interphase nuclei (data not shown). The probe produces a single signal on polytene chromosomes at 12D on the X chromosome, where the euchromatic Stellate locus is located. Because heterochromatin is underrepresented in polytene chromosomes, the Y-linked Su(Ste) locus and the second X-heterochromatin Stellate locus are not detected. Hybridization to embryonic interphase nuclei, in contrast, yields two signals in nuclei of female embryos and three signals in male nuclei. These results are consistent with hybridization with the two X-linked Stellate loci (in the euchromatin at 12D and in the heterochromatin at h26) and the Y-linked Su(Ste) locus. Since females carry two X chromosomes that are paired in most somatic nuclei in embryos at this developmental stage, two signals per nucleus are expected, while in males a third signal corresponds to the Su(Ste) locus located on the Y chromosome.

RNA in situ hybridization with single-stranded probes was done on dissected testes, using the same sequences as for the DNA probe described above. D. melanogaster testes are composed of male germ cells in successive stages of spermatogenesis and several types of somatic cells. We detected abundant antisense transcripts in early and mature primary spermatocytes. In early primary spermatocytes of wild-type males, the antisense RNA had a diffuse nuclear localization (Fig. 1 and 2a). DNA counterstaining by DAPI showed that the antisense signal corresponds to the non-DAPI-stained nuclear region (Fig. 2a). In the subsequent mature primary spermatocyte developmental stage, strong nuclear antisense signals are seen as distinct dots (one, two, or occasionally more) in each nucleus. No antisense transcripts are detected in the cytoplasm of spermatocytes at any stage. As expected for cry1Y males, which have a partial deletion of Su(Ste) repeats, probing for antisense RNA produces a dramatically weaker signal than in wild-type males. Thus, the abundant antisense transcripts of wild-type males have a nuclear localization and their expression is significantly decreased in cry1Y males.



View larger version (97K):
[in this window]
[in a new window]
 
FIG. 1. Localization of sense and antisense Stellate and Su(Ste) transcripts in testes. Sense and antisense RNA were detected by using single-stranded probes in whole testes of wild-type males (XY) and of males with a deletion of the bulk of Su(Ste) repeats (Xcry1Y). DIG-labeled probes were visualized by using AP-coupled antibodies following color reaction with NBT/BCIP substrate. The segments shown in enlarged panels correspond to early (EPS) and mature (MPS) primary spermatocyte stages. In wild-type males, antisense transcripts are abundant in the nuclei of early primary spermatocytes, while in cry1Y males the signal area is greatly decreased. In mature primary spermatocytes, antisense transcripts are detected as one or two sharp dots per nucleus. In cry1Y males the signals are not visible in all nuclei. Sense RNA is detected only at the mature primary spermatocyte stage, as faint dots in nuclei of the wild-type males or as a strong diffuse signal in the cytoplasm of cry1Y males.

The probe for Stellate and Su(Ste) sense RNAs does not detect any signal in early primary spermatocytes, which represent the developmental stage where antisense transcripts are first detected. In the subsequent mature primary spermatocyte stage, we detected sense RNA signals in nuclei as distinct faint dots that are qualitatively similar to the signals of antisense transcripts at the same stage (Fig. 1 and 2a). No signal above background was seen in the cytoplasm of wild-type males. In contrast, when silencing was relieved in cry1Y males, the sense RNA was detected as a strong and dispersed signal in the cytoplasm of mature primary spermatocytes. No sense RNA was detected in the nuclei of cry1Y males (Fig. 1). Thus, sense transcripts appear after antisense RNAs and are localized as compact dots in nuclei of mature primary spermatocytes of wild-type males but are found in the cytoplasm when silencing is relieved.

We have ruled out the possibility that the sense and antisense RNA signals in nuclei of mature primary spermatocytes arise from DNA hybridization: no signals are detected in somatic cells, and RNase treatment of fixed testes before hybridization eliminates the signals. Simultaneous detection of sense and antisense RNAs demonstrates that the sense and antisense transcripts are colocalized in nuclei of wild-type mature primary spermatocytes (Fig. 2b). This suggests that the sites where sense and antisense transcripts colocalize might represent nuclear sites of dsRNA formation.

The short Su(Ste) RNA detected in vivo is longer than siRNAs. Stellate silencing has been shown to be associated with the presence in testes of a homologous short 25- to 27-nt RNA that is likely processed from Su(Ste) dsRNA. The short Su(Ste) RNA is longer than canonical siRNA (21 to 23 nt) and endogenous microRNAs (21 to 24 nt) processed from hairpin precursors in D. melanogaster (1). This apparent size difference is not a technical artifact caused by decreased RNA mobility because of a high concentration of total RNA in the samples (data not shown), nor is the length of the short RNA related to some peculiarity of the Su(Ste) RNA sequence. In vitro-synthesized Su(Ste) dsRNAs incubated with a cell culture extract are processed into fragments of the same size (21 to 23 nt) as lacZ dsRNA (Fig. 3a) rather than the 25 to 27 nt of endogenous Su(Ste) short RNA (Fig. 3b). Thus, both Stellate and Su(Ste) dsRNAs are processed in vitro into fragments of canonic siRNA sizes, while the in vivo product is longer. The same result was obtained using testis extract (Fig. 3a). It cannot be excluded that specific processing occurs only in germ cells, whereas siRNAs of standard size are produced in the somatic cells. However, the complete absence of longer products in testis extract-treated RNA is in conflict with this explanation.



View larger version (56K):
[in this window]
[in a new window]
 
FIG. 3. Sizes of short RNAs produced by dsRNA processing in vitro and detected in vivo. (a) Twenty-one- to 23-nt RNA fragments of lacZ and Su(Ste) are produced by dsRNA processing in cell culture and testis extracts. In vitro-synthesized, uniformly labeled lacZ or Su(Ste) dsRNAs were incubated with cell culture or testis extracts, and RNAs were isolated and separated on a 15% denaturing acrylamide gel. Total testis RNA from wild-type males was separated in parallel. 32P-labeled RNA oligonucleotides were used as size markers. (b) The same gel was electroblotted to a membrane and hybridized with a Su(Ste) probe to detect the 25- to 27-nt Su(Ste) RNA in the total testis RNA preparation. Hybridization also increased the strength of signals from the in vitro-synthesized Su(Ste) dsRNA.

The Aub and Spn-E proteins are required for the presence of Su(Ste) short RNA in vivo but are dispensable for dsRNA processing in vitro. Stellate derepression in the presence of an intact Su(Ste) locus has been observed as a result of mutations in the aub and spn-E genes, which encode an Argonaute family protein and a DExH RNA helicase, respectively (2, 40, 44). The Stellate derepression caused by mutation was not a result of lack of Su(Ste) antisense transcription (2). Both aub and spn-E are required for artificial RNAi in oocytes and embryos (23). spn-E mutation also leads to an increased steady-state level of several retrotransposon transcripts in the germ line (2, 44). We tested for the presence of Su(Ste) short RNA in testes of aub and spn-E mutant males. Su(Ste) short RNAs of both polarity are absent in total testis RNA isolated from homozygous aub and from homozygous spn-E males (Fig. 4a). This observation supports the correlation between Stellate silencing and the presence of short RNAs and implicates the Aub and Spn-E proteins in the formation and/or stabilization of the short RNAs. We have also investigated the effect of the aub and spn-E mutations on the expression of microRNA in testes. The expression of two microRNAs (miR-304 and miR-12) is increased in testes as compared to somatic tissues (data not shown). However, the amounts of both microRNAs were not affected by the aub and spn-E mutations (Fig. 4b; data not shown). Thus, different sets of proteins are involved in the expression of Su(Ste) short RNA and microRNAs in testes.



View larger version (59K):
[in this window]
[in a new window]
 
FIG. 4. Effects of aub and spn-E mutations on the presence of the short Su(Ste) RNA and of microRNA in vivo and on processing of dsRNA in vitro. (a) Short Su(Ste) RNAs are absent in homozygous aub and spn-E mutants. Equal quantities of total RNA isolated from testes of heterozygous (+/–) and homozygous (–/–) males were separated on a gel and hybridized with a Su(Ste) probe. (b) There is no effect of either mutation on the amount of miR-304. (c) aub and spn-E mutations do not affect in vitro processing of dsRNA to 21- to 23-nt fragments. lacZ dsRNA was incubated with extracts prepared from testes of heterozygous (+/–) or homozygous (–/–) males. No degradation of dsRNA was detected in the absence of testis extract (lysate–).

To analyze the role of Aub and Spn-E in dsRNA processing in vitro, 32P-labeled Su(Ste) dsRNA was incubated with mutant testis extracts. Normal processing of dsRNA into 21- to 23-nt siRNA was observed in testis extracts obtained from both aub and spn-E males (Fig. 4c), suggesting that the proteins are not directly involved in dsRNA cleavage even though they are required for in vivo production of the 25- to 27-nt Su(Ste) RNA.

Disruption of homology to Su(Ste) repeats in the transcribed region of the Stellate gene relieves silencing of reporter constructs. Stellate silencing may be investigated by using reporter constructs that include Stellate sequences fused to lacZ (2). The Ste134-lacZ construct contains 134 bp of the Stellate gene, including 104 bp of nontranscribed sequence followed by 30 bp from the 5'-UTR of the first Stellate exon (Fig. 5a). This fragment drives Su(Ste)-dependent lacZ expression in testes (2). Assuming a posttranscriptional mechanism of silencing, only 30 bp of this sequence represents a target for homologous recognition and degradation. We substituted three sequential nucleotides located in the middle of the 30-bp sequence (+16 to +18 with respect to the transcription start) to produce the Ste134mut-lacZ construct (Fig. 5a). This mismatch may prevent the complementary interaction between Stellate and Su(Ste) short RNAs. Measurement of ß-Gal activity in testes of wild-type males carrying this mutated construct showed a considerable (two- to fivefold for different stocks) increase of lacZ expression compared to that in males with the ancestral Ste134-lacZ construct (Fig. 5b). In contrast, the expression level was roughly the same for both constructs in cry1Y males, suggesting that mutation does not lead to Su(Ste)-independent promoter activation. Thus, local perturbation of complementarity in the transcribed region between the Stellate transcripts and the small Su(Ste) RNA results in a relief of silencing similar to that produced by cry1Y deletion.



View larger version (37K):
[in this window]
[in a new window]
 
FIG. 5. Structures and expression of reporter constructs containing Stellate sequences. (a) The structures of Stellate genes and reporter Ste-lacZ fusion constructs used for Drosophila transformation. The Ste134-lacZ construct contains a 134-bp fragment of the Stellate gene, including 104 bp of nontranscribed sequence followed by 30 bp of the transcribed noncoding region from the first Stellate exon. An arrow indicates the site of substitution of three adjacent nucleotides in the Stellate 5'-UTR sequence in the Ste134mut-lacZ construct. In the ß2tub-Ste-lacZ construct, the ß2tub promoter drives expression of the Ste open reading frame, detached from intron 2, fused to lacZ. (b) Nucleotide substitutions in the Stellate transcribed region result in relief of Su(Ste)-dependent silencing. ß-Gal activity was measured in testis extracts from wild-type (filled bars) and cry1Y (open bars) males for three stocks carrying independent insertions of Stel34-lacZ and eight stocks with independent insertions of Ste134mut-lacZ. There is less difference in lacZ expression between wild-type and cry1Y males that carry the Ste134mut-lacZ construct than between those that carry the Stel34-lacZ construct. Southern analysis confirmed that all of the stocks carry a single transgene insertion. (c) X-Gal staining of testes from transgenic flies carrying the ß2tub-Ste-lacZ construct. Weak expression was observed in the germ cells of wild-type males, while in cry1Y males strong staining was detected throughout the testes except in the very tip. cry1Y males have a five- to sevenfold higher level of ß-Gal activity than wild-type (XY) males.

To test whether the Stellate promoter is necessary for Su(Ste)-dependent repression, we used a ß2tub-Ste-lacZ construct. This transgene contains an almost complete Stellate open reading frame fused to the lacZ gene under control of the heterologous ß2-tubulin promoter (Fig. 5a), which provides strong constitutive expression in male germ cells. Weak lacZ expression was observed in testes of wild-type males. In cry1Y males, however, strong staining was detected in all but the tip of the testes, as expected for ß2-tubulin-driven expression (Fig. 5c). In other words, a construct carrying a heterologous promoter that contains only Stellate coding sequence is still repressed by Su(Ste). Hence, the nontranscribed promoter region of Stellate appears to be dispensable for repression, supporting a posttranscriptional mechanism of Stellate silencing.


arrow
DISCUSSION
 
Here we present studies of natural RNA silencing of the X-linked Stellate repeats. Silencing of Stellate repeats in the D. melanogaster germ line is required for male fertility and is mediated by an interaction with the homologous heterochromatic Y-linked Su(Ste) repeats. Natural RNA silencing associated with the presence of short RNA may be a common factor in the control of heterochromatin functions. In S. pombe long dsRNA produced from centromeric repeats is processed into short RNAs that guide the initiation of heterochromatin formation (38, 50, 51). Various types of transposable elements that make up a considerable part of the heterochromatin in higher eukaryotes have been shown to be repressed by an RNA-silencing mechanism (1, 8, 24, 45, 48, 53, 56). As a first step in dissecting the Stellate silencing mechanism, we have examined the processing and distribution of Stellate and Su(Ste) RNAs.

Nuclear step of dsRNA maturation. Our group has previously shown that Stellate gene transcription yields only sense transcripts, while Su(Ste) repeats yield both sense and antisense transcripts. We have also observed that expression of Stellate and sense Su(Ste) transcripts is repressed in wild-type males but that antisense Su(Ste) transcripts escape silencing despite their complementarity to short RNAs (2). Here, we showed that antisense RNAs accumulate in the nucleoplasm and are not transported into the cytoplasm. This result supports our earlier proposal that nonpolyadenylated antisense RNAs escape the cytoplasmic degradation machinery because they are sequestered in the nucleus (2).

Sense transcripts are localized in nuclei of mature wild-type primary spermatocytes. In cry1Y males, in which the Stellate genes are derepressed, these transcripts are found only in the cytoplasm. These results correspond to the accumulation of the Stellate-coded protein as crystalline aggregates in the cytoplasm of mature primary spermatocytes of cry1Y males (7). The total amount of Stellate and Su(Ste) sense transcripts is greatly increased in cry1Y males (2, 7, 35). The absence of a nuclear signal in cry1Y males, contrasted with the presence of sense transcripts in wild-type nuclei, therefore suggests that these transcripts are never released from the wild-type nucleus. Nuclear retention of sense transcripts in the wild type might be explained by the interaction between sense and antisense transcripts. Nuclear localization of sense and antisense transcripts has also been observed for bidirectionally transcribed white transgenes, which induce RNAi of the endogenous white gene (13).

The distinct sharp dots observed in the nuclei for both sense and antisense RNAs in mature primary spermatocytes may correspond to the accumulation of the native transcript at the sites of transcription. The signals are often located at the border between the chromatin (DAPI stained) and the nucleoplasmic areas of the nucleus, where actively transcribed loci are thought to be located. Restricted nuclear signals corresponding to the sites of transcription have been observed for a number of genes (52), whereas transcripts in the process of export from the nucleus are usually below the detection sensitivity of the standard in situ hybridization technique. The colocalization of the sense and antisense transcripts suggests the formation of dsRNA in the nucleus, thus placing the initiation of Stellate silencing in the nucleus. We propose that these nuclear dsRNA species may involve hybrids between sense and antisense Su(Ste) transcripts, as well as between sense Stellate and antisense Su(Ste) transcripts, and that these hybrids are essential for Stellate silencing by Su(Ste).

Different sizes of the short Su(Ste) RNAs and typical siRNAs. We observed a strong correlation between Stellate silencing and the presence in testes of sense and antisense 25- to 27-nt RNAs homologous to Stellate and Su(Ste) sequences. The short RNAs are absent when Stellate genes are derepressed as a consequence of either a Su(Ste) locus deletion or mutations in the aub and spn-E genes. The cloning of short RNA from D. melanogaster testes also demonstrates the presence of short RNAs that are derived from Su(Ste) and are highly homologous to Stellate (1). A rigid size restriction of 21 to 23 nt has, however, been observed for siRNA in various in vitro studies of D. melanogaster RNAi. Examination of Dicer activity with different dsRNAs suggests a strong specificity of processing to 21- to 23-nt fragments in both Drosophila embryo extracts and cell culture (4, 9). Furthermore, investigation of the functional anatomy of chemically synthesized siRNAs in embryo extracts defined the optimal length of siRNAs as 21 to 23 nt, while RNAs longer than 24 nt have practically no cognate-mRNA cleavage activity (10). It has been proposed that only RNAs that meet this size requirement can be loaded into the RISC. However, examples of the existence of two size classes of short RNAs (21 or 22 nt and 24 to 26 nt) involved in silencing have also been reported. Two different size variants of short RNAs were observed during artificial silencing in plants, with the short variant responsible for posttranscriptional gene silencing and the long one most likely participating in DNA methylation and spreading of the silencing signal (16). Furthermore, only RNAs from the long class have been detected that correspond to endogenous plant transposable elements. Two size classes of short RNAs are produced from dsRNA in plant extracts, and the activity of different Dicer proteins was shown to be responsible for producing each class (46). Cloning of endogenous short RNAs from D. melanogaster has also identified two size classes of short RNAs, with the short class (21 to 23 nt) including microRNAs and the long class (24 to 26 nt) comprising sequences derived from transcripts of transposable elements and other repetitive heterochromatic sequences (1).

The larger size of the short Su(Ste) RNA may be explained by specific sequences affecting dsRNA processing by Dicer or by the presence in testes of specific factors that change the cleavage interval of dsRNA. However, we find that exogenous Su(Ste) dsRNA is cleaved into 21- to 23-nt siRNA in testis extracts, most likely reflecting the activity of the same Dicer protein that acts in somatic tissues. We favor the hypothesis that the 25- to 27-nt Su(Ste) RNAs detected in vivo are produced by a mechanism at least partially different from conventional siRNA production. A clue to the origin of the short Su(Ste) RNAs comes from the finding that Su(Ste) dsRNA formation occurs in the nucleus, unlike that of artificial RNAi, in which dsRNA is believed to be processed in the cytoplasm (5). Both conventional-size siRNA and a longer short RNA have been observed during viroid replication in the plant nucleus (36). Two size classes of short RNAs may be produced in D. melanogaster by different Dicer proteins, as has been demonstrated in plants (46). Alternatively, specific nuclear factors may affect how a single Dicer protein processes dsRNA in the nucleus.

Role of Aub and Spn-E in formation of short RNAs. We observed that mutations in the aub and spn-E genes lead to elimination of short Su(Ste) RNA in testes. However, neither mutation affects processing of exogenously provided dsRNA to 21- to 23-nt siRNA in testis extracts. It has been observed that both aub and spn-E mutations block RNAi in oocytes produced by injected dsRNA (23). The authors proposed that both proteins affect RNAi because of their involvement in translational control, but our results suggest that Aub and Spn-E may be involved in the production and/or stabilization of siRNA. Similarly, the rde-1 and mut-7 genes of Caenorhabditis elegans are required for the production of siRNA in vivo but are dispensable for dsRNA processing in vitro (37, 48). The authors showed that the corresponding proteins are required for long-term stabilization of siRNA rather than for dsRNA processing.

The aub and spn-E mutations eliminate the short Su(Ste) RNA without affecting the abundance of two different microRNAs in testes. We propose that distinct protein complexes mediate production and/or stabilization of short Su(Ste) RNA and microRNAs in testes. Similarly, different members of the Argonaute family participate in artificial RNAi and in microRNA processing in C. elegans and plants (5, 16), despite the central role of Dicer in both processes (6, 14).

Mechanism of Stellate repression. Homologous silencing mediated by short RNA may occur by posttranscriptional degradation of mRNA (49, 54) and by DNA and chromatin modification leading to transcriptional repression (16, 41, 56). The nuclear antisense RNA accumulation and dsRNA formation that we have found raises the question of whether posttranscriptional or transcriptional mechanisms of silencing operate in Stellate repression. For animals, it is generally believed that artificial RNAi caused by dsRNA leads to posttranscriptional degradation of mRNA. However, it has been shown that dsRNA or short RNA can affect transcription and chromatin structure of homologous sequences in plants and Saccharomyces cerevisiae (30, 51, 56). In plants, for example, transcriptional silencing of reporter constructs can be caused if the dsRNA produced by hairpin constructs or virus infection is homologous to the untranscribed promoter region of the target gene, while posttranscriptional degradation of the corresponding mRNA occurs if there is homology between the dsRNA and the transcribed sequence (30, 31).

We have observed that constructs containing the Stellate coding sequence driven by a heterologous promoter are regulated by Su(Ste) repeats in the same manner as native Stellate genes or reporter constructs with Stellate sequence fused to lacZ. In contrast, expression of the endogenous ßNac-like genes, having a putative promoter region with high levels of sequence similarity (95%) to Stellate but an unrelated transcribed sequence, shows no response to the deletion of Su(Ste) (L. Usakin and G. L. Kogan, unpublished results). In the present study, we also found that nucleotide substitutions in the transcribed region of a Stellate fragment homologous to the Su(Ste) sequence lead to a release of silencing. Thus, homology to Su(Ste) in the untranscribed region is dispensable for repression, while local disturbance of complementarity in the transcribed sequence impairs silencing. We cannot rule out the possibility that regulatory sequences important for transcriptional silencing may be present in the transcribed region, but our results are more simply explained by a posttranscriptional Stellate silencing mechanism.

The two blocks of tandemly repeated Stellate genes are located in intercalary and constitutive heterochromatin of the X chromosome (27, 42), and Su(Ste) repeats are located in the heterochromatic Y chromosome. siRNA-mediated transcriptional repression of centromeric heterochromatin repeats has been recently demonstrated in S. cerevisiae (51). Our results do not exclude participation of transcriptional repression of genomic Stellate repeats acting in concert with a posttranscriptional mechanism. Similarly, both transcriptional and posttranscriptional mechanisms have been shown to operate in the repression of multicopy transgenes associated with the presence of homologous short RNA in D. melanogaster (34). Thus, both transcriptional and posttranscriptional mechanisms might act in Stellate silencing, and further studies will be directed to understanding the contribution of each of them.


arrow
ACKNOWLEDGMENTS
 
We thank Leonard Robbins, Yair Dorsett, and Phillip Zamore for text improvements and critical comments.

This work was supported by grants from the Russian Foundation for Basic Researches (N 02-04-48498), INTAS (N 01-0279), the Russian Foundation for Science School Support (N 2074, 2003.4), the Physics-Chemical Biology Program of RAS, and INTAS young scientist fellowship YSF 00-243 to A.A.A. The work of F.B. and G.C. was supported by grants from the CNRS (ATIPE), the Association pour la Recherche sur le Cancer, and the Human Frontier Science Program Organization.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Institute of Molecular Genetics of RAS, Kurchatov sq., 2, Moscow 123182, Russia. Phone: (7-095)196-0012. Fax: (7-095)196-0221. E-mail: gvozdev{at}img.ras.ru. Back

{dagger} Present address: Laboratory for RNA Molecular Biology, The Rockefeller University, New York, NY 10021. Back


arrow
REFERENCES
 
    1
  1. Aravin, A. A., M. Lagos-Quintana, A. Yalcin, M. Zavolan, D. Marks, B. Snyder, T. Gaasterland, J. Meyer, and T. Tuschl. 2003. The Small RNA profile during Drosophila melanogaster development. Dev. Cell 5:337-350.[CrossRef][Medline]
  2. 2
  3. Aravin, A. A., N. M. Naumova, A. V. Tulin, V. V. Vagin, Y. M. Rozovsky, and V. A. Gvozdev. 2001. Double-stranded RNA-mediated silencing of genomic tandem repeats and transposable elements in the D. melanogaster germline. Curr. Biol. 11:1017-1027.[CrossRef][Medline]
  4. 3
  5. Bantignies, F., C. Grimaud, S. Lavrov, M. Gabut, and G. Cavalli. 2003. Inheritance of Polycomb-dependent chromosomal interactions in Drosophila. Genes Dev. 17:2406-2420.[Abstract/Free Full Text]
  6. 4
  7. Bernstein, E., A. A. Caudy, S. M. Hammond, and G. J. Hannon. 2001. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 409:363-366.[CrossRef][Medline]
  8. 5
  9. Billy, E., V. Brondani, H. Zhang, U. Muller, and W. Filipowicz. 2001. Specific interference with gene expression induced by long, double-stranded RNA in mouse embryonal teratocarcinoma cell lines. Proc. Natl. Acad. Sci. USA 98:14428-14433.[Abstract/Free Full Text]
  10. 6
  11. Boutet, S., F. Vazquez, J. Liu, C. Beclin, M. Fagard, A. Gratias, J. B. Morel, P. Crete, X. Chen, and H. Vaucheret. 2003. Arabidopsis HEN1. A genetic link between endogenous miRNA controlling development and siRNA controlling transgene silencing and virus resistance. Curr. Biol. 13:843-848.[CrossRef][Medline]
  12. 7
  13. Bozzetti, M. P., S. Massari, P. Finelli, F. Meggio, L. A. Pinna, B. Boldyreff, O. G. Issinger, G. Palumbo, C. Ciriaco, S. Bonaccorsi, et al. 1995. The Ste locus, a component of the parasitic cry-Ste system of Drosophila melanogaster, encodes a protein that forms crystals in primary spermatocytes and mimics properties of the beta subunit of casein kinase 2. Proc. Natl. Acad. Sci. USA 92:6067-6071.[Abstract/Free Full Text]
  14. 8
  15. Djikeng, A., H. Shi, C. Tschudi, and E. Ullu. 2001. RNA interference in Trypanosoma brucei: cloning of small interfering RNAs provides evidence for retroposon-derived 24-26-nucleotide RNAs. RNA 7:1522-1530.[Abstract]
  16. 9
  17. Elbashir, S. M., W. Lendeckel, and T. Tuschl. 2001. RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev. 15:188-200.[Abstract/Free Full Text]
  18. 10
  19. Elbashir, S. M., J. Martinez, A. Patkaniowska, W. Lendeckel, and T. Tuschl. 2001. Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate. EMBO J. 20:6877-6888.[CrossRef][Medline]
  20. 11
  21. Fire, A., S. Xu, M. K. Montgomery, S. A. Kostas, S. E. Driver, and C. C. Mello. 1998. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391:806-811.[CrossRef][Medline]
  22. 12
  23. Fraser, A. G., R. S. Kamath, P. Zipperlen, M. Martinez-Campos, M. Sohrmann, and J. Ahringer. 2000. Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408:325-330.[CrossRef][Medline]
  24. 13
  25. Giordano, E., R. Rendina, I. Peluso, and M. Furia. 2002. RNAi triggered by symmetrically transcribed transgenes in Drosophila melanogaster. Genetics 160:637-648.[Abstract/Free Full Text]
  26. 14
  27. Grishok, A., A. E. Pasquinelli, D. Conte, N. Li, S. Parrish, I. Ha, D. L. Baillie, A. Fire, G. Ruvkun, and C. C. Mello. 2001. Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing. Cell 106:23-34.[CrossRef][Medline]
  28. 15
  29. Hall, I. M., G. D. Shankaranarayana, K. Noma, N. Ayoub, A. Cohen, and S. I. Grewal. 2002. Establishment and maintenance of a heterochromatin domain. Science 297:2232-2237.[Abstract/Free Full Text]
  30. 16
  31. Hamilton, A., O. Voinnet, L. Chappell, and D. Baulcombe. 2002. Two classes of short interfering RNA in RNA silencing. EMBO J. 21:4671-4679.[CrossRef][Medline]
  32. 17
  33. Hammond, S. M., E. Bernstein, D. Beach, and G. J. Hannon. 2000. An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature 404:293-296.[CrossRef][Medline]
  34. 18
  35. Hammond, S. M., S. Boettcher, A. A. Caudy, R. Kobayashi, and G. J. Hannon. 2001. Argonaute2, a link between genetic and biochemical analyses of RNAi. Science 293:1146-1150.[Abstract/Free Full Text]
  36. 19
  37. Hutvagner, G., J. McLachlan, A. E. Pasquinelli, E. Balint, T. Tuschl, and P. D. Zamore. 2001. A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA. Science 293:834-838.[Abstract/Free Full Text]
  38. 20
  39. Hutvagner, G., and P. D. Zamore. 2002. A microRNA in a multiple-turnover RNAi enzyme complex. Science 297:2056-2060.[Abstract/Free Full Text]
  40. 21
  41. Ishizuka, A., M. C. Siomi, and H. Siomi. 2002. A Drosophila fragile X protein interacts with components of RNAi and ribosomal proteins. Genes Dev. 16:2497-2508.[Abstract/Free Full Text]
  42. 22
  43. Kamath, R. S., A. G. Fraser, Y. Dong, G. Poulin, R. Durbin, M. Gotta, A. Kanapin, N. Le Bot, S. Moreno, M. Sohrmann, D. P. Welchman, P. Zipperlen, and J. Ahringer. 2003. Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421:231-237.[CrossRef][Medline]
  44. 23
  45. Kennerdell, J. R., S. Yamaguchi, and R. W. Carthew. 2002. RNAi is activated during Drosophila oocyte maturation in a manner dependent on aubergine and spindle-E. Genes Dev. 16:1884-1889.[Abstract/Free Full Text]
  46. 24
  47. Ketting, R. F., T. H. Haverkamp, H. G. van Luenen, and R. H. Plasterk. 1999. Mut-7 of C. elegans, required for transposon silencing and RNA interference, is a homolog of Werner syndrome helicase and RNaseD. Cell 99:133-141.[CrossRef][Medline]
  48. 25
  49. Lam, G., and C. S. Thummel. 2000. Inducible expression of double-stranded RNA directs specific genetic interference in Drosophila. Curr. Biol. 10:957-963.[CrossRef][Medline]
  50. 26
  51. Livak, K. 1990. Detailed structure of the Drosophila melanogaster Stellate genes and their transcripts. Genetics 124:303-316.[Abstract]
  52. 27
  53. Livak, K. J. 1984. Organization and mapping of a sequence on the Drosophila melanogaster X and Y chromosomes that is transcribed during spermatogenesis. Genetics 107:611-634.[Abstract/Free Full Text]
  54. 28
  55. Llave, C., Z. Xie, K. D. Kasschau, and J. C. Carrington. 2002. Cleavage of Scarecrow-like mRNA targets directed by a class of Arabidopsis miRNA. Science 297:2053-2056.[Abstract/Free Full Text]
  56. 29
  57. Martinez, J., A. Patkaniowska, H. Urlaub, R. Luhrmann, and T. Tuschl. 2002. Single-stranded antisense siRNAs guide target RNA cleavage in RNAi. Cell 110:563-574.[CrossRef][Medline]
  58. 30
  59. Mette, M. F., W. Aufsatz, J. van Der Winden, M. A. Matzke, and A. J. Matzke. 2000. Transcriptional silencing and promoter methylation triggered by double-stranded RNA. EMBO J. 19:5194-5201.[CrossRef][Medline]
  60. 31
  61. Mette, M. F., A. J. Matzke, and M. A. Matzke. 2001. Resistance of RNA-mediated TGS to HC-Pro, a viral suppressor of PTGS, suggests alternative pathways for dsRNA processing. Curr. Biol. 11:1119-1123.[CrossRef][Medline]
  62. 32
  63. Mourelatos, Z., J. Dostie, S. Paushkin, A. Sharma, B. Charroux, L. Abel, J. Rappsilber, M. Mann, and G. Dreyfuss. 2002. miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. Genes Dev. 16:720-728.[Abstract/Free Full Text]
  64. 33
  65. Nykanen, A., B. Haley, and P. D. Zamore. 2001. ATP requirements and small interfering RNA structure in the RNA interference pathway. Cell 107:309-321.[CrossRef][Medline]
  66. 34
  67. Pal-Bhadra, M., U. Bhadra, and J. A. Birchler. 2002. RNAi related mechanisms affect both transcriptional and posttranscriptional transgene silencing in Drosophila. Mol. Cell 9:315-327.[CrossRef][Medline]
  68. 35
  69. Palumbo, G., S. Bonaccorsi, L. G. Robbins, and S. Pimpinelli. 1994. Genetic analysis of Stellate elements of Drosophila melanogaster. Genetics 138:1181-1197.[Abstract]
  70. 36
  71. Papaefthimiou, I., A. Hamilton, M. Denti, D. Baulcombe, M. Tsagris, and M. Tabler. 2001. Replicating potato spindle tuber viroid RNA is accompanied by short RNA fragments that are characteristic of post-transcriptional gene silencing. Nucleic Acids Res. 29:2395-2400.[Abstract/Free Full Text]
  72. 37
  73. Parrish, S., and A. Fire. 2001. Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans. RNA 7:1397-1402.[Abstract]
  74. 38
  75. Reinhart, B. J., and D. P. Bartel. 2002. Small RNAs correspond to centromere heterochromatic repeats. Science 297:1831.[Free Full Text]
  76. 39
  77. Rubin, G. M., and A. C. Spradling. 1982. Genetic transformation of Drosophila with transposable element vectors. Science 218:348-353.[Abstract/Free Full Text]
  78. 40
  79. Schmidt, A., G. Palumbo, M. P. Bozzetti, P. Tritto, S. Pimpinelli, and U. Schafer. 1999. Genetic and molecular characterization of sting, a gene involved in crystal formation and meiotic drive in the male germ line of Drosophila melanogaster. Genetics 151:749-760.[Abstract/Free Full Text]
  80. 41
  81. Schramke, V., and R. Allshire. 2003. Hairpin RNAs and retrotransposon LTRs effect RNAi and chromatin-based gene silencing. Science 301:1069-1074.[Abstract/Free Full Text]
  82. 42
  83. Shevelyov, Y. Y. 1992. Copies of a Stellate gene variant are located in the X heterochromatin of Drosophila melanogaster and are probably expressed. Genetics 132:1033-1037.[Abstract]
  84. 43
  85. Shi, H., A. Djikeng, T. Mark, E. Wirtz, C. Tschudi, and E. Ullu. 2000. Genetic interference in Trypanosoma brucei by heritable and inducible double-stranded RNA. RNA 6:1069-1076.[Abstract]
  86. 44
  87. Stapleton, W., S. Das, and B. D. McKee. 2001. A role of the Drosophila homeless gene in repression of Stellate in male meiosis. Chromosoma 110:228-240.[Medline]
  88. 45
  89. Tabara, H., M. Sarkissian, W. G. Kelly, J. Fleenor, A. Grishok, L. Timmons, A. Fire, and C. C. Mello. 1999. The rde-1 gene, RNA interference, and transposon silencing in C. elegans. Cell 99:123-132.[CrossRef][Medline]
  90. 46
  91. Tang, G., B. J. Reinhart, D. P. Bartel, and P. D. Zamore. 2003. A biochemical framework for RNA silencing in plants. Genes Dev. 17:49-63.[Abstract/Free Full Text]
  92. 47
  93. Thummel, C., A. Boulet, and H. Lipshitz. 1988. Vectors for Drosophila P-element-mediated transformation and tissue culture transfection. Gene 74:445-456.[CrossRef][Medline]
  94. 48
  95. Tijsterman, M., R. F. Ketting, K. L. Okihara, T. Sijen, and R. H. Plasterk. 2002. RNA helicase MUT-14-dependent gene silencing triggered in C. elegans by short antisense RNAs. Science 295:694-697.[Abstract/Free Full Text]
  96. 49
  97. Tuschl, T., P. D. Zamore, R. Lehmann, D. P. Bartel, and P. A. Sharp. 1999. Targeted mRNA degradation by double-stranded RNA in vitro. Genes Dev. 13:3191-3197.[Abstract/Free Full Text]
  98. 50
  99. Verdel, A., S. Jia, S. Gerber, T. Sugiyama, S. Gygi, S. I. Grewal, and D. Moazed. 2004. RNAi-mediated targeting of heterochromatin by the RITS complex. Science 303:672-676.[Abstract/Free Full Text]
  100. 51
  101. Volpe, T. A., C. Kidner, I. M. Hall, G. Teng, S. I. Grewal, and R. A. Martienssen. 2002. Regulation of heterochromatic silencing and histone H3 lysine-9 methylation by RNAi. Science 297:1833-1837.[Abstract/Free Full Text]
  102. 52
  103. Wilkie, G. S., A. W. Shermoen, P. H. O'Farrell, and I. Davis. 1999. Transcribed genes are localized according to chromosomal position within polarized Drosophila embryonic nuclei. Curr. Biol. 9:1263-1266.[CrossRef][Medline]
  104. 53
  105. Wu-Scharf, D., B. Jeong, C. Zhang, and H. Cerutti. 2000. Transgene and transposon silencing in Chlamydomonas reinhardtii by a DEAH-Box RNA helicase. Science 290:1159-1163.[Abstract/Free Full Text]
  106. 54
  107. Zamore, P. D., T. Tuschl, P. A. Sharp, and D. P. Bartel. 2000. RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 101:25-33.[CrossRef][Medline]
  108. 55
  109. Zhang, H., F. A. Kolb, V. Brondani, E. Billy, and W. Filipowicz. 2002. Human Dicer preferentially cleaves dsRNAs at their termini without a requirement for ATP. EMBO J. 21:5875-5885.[CrossRef][Medline]
  110. 56
  111. Zilberman, D., X. Cao, and S. E. Jacobsen. 2003. ARGONAUTE4 control of locus-specific siRNA accumulation and DNA and histone methylation. Science 299:716-719.[Abstract/Free Full Text]


Molecular and Cellular Biology, August 2004, p. 6742-6750, Vol. 24, No. 15
0270-7306/04/$08.00+0     DOI: 10.1128/MCB.24.15.6742-6750.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Vagin, V. V., Wohlschlegel, J., Qu, J., Jonsson, Z., Huang, X., Chuma, S., Girard, A., Sachidanandam, R., Hannon, G. J., Aravin, A. A. (2009). Proteomic analysis of murine Piwi proteins reveals a role for arginine methylation in specifying interaction with Tudor family members. Genes Dev. 23: 1749-1762 [Abstract] [Full Text]  
  • Navarro, C., Bullock, S., Lehmann, R. (2009). Altered dynein-dependent transport in piRNA pathway mutants. Proc. Natl. Acad. Sci. USA 106: 9691-9696 [Abstract] [Full Text]  
  • Kotelnikov, R. N., Klenov, M. S., Rozovsky, Y. M., Olenina, L. V., Kibanov, M. V., Gvozdev, V. A. (2009). Peculiarities of piRNA-mediated post-transcriptional silencing of Stellate repeats in testes of Drosophila melanogaster. Nucleic Acids Res 37: 3254-3263 [Abstract] [Full Text]  
  • Obbard, D. J, Gordon, K. H.J, Buck, A. H, Jiggins, F. M (2009). The evolution of RNAi as a defence against viruses and transposable elements. Phil Trans R Soc B 364: 99-115 [Abstract] [Full Text]  
  • Shpiz, S., Kwon, D., Rozovsky, Y., Kalmykova, A. (2009). rasiRNA pathway controls antisense expression of Drosophila telomeric retrotransposons in the nucleus. Nucleic Acids Res 37: 268-278 [Abstract] [Full Text]  
  • Klattenhoff, C., Theurkauf, W. (2008). Biogenesis and germline functions of piRNAs. Development 135: 3-9 [Abstract] [Full Text]  
  • Nishida, K. M., Saito, K., Mori, T., Kawamura, Y., Nagami-Okada, T., Inagaki, S., Siomi, H., Siomi, M. C. (2007). Gene silencing mechanisms mediated by Aubergine piRNA complexes in Drosophila male gonad. RNA 13: 1911-1922 [Abstract] [Full Text]  
  • Extavour, C. G. M. (2007). Evolution of the bilaterian germ line: lineage origin and modulation of specification mechanisms. Integr. Comp. Biol. 47: 770-785 [Abstract] [Full Text]  
  • Klenov, M. S., Lavrov, S. A., Stolyarenko, A. D., Ryazansky, S. S., Aravin, A. A., Tuschl, T., Gvozdev, V. A. (2007). Repeat-associated siRNAs cause chromatin silencing of retrotransposons in the Drosophila melanogaster germline. Nucleic Acids Res 0: gkm576v1-9 [Abstract] [Full Text]  
  • Hartig, J. V., Tomari, Y., Forstemann, K. (2007). piRNAs--the ancient hunters of genome invaders. Genes Dev. 21: 1707-1713 [Abstract] [Full Text]  
  • Saito, K., Sakaguchi, Y., Suzuki, T., Suzuki, T., Siomi, H., Siomi, M. C. (2007). Pimet, the Drosophila homolog of HEN1, mediates 2'-O-methylation of Piwi- interacting RNAs at their 3' ends. Genes Dev. 21: 1603-1608 [Abstract] [Full Text]  
  • Gunawardane, L. S., Saito, K., Nishida, K. M., Miyoshi, K., Kawamura, Y., Nagami, T., Siomi, H., Siomi, M. C. (2007). A Slicer-Mediated Mechanism for Repeat-Associated siRNA 5' End Formation in Drosophila. Science 315: 1587-1590 [Abstract] [Full Text]  
  • Pelisson, A., Sarot, E., Payen-Groschene, G., Bucheton, A. (2007). A Novel Repeat-Associated Small Interfering RNA-Mediated Silencing Pathway Downregulates Complementary Sense gypsy Transcripts in Somatic Cells of the Drosophila Ovary. J. Virol. 81: 1951-1960 [Abstract] [Full Text]  
  • Prasanth, K. V., Spector, D. L. (2007). Eukaryotic regulatory RNAs: an answer to the 'genome complexity' conundrum. Genes Dev. 21: 11-42 [Abstract] [Full Text]  
  • Shigenobu, S., Kitadate, Y., Noda, C., Kobayashi, S. (2006). Molecular characterization of embryonic gonads by gene expression profiling in Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 103: 13728-13733 [Abstract] [Full Text]  
  • Saito, K., Nishida, K. M., Mori, T., Kawamura, Y., Miyoshi, K., Nagami, T., Siomi, H., Siomi, M. C. (2006). Specific association of Piwi with rasiRNAs derived from retrotransposon and heterochromatic regions in the Drosophila genome. Genes Dev. 20: 2214-2222 [Abstract] [Full Text]  
  • Kim, V. N. (2006). Small RNAs just got bigger: Piwi-interacting RNAs (piRNAs) in mammalian testes. Genes Dev. 20: 1993-1997 [Abstract] [Full Text]  
  • Lau, N. C., Seto, A. G., Kim, J., Kuramochi-Miyagawa, S., Nakano, T., Bartel, D. P., Kingston, R. E. (2006). Characterization of the piRNA Complex from Rat Testes. Science 313: 363-367 [Abstract] [Full Text]  
  • Vagin, V. V., Sigova, A., Li, C., Seitz, H., Gvozdev, V., Zamore, P. D. (2006). A Distinct Small RNA Pathway Silences Selfish Genetic Elements in the Germline. Science 313: 320-324 [Abstract] [Full Text]  
  • Savitsky, M., Kwon, D., Georgiev, P., Kalmykova, A., Gvozdev, V. (2006). Telomere elongation is under the control of the RNAi-based mechanism in the Drosophila germline. Genes Dev. 20: 345-354 [Abstract] [Full Text]  
  • THEURKAUF, W.E., KLATTENHOFF, C., BRATU, D.P., McGINNIS-SCHULTZ, N., KOPPETSCH, B.S., COOK, H.A. (2006). rasiRNAs, DNA Damage, and Embryonic Axis Specification. Cold Spring Harb Symp Quant Biol 71: 171-180 [Abstract]  
  • BASS, B.L. (2006). How Does RNA Editing Affect dsRNA-mediated Gene Silencing?. Cold Spring Harb Symp Quant Biol 71: 285-292 [Abstract]  
  • SIOMI, M. C., TSUKUMO, H., ISHIZUKA, A., NAGAMI, T., SIOMI, H. (2005). A potential link between transgene silencing and poly(A) tails. RNA 11: 1004-1011 [Abstract] [Full Text]  
  • MANIATAKI, E., MOURELATOS, Z. (2005). Human mitochondrial tRNAMet is exported to the cytoplasm and associates with the Argonaute 2 protein. RNA 11: 849-852 [Abstract] [Full Text]  
  • Ullu, E., Lujan, H. D., Tschudi, C. (2005). Small Sense and Antisense RNAs Derived from a Telomeric Retroposon Family in Giardia intestinalis. Eukaryot Cell 4: 1155-1157 [Abstract] [Full Text]  
  • Mattick, J. S., Makunin, I. V. (2005). Small regulatory RNAs in mammals. Hum Mol Genet 14: R121-R132 [Abstract] [Full Text]  
  • Kalmykova, A. I., Klenov, M. S., Gvozdev, V. A. (2005). Argonaute protein PIWI controls mobilization of retrotransposons in the Drosophila male germline. Nucleic Acids Res 33: 2052-2059 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Aravin, A. A.
Right arrow Articles by Gvozdev, V. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Aravin, A. A.
Right arrow Articles by Gvozdev, V. A.