![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Molecular and Cellular Biology, August 2004, p. 6742-6750, Vol. 24, No. 15
0270-7306/04/$08.00+0 DOI: 10.1128/MCB.24.15.6742-6750.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Mikhail S. Klenov,1 Vasilii V. Vagin,1 Frédéric Bantignies,2 Giacomo Cavalli,2 and Vladimir A. Gvozdev1*
Department of Animal Molecular Genetics, Institute of Molecular Genetics, Moscow 123182, Russia,1 Chromatin and Cell Biology Laboratory, Institute of Human Genetics, Centre National de la Recherche Scientifique, 34396 Montpellier, France2
Received 12 November 2003/ Returned for modification 31 December 2003/ Accepted 6 April 2004
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Twenty-one- to 23-nucleotide (nt) short interfering (si) RNAs formed by processing of long dsRNA molecules by the RNase Dicer play a central role in dsRNA-mediated silencing (4, 46, 55). siRNA is assumed to act as a guide for the RNase complex (RISC) that degrades homologous mRNAs (9, 17, 33). microRNAs are involved in the control of expression of cellular genes (14, 19, 20, 29). microRNAs are transcribed as precursors with a stem-loop structure that are processed by Dicer into single-stranded RNAs of a size similar to that of siRNA. Recent experiments suggest that siRNAs and microRNAs can be loaded into a common RISC (20, 28, 29, 32). The Argonaute family of proteins represents the conserved core component of siRNA- and microRNA-containing complexes isolated from both D. melanogaster and mammals (18, 21, 29, 32).
The repression of Stellate in D. melanogaster by the closely homologous Su(Ste) repeats shares a number of traits with artificial RNAi. Bidirectional transcription of Su(Ste) repeats leads to formation of short sense and antisense RNAs (2). Derepression of Stellate occurs in aubergine (aub) and spindle-E (spn-E) mutants, genes that encode an Argonaute-family protein and a DExH RNA helicase, respectively (2, 40, 44). Recently, a requirement for the Aub and Spn-E proteins for dsRNA-injection-provoked RNAi was shown in D. melanogaster embryos (23). In the fission yeast, Schizosaccharomyces pombe, components of the RNAi machinery are involved in natural repression of centromeric heterochromatin, which contains remnants of transposable elements that are transcribed bidirectionally (51). Short RNAs complementary to centromeric repeats have been found (38), and mutations in genes encoding the Argonaute protein and the dsRNA-processing enzyme Dicer lead to derepression of centromeric repeats (15, 51). Antisense transcription of Su(Ste) repeats in D. melanogaster is thought to be caused by a hoppel transposon insertion (2). Thus, two systems of natural silencing, one in D. melanogaster and one in S. pombe, evolved as a result of heterochromatic genome rearrangements and use of the RNAi machinery.
Here, we extended the study of natural dsRNA-mediated silencing in D. melanogaster. Using in situ hybridization, we examined the order of steps that lead to Su(Ste) dsRNA formation. We found that (i) accumulation of antisense Su(Ste) RNA is followed by formation of dsRNA in the nuclei of spermatocytes at successive stages of spermatogenesis, (ii) mutations in the aub and spn-E genes lead to disappearance of short Su(Ste) RNA, but (iii) these mutations have no effect on microRNA formation, indicating that different protein complexes are involved in the formation of microRNA and Su(Ste) short RNA in testes. We also show that the Stellate promoter is dispensable for silencing and propose a posttranscriptional mechanism for Stellate repression.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Drosophila strains, transformation, and genetic crosses. P-element-mediated germ line transformation of Df (1)w67c23(2), y embryos was performed according to standard protocol (39). For remobilization of the P{Ste134mut-lacZ} element, the yw; Sb[2-3]/TM6B stock was used. The number of insertions was determined by Southern blot analysis. The cry1Y strain, with a deletion of most Su(Ste) repeats, has been described (35). To produce males carrying the cry1Y chromosome, Df (1)w67c23(2), y females were crossed to X/Bs cry1Yy+ males. The strains carrying the aub and spn-E mutations were y1 ac1 sc1 w1 Ste+; P{lacW}aubsting-1/Cy and Ste+; ru1 st1 spn-E1 e1 ca1/TM3, Sb1 es.
Detection of transcripts by in situ hybridization. DNA fluorescent in situ hybridization (FISH) experiments on whole-mount embryos was performed as described previously (3). A plasmid template containing a full-length Stellate gene (1,150 bp) was used for PCR amplification to produce 631-bp PCR products containing a Stellate open reading frame and either T3 or T7 RNA polymerase promoter sequences. PCR products were cleaned before transcription, using a PCR purification kit (QIAGEN), and probes were transcribed by T7 or T3 RNA polymerase. About 1 µg of template was used in a 10- to 20-µl transcription reaction mixture with a nucleotide mix containing either digoxigenin (DIG)-UTP or biotin-UTP. The labeled RNA was partially hydrolyzed by incubation at 60°C in a 40 mM NaHCO3-60 mM Na2CO3 solution. After neutralization and ethanol precipitation, RNA was dissolved in 20 µl of water and 80 µl of hybridization solution HS (50% formamide, 5x SSC [1x SSC is 0.15 M NaCl plus0.015 M sodium citrate], 0.1% Tween 20, 5 mg of torula RNA/ml, 50 µg of heparin/ml) was added.
Testes were dissected in 1x phosphate-buffered saline (PBS), fixed for 20 min in 4% paraformaldehyde in 1x PBS, washed three times for 5 min in PBT (1x PBS, 0.1% Tween 20), treated with a solution of 50 µg of proteinase K/ml in 1x PBS for 8 min, washed with a solution of 2 mg of glycine/ml in PBT for 2 min and two times for 5 min in PBT, refixed for 20 min in 4% paraformaldehyde in 1x PBS, and washed two times for 5 min in PBT and finally with 50% HS in PBT. After prehybridization in HS at 60°C for 1 to 3 h, samples were hybridized overnight at 60°C in 150 to 200 µl of HS containing 2.5 to 5 ng of riboprobe/µl. After hybridization, samples were washed three times for 30 min in HS at 60°C, 15 min in 50% HS in PBT at 60°C, two times for 15 min in 2x SSC-0.1% Tween 20 at 60°C, two times for 15 min in 0.2x SSC-0.1% Tween 20 at 60°C, and two times for 15 min in PBT at room temperature. Samples were incubated for 1 to 2 h in 1x PBS-0.3% Triton X-100-1% bovine serum albumin-10% goat serum for blocking and in the same solution with antibodies for 1 h. The following antibody concentrations were used: 1:2,000 for anti-DIG-alkaline phosphatase (AP) (Roche), 1:50 for anti-rhodamine (Roche), and 1:500 for anti-biotin-fluorescein isothiocyanate (Vector). Samples were washed two times for 15 min in 1x PBS-0.3% Triton X-100, once for 15 min in PBS-250 mM NaCl-0.2% NP-40-0.2% Tween 20, and two times for 15 min in 1x PBS-0.3% Triton X-100.
For fluorescence detection, DNA was counterstained with 0.2 µg of 4',6'-diamidino-2-phenylindole (DAPI)/ml in PBT for 10 min, washed in PBT, washed in 1x PBS, and mounted in 30 to 40 µl of ProLong antifade (Molecular Probes). For AP reactions, samples were washed for 10 min in AP buffer (100 mM NaCl, 50 mM MgCl2, 100 mM Tris [pH 9.5], 0.1% Tween 20) and incubated with 1 ml of AP buffer with 20 µl of nitroblue tetrazolium-5-bromo-4-chloro-3-indolylphosphate (NBT/BCIP) stock solution (Roche) added. Development of the reaction was observed visually, and the reaction was stopped after 0.5 to 1 h. Samples were washed two times for 3 min with PBT and mounted in 70% glycerol in 1x PBS.
For DNA and RNA FISH experiments, images were acquired with a cooled charge-coupled device camera (Micromax YHS 1300; Roper Scientific) mounted on a DMRXA Leica microscope with a 100x Plan/Apo objective (numerical aperture, 1.4) mounted on a Roper Scientific piezo electric z-axis actuator. For Fig. 2, single slices from z stacks were deconvolved by a Huygens MLE single-TIF procedure (Scientific Volume Imaging).
|
-32P]UTP-labeled dsRNA (50 nM) was incubated at 25°C for 1 h in a 50-µl reaction volume containing 25 µl of lysate, 1 mM ATP, 10 mM creatine phosphate, and 30 µg of creatine phosphokinase/ml. Reactions were stopped by the addition of Trizol reagent (GIBCO BRL). RNA was isolated by using the standard Trizol protocol and was analyzed by electrophoresis in a 15% polyacrylamide gel. [
-32P]ATP-labeled RNA size markers were prepared by using T4 polynucleotide kinase (New England Biolabs). ß-Gal activity assay. Eight pairs of hand-dissected testes were added to 200 µl of Z buffer (60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4, 0.35% ß-mercaptoethanol). Testes were homogenized with a tissue grinder, and 100 µl of 0.4% ONPG (o-nitrophenyl-ß-D-galactopyranoside) (Sigma) in Z buffer was added. Samples were incubated at 37°C for 3 h, and the reaction was stopped by adding 1 ml of 0.52 M Na2CO3. The extracts were centrifuged at 20,000 x g for 1 min. ß-Gal activity was calculated from absorbance measured at 420 and 550 nm.
Detection of Su(Ste) small RNA and X-Gal (5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside) staining of testes were performed as described previously (2). The detection of miR-304 and miR-12 was carried out by hybridization (30) with the oligonucleotides CTCACATTTACAAATTGAGATTA and ACCAGTACCTGATGTAATACTCA, respectively, labeled with [-32P]ATP, using T4 polynucleotide kinase (New England Biolabs).
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
RNA in situ hybridization with single-stranded probes was done on dissected testes, using the same sequences as for the DNA probe described above. D. melanogaster testes are composed of male germ cells in successive stages of spermatogenesis and several types of somatic cells. We detected abundant antisense transcripts in early and mature primary spermatocytes. In early primary spermatocytes of wild-type males, the antisense RNA had a diffuse nuclear localization (Fig. 1 and 2a). DNA counterstaining by DAPI showed that the antisense signal corresponds to the non-DAPI-stained nuclear region (Fig. 2a). In the subsequent mature primary spermatocyte developmental stage, strong nuclear antisense signals are seen as distinct dots (one, two, or occasionally more) in each nucleus. No antisense transcripts are detected in the cytoplasm of spermatocytes at any stage. As expected for cry1Y males, which have a partial deletion of Su(Ste) repeats, probing for antisense RNA produces a dramatically weaker signal than in wild-type males. Thus, the abundant antisense transcripts of wild-type males have a nuclear localization and their expression is significantly decreased in cry1Y males.
|
We have ruled out the possibility that the sense and antisense RNA signals in nuclei of mature primary spermatocytes arise from DNA hybridization: no signals are detected in somatic cells, and RNase treatment of fixed testes before hybridization eliminates the signals. Simultaneous detection of sense and antisense RNAs demonstrates that the sense and antisense transcripts are colocalized in nuclei of wild-type mature primary spermatocytes (Fig. 2b). This suggests that the sites where sense and antisense transcripts colocalize might represent nuclear sites of dsRNA formation.
The short Su(Ste) RNA detected in vivo is longer than siRNAs. Stellate silencing has been shown to be associated with the presence in testes of a homologous short 25- to 27-nt RNA that is likely processed from Su(Ste) dsRNA. The short Su(Ste) RNA is longer than canonical siRNA (21 to 23 nt) and endogenous microRNAs (21 to 24 nt) processed from hairpin precursors in D. melanogaster (1). This apparent size difference is not a technical artifact caused by decreased RNA mobility because of a high concentration of total RNA in the samples (data not shown), nor is the length of the short RNA related to some peculiarity of the Su(Ste) RNA sequence. In vitro-synthesized Su(Ste) dsRNAs incubated with a cell culture extract are processed into fragments of the same size (21 to 23 nt) as lacZ dsRNA (Fig. 3a) rather than the 25 to 27 nt of endogenous Su(Ste) short RNA (Fig. 3b). Thus, both Stellate and Su(Ste) dsRNAs are processed in vitro into fragments of canonic siRNA sizes, while the in vivo product is longer. The same result was obtained using testis extract (Fig. 3a). It cannot be excluded that specific processing occurs only in germ cells, whereas siRNAs of standard size are produced in the somatic cells. However, the complete absence of longer products in testis extract-treated RNA is in conflict with this explanation.
|
|
Disruption of homology to Su(Ste) repeats in the transcribed region of the Stellate gene relieves silencing of reporter constructs. Stellate silencing may be investigated by using reporter constructs that include Stellate sequences fused to lacZ (2). The Ste134-lacZ construct contains 134 bp of the Stellate gene, including 104 bp of nontranscribed sequence followed by 30 bp from the 5'-UTR of the first Stellate exon (Fig. 5a). This fragment drives Su(Ste)-dependent lacZ expression in testes (2). Assuming a posttranscriptional mechanism of silencing, only 30 bp of this sequence represents a target for homologous recognition and degradation. We substituted three sequential nucleotides located in the middle of the 30-bp sequence (+16 to +18 with respect to the transcription start) to produce the Ste134mut-lacZ construct (Fig. 5a). This mismatch may prevent the complementary interaction between Stellate and Su(Ste) short RNAs. Measurement of ß-Gal activity in testes of wild-type males carrying this mutated construct showed a considerable (two- to fivefold for different stocks) increase of lacZ expression compared to that in males with the ancestral Ste134-lacZ construct (Fig. 5b). In contrast, the expression level was roughly the same for both constructs in cry1Y males, suggesting that mutation does not lead to Su(Ste)-independent promoter activation. Thus, local perturbation of complementarity in the transcribed region between the Stellate transcripts and the small Su(Ste) RNA results in a relief of silencing similar to that produced by cry1Y deletion.
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Nuclear step of dsRNA maturation. Our group has previously shown that Stellate gene transcription yields only sense transcripts, while Su(Ste) repeats yield both sense and antisense transcripts. We have also observed that expression of Stellate and sense Su(Ste) transcripts is repressed in wild-type males but that antisense Su(Ste) transcripts escape silencing despite their complementarity to short RNAs (2). Here, we showed that antisense RNAs accumulate in the nucleoplasm and are not transported into the cytoplasm. This result supports our earlier proposal that nonpolyadenylated antisense RNAs escape the cytoplasmic degradation machinery because they are sequestered in the nucleus (2).
Sense transcripts are localized in nuclei of mature wild-type primary spermatocytes. In cry1Y males, in which the Stellate genes are derepressed, these transcripts are found only in the cytoplasm. These results correspond to the accumulation of the Stellate-coded protein as crystalline aggregates in the cytoplasm of mature primary spermatocytes of cry1Y males (7). The total amount of Stellate and Su(Ste) sense transcripts is greatly increased in cry1Y males (2, 7, 35). The absence of a nuclear signal in cry1Y males, contrasted with the presence of sense transcripts in wild-type nuclei, therefore suggests that these transcripts are never released from the wild-type nucleus. Nuclear retention of sense transcripts in the wild type might be explained by the interaction between sense and antisense transcripts. Nuclear localization of sense and antisense transcripts has also been observed for bidirectionally transcribed white transgenes, which induce RNAi of the endogenous white gene (13).
The distinct sharp dots observed in the nuclei for both sense and antisense RNAs in mature primary spermatocytes may correspond to the accumulation of the native transcript at the sites of transcription. The signals are often located at the border between the chromatin (DAPI stained) and the nucleoplasmic areas of the nucleus, where actively transcribed loci are thought to be located. Restricted nuclear signals corresponding to the sites of transcription have been observed for a number of genes (52), whereas transcripts in the process of export from the nucleus are usually below the detection sensitivity of the standard in situ hybridization technique. The colocalization of the sense and antisense transcripts suggests the formation of dsRNA in the nucleus, thus placing the initiation of Stellate silencing in the nucleus. We propose that these nuclear dsRNA species may involve hybrids between sense and antisense Su(Ste) transcripts, as well as between sense Stellate and antisense Su(Ste) transcripts, and that these hybrids are essential for Stellate silencing by Su(Ste).
Different sizes of the short Su(Ste) RNAs and typical siRNAs. We observed a strong correlation between Stellate silencing and the presence in testes of sense and antisense 25- to 27-nt RNAs homologous to Stellate and Su(Ste) sequences. The short RNAs are absent when Stellate genes are derepressed as a consequence of either a Su(Ste) locus deletion or mutations in the aub and spn-E genes. The cloning of short RNA from D. melanogaster testes also demonstrates the presence of short RNAs that are derived from Su(Ste) and are highly homologous to Stellate (1). A rigid size restriction of 21 to 23 nt has, however, been observed for siRNA in various in vitro studies of D. melanogaster RNAi. Examination of Dicer activity with different dsRNAs suggests a strong specificity of processing to 21- to 23-nt fragments in both Drosophila embryo extracts and cell culture (4, 9). Furthermore, investigation of the functional anatomy of chemically synthesized siRNAs in embryo extracts defined the optimal length of siRNAs as 21 to 23 nt, while RNAs longer than 24 nt have practically no cognate-mRNA cleavage activity (10). It has been proposed that only RNAs that meet this size requirement can be loaded into the RISC. However, examples of the existence of two size classes of short RNAs (21 or 22 nt and 24 to 26 nt) involved in silencing have also been reported. Two different size variants of short RNAs were observed during artificial silencing in plants, with the short variant responsible for posttranscriptional gene silencing and the long one most likely participating in DNA methylation and spreading of the silencing signal (16). Furthermore, only RNAs from the long class have been detected that correspond to endogenous plant transposable elements. Two size classes of short RNAs are produced from dsRNA in plant extracts, and the activity of different Dicer proteins was shown to be responsible for producing each class (46). Cloning of endogenous short RNAs from D. melanogaster has also identified two size classes of short RNAs, with the short class (21 to 23 nt) including microRNAs and the long class (24 to 26 nt) comprising sequences derived from transcripts of transposable elements and other repetitive heterochromatic sequences (1).
The larger size of the short Su(Ste) RNA may be explained by specific sequences affecting dsRNA processing by Dicer or by the presence in testes of specific factors that change the cleavage interval of dsRNA. However, we find that exogenous Su(Ste) dsRNA is cleaved into 21- to 23-nt siRNA in testis extracts, most likely reflecting the activity of the same Dicer protein that acts in somatic tissues. We favor the hypothesis that the 25- to 27-nt Su(Ste) RNAs detected in vivo are produced by a mechanism at least partially different from conventional siRNA production. A clue to the origin of the short Su(Ste) RNAs comes from the finding that Su(Ste) dsRNA formation occurs in the nucleus, unlike that of artificial RNAi, in which dsRNA is believed to be processed in the cytoplasm (5). Both conventional-size siRNA and a longer short RNA have been observed during viroid replication in the plant nucleus (36). Two size classes of short RNAs may be produced in D. melanogaster by different Dicer proteins, as has been demonstrated in plants (46). Alternatively, specific nuclear factors may affect how a single Dicer protein processes dsRNA in the nucleus.
Role of Aub and Spn-E in formation of short RNAs. We observed that mutations in the aub and spn-E genes lead to elimination of short Su(Ste) RNA in testes. However, neither mutation affects processing of exogenously provided dsRNA to 21- to 23-nt siRNA in testis extracts. It has been observed that both aub and spn-E mutations block RNAi in oocytes produced by injected dsRNA (23). The authors proposed that both proteins affect RNAi because of their involvement in translational control, but our results suggest that Aub and Spn-E may be involved in the production and/or stabilization of siRNA. Similarly, the rde-1 and mut-7 genes of Caenorhabditis elegans are required for the production of siRNA in vivo but are dispensable for dsRNA processing in vitro (37, 48). The authors showed that the corresponding proteins are required for long-term stabilization of siRNA rather than for dsRNA processing.
The aub and spn-E mutations eliminate the short Su(Ste) RNA without affecting the abundance of two different microRNAs in testes. We propose that distinct protein complexes mediate production and/or stabilization of short Su(Ste) RNA and microRNAs in testes. Similarly, different members of the Argonaute family participate in artificial RNAi and in microRNA processing in C. elegans and plants (5, 16), despite the central role of Dicer in both processes (6, 14).
Mechanism of Stellate repression. Homologous silencing mediated by short RNA may occur by posttranscriptional degradation of mRNA (49, 54) and by DNA and chromatin modification leading to transcriptional repression (16, 41, 56). The nuclear antisense RNA accumulation and dsRNA formation that we have found raises the question of whether posttranscriptional or transcriptional mechanisms of silencing operate in Stellate repression. For animals, it is generally believed that artificial RNAi caused by dsRNA leads to posttranscriptional degradation of mRNA. However, it has been shown that dsRNA or short RNA can affect transcription and chromatin structure of homologous sequences in plants and Saccharomyces cerevisiae (30, 51, 56). In plants, for example, transcriptional silencing of reporter constructs can be caused if the dsRNA produced by hairpin constructs or virus infection is homologous to the untranscribed promoter region of the target gene, while posttranscriptional degradation of the corresponding mRNA occurs if there is homology between the dsRNA and the transcribed sequence (30, 31).
We have observed that constructs containing the Stellate coding sequence driven by a heterologous promoter are regulated by Su(Ste) repeats in the same manner as native Stellate genes or reporter constructs with Stellate sequence fused to lacZ. In contrast, expression of the endogenous ßNac-like genes, having a putative promoter region with high levels of sequence similarity (95%) to Stellate but an unrelated transcribed sequence, shows no response to the deletion of Su(Ste) (L. Usakin and G. L. Kogan, unpublished results). In the present study, we also found that nucleotide substitutions in the transcribed region of a Stellate fragment homologous to the Su(Ste) sequence lead to a release of silencing. Thus, homology to Su(Ste) in the untranscribed region is dispensable for repression, while local disturbance of complementarity in the transcribed sequence impairs silencing. We cannot rule out the possibility that regulatory sequences important for transcriptional silencing may be present in the transcribed region, but our results are more simply explained by a posttranscriptional Stellate silencing mechanism.
The two blocks of tandemly repeated Stellate genes are located in intercalary and constitutive heterochromatin of the X chromosome (27, 42), and Su(Ste) repeats are located in the heterochromatic Y chromosome. siRNA-mediated transcriptional repression of centromeric heterochromatin repeats has been recently demonstrated in S. cerevisiae (51). Our results do not exclude participation of transcriptional repression of genomic Stellate repeats acting in concert with a posttranscriptional mechanism. Similarly, both transcriptional and posttranscriptional mechanisms have been shown to operate in the repression of multicopy transgenes associated with the presence of homologous short RNA in D. melanogaster (34). Thus, both transcriptional and posttranscriptional mechanisms might act in Stellate silencing, and further studies will be directed to understanding the contribution of each of them.
|
ACKNOWLEDGMENTS |
|---|
This work was supported by grants from the Russian Foundation for Basic Researches (N 02-04-48498), INTAS (N 01-0279), the Russian Foundation for Science School Support (N 2074, 2003.4), the Physics-Chemical Biology Program of RAS, and INTAS young scientist fellowship YSF 00-243 to A.A.A. The work of F.B. and G.C. was supported by grants from the CNRS (ATIPE), the Association pour la Recherche sur le Cancer, and the Human Frontier Science Program Organization.
|
FOOTNOTES |
|---|
Present address: Laboratory for RNA Molecular Biology, The Rockefeller University, New York, NY 10021.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Aravin, A. A., N. M. Naumova, A. V. Tulin, V. V. Vagin, Y. M. Rozovsky, and V. A. Gvozdev. 2001. Double-stranded RNA-mediated silencing of genomic tandem repeats and transposable elements in the D. melanogaster germline. Curr. Biol. 11:1017-1027.[CrossRef][Medline]
3. Bantignies, F., C. Grimaud, S. Lavrov, M. Gabut, and G. Cavalli. 2003. Inheritance of Polycomb-dependent chromosomal interactions in Drosophila. Genes Dev. 17:2406-2420.
4. Bernstein, E., A. A. Caudy, S. M. Hammond, and G. J. Hannon. 2001. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 409:363-366.[CrossRef][Medline]
5. Billy, E., V. Brondani, H. Zhang, U. Muller, and W. Filipowicz. 2001. Specific interference with gene expression induced by long, double-stranded RNA in mouse embryonal teratocarcinoma cell lines. Proc. Natl. Acad. Sci. USA 98:14428-14433.
6. Boutet, S., F. Vazquez, J. Liu, C. Beclin, M. Fagard, A. Gratias, J. B. Morel, P. Crete, X. Chen, and H. Vaucheret. 2003. Arabidopsis HEN1. A genetic link between endogenous miRNA controlling development and siRNA controlling transgene silencing and virus resistance. Curr. Biol. 13:843-848.[CrossRef][Medline]
7. Bozzetti, M. P., S. Massari, P. Finelli, F. Meggio, L. A. Pinna, B. Boldyreff, O. G. Issinger, G. Palumbo, C. Ciriaco, S. Bonaccorsi, et al. 1995. The Ste locus, a component of the parasitic cry-Ste system of Drosophila melanogaster, encodes a protein that forms crystals in primary spermatocytes and mimics properties of the beta subunit of casein kinase 2. Proc. Natl. Acad. Sci. USA 92:6067-6071.
8. Djikeng, A., H. Shi, C. Tschudi, and E. Ullu. 2001. RNA interference in Trypanosoma brucei: cloning of small interfering RNAs provides evidence for retroposon-derived 24-26-nucleotide RNAs. RNA 7:1522-1530.[Abstract]
9. Elbashir, S. M., W. Lendeckel, and T. Tuschl. 2001. RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev. 15:188-200.
10. Elbashir, S. M., J. Martinez, A. Patkaniowska, W. Lendeckel, and T. Tuschl. 2001. Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate. EMBO J. 20:6877-6888.[CrossRef][Medline]
11. Fire, A., S. Xu, M. K. Montgomery, S. A. Kostas, S. E. Driver, and C. C. Mello. 1998. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391:806-811.[CrossRef][Medline]
12. Fraser, A. G., R. S. Kamath, P. Zipperlen, M. Martinez-Campos, M. Sohrmann, and J. Ahringer. 2000. Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408:325-330.[CrossRef][Medline]
13. Giordano, E., R. Rendina, I. Peluso, and M. Furia. 2002. RNAi triggered by symmetrically transcribed transgenes in Drosophila melanogaster. Genetics 160:637-648.
14. Grishok, A., A. E. Pasquinelli, D. Conte, N. Li, S. Parrish, I. Ha, D. L. Baillie, A. Fire, G. Ruvkun, and C. C. Mello. 2001. Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing. Cell 106:23-34.[CrossRef][Medline]
15. Hall, I. M., G. D. Shankaranarayana, K. Noma, N. Ayoub, A. Cohen, and S. I. Grewal. 2002. Establishment and maintenance of a heterochromatin domain. Science 297:2232-2237.
16. Hamilton, A., O. Voinnet, L. Chappell, and D. Baulcombe. 2002. Two classes of short interfering RNA in RNA silencing. EMBO J. 21:4671-4679.[CrossRef][Medline]
17. Hammond, S. M., E. Bernstein, D. Beach, and G. J. Hannon. 2000. An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature 404:293-296.[CrossRef][Medline]
18. Hammond, S. M., S. Boettcher, A. A. Caudy, R. Kobayashi, and G. J. Hannon. 2001. Argonaute2, a link between genetic and biochemical analyses of RNAi. Science 293:1146-1150.
19. Hutvagner, G., J. McLachlan, A. E. Pasquinelli, E. Balint, T. Tuschl, and P. D. Zamore. 2001. A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA. Science 293:834-838.
20. Hutvagner, G., and P. D. Zamore. 2002. A microRNA in a multiple-turnover RNAi enzyme complex. Science 297:2056-2060.
21. Ishizuka, A., M. C. Siomi, and H. Siomi. 2002. A Drosophila fragile X protein interacts with components of RNAi and ribosomal proteins. Genes Dev. 16:2497-2508.
22. Kamath, R. S., A. G. Fraser, Y. Dong, G. Poulin, R. Durbin, M. Gotta, A. Kanapin, N. Le Bot, S. Moreno, M. Sohrmann, D. P. Welchman, P. Zipperlen, and J. Ahringer. 2003. Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421:231-237.[CrossRef][Medline]
23. Kennerdell, J. R., S. Yamaguchi, and R. W. Carthew. 2002. RNAi is activated during Drosophila oocyte maturation in a manner dependent on aubergine and spindle-E. Genes Dev. 16:1884-1889.
24. Ketting, R. F., T. H. Haverkamp, H. G. van Luenen, and R. H. Plasterk. 1999. Mut-7 of C. elegans, required for transposon silencing and RNA interference, is a homolog of Werner syndrome helicase and RNaseD. Cell 99:133-141.[CrossRef][Medline]
25. Lam, G., and C. S. Thummel. 2000. Inducible expression of double-stranded RNA directs specific genetic interference in Drosophila. Curr. Biol. 10:957-963.[CrossRef][Medline]
26. Livak, K. 1990. Detailed structure of the Drosophila melanogaster Stellate genes and their transcripts. Genetics 124:303-316.[Abstract]
27. Livak, K. J. 1984. Organization and mapping of a sequence on the Drosophila melanogaster X and Y chromosomes that is transcribed during spermatogenesis. Genetics 107:611-634.
28. Llave, C., Z. Xie, K. D. Kasschau, and J. C. Carrington. 2002. Cleavage of Scarecrow-like mRNA targets directed by a class of Arabidopsis miRNA. Science 297:2053-2056.
29. Martinez, J., A. Patkaniowska, H. Urlaub, R. Luhrmann, and T. Tuschl. 2002. Single-stranded antisense siRNAs guide target RNA cleavage in RNAi. Cell 110:563-574.[CrossRef][Medline]
30. Mette, M. F., W. Aufsatz, J. van Der Winden, M. A. Matzke, and A. J. Matzke. 2000. Transcriptional silencing and promoter methylation triggered by double-stranded RNA. EMBO J. 19:5194-5201.[CrossRef][Medline]
31. Mette, M. F., A. J. Matzke, and M. A. Matzke. 2001. Resistance of RNA-mediated TGS to HC-Pro, a viral suppressor of PTGS, suggests alternative pathways for dsRNA processing. Curr. Biol. 11:1119-1123.[CrossRef][Medline]
32. Mourelatos, Z., J. Dostie, S. Paushkin, A. Sharma, B. Charroux, L. Abel, J. Rappsilber, M. Mann, and G. Dreyfuss. 2002. miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. Genes Dev. 16:720-728.
33. Nykanen, A., B. Haley, and P. D. Zamore. 2001. ATP requirements and small interfering RNA structure in the RNA interference pathway. Cell 107:309-321.[CrossRef][Medline]
34. Pal-Bhadra, M., U. Bhadra, and J. A. Birchler. 2002. RNAi related mechanisms affect both transcriptional and posttranscriptional transgene silencing in Drosophila. Mol. Cell 9:315-327.[CrossRef][Medline]
35. Palumbo, G., S. Bonaccorsi, L. G. Robbins, and S. Pimpinelli. 1994. Genetic analysis of Stellate elements of Drosophila melanogaster. Genetics 138:1181-1197.[Abstract]
36. Papaefthimiou, I., A. Hamilton, M. Denti, D. Baulcombe, M. Tsagris, and M. Tabler. 2001. Replicating potato spindle tuber viroid RNA is accompanied by short RNA fragments that are characteristic of post-transcriptional gene silencing. Nucleic Acids Res. 29:2395-2400.
37. Parrish, S., and A. Fire. 2001. Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans. RNA 7:1397-1402.[Abstract]
38. Reinhart, B. J., and D. P. Bartel. 2002. Small RNAs correspond to centromere heterochromatic repeats. Science 297:1831.
39. Rubin, G. M., and A. C. Spradling. 1982. Genetic transformation of Drosophila with transposable element vectors. Science 218:348-353.
40. Schmidt, A., G. Palumbo, M. P. Bozzetti, P. Tritto, S. Pimpinelli, and U. Schafer. 1999. Genetic and molecular characterization of sting, a gene involved in crystal formation and meiotic drive in the male germ line of Drosophila melanogaster. Genetics 151:749-760.
41. Schramke, V., and R. Allshire. 2003. Hairpin RNAs and retrotransposon LTRs effect RNAi and chromatin-based gene silencing. Science 301:1069-1074.
42. Shevelyov, Y. Y. 1992. Copies of a Stellate gene variant are located in the X heterochromatin of Drosophila melanogaster and are probably expressed. Genetics 132:1033-1037.[Abstract]
43. Shi, H., A. Djikeng, T. Mark, E. Wirtz, C. Tschudi, and E. Ullu. 2000. Genetic interference in Trypanosoma brucei by heritable and inducible double-stranded RNA. RNA 6:1069-1076.[Abstract]
44. Stapleton, W., S. Das, and B. D. McKee. 2001. A role of the Drosophila homeless gene in repression of Stellate in male meiosis. Chromosoma 110:228-240.[Medline]
45. Tabara, H., M. Sarkissian, W. G. Kelly, J. Fleenor, A. Grishok, L. Timmons, A. Fire, and C. C. Mello. 1999. The rde-1 gene, RNA interference, and transposon silencing in C. elegans. Cell 99:123-132.[CrossRef][Medline]
46. Tang, G., B. J. Reinhart, D. P. Bartel, and P. D. Zamore. 2003. A biochemical framework for RNA silencing in plants. Genes Dev. 17:49-63.
47. Thummel, C., A. Boulet, and H. Lipshitz. 1988. Vectors for Drosophila P-element-mediated transformation and tissue culture transfection. Gene 74:445-456.[CrossRef][Medline]
48. Tijsterman, M., R. F. Ketting, K. L. Okihara, T. Sijen, and R. H. Plasterk. 2002. RNA helicase MUT-14-dependent gene silencing triggered in C. elegans by short antisense RNAs. Science 295:694-697.
49. Tuschl, T., P. D. Zamore, R. Lehmann, D. P. Bartel, and P. A. Sharp. 1999. Targeted mRNA degradation by double-stranded RNA in vitro. Genes Dev. 13:3191-3197.
50. Verdel, A., S. Jia, S. Gerber, T. Sugiyama, S. Gygi, S. I. Grewal, and D. Moazed. 2004. RNAi-mediated targeting of heterochromatin by the RITS complex. Science 303:672-676.
51. Volpe, T. A., C. Kidner, I. M. Hall, G. Teng, S. I. Grewal, and R. A. Martienssen. 2002. Regulation of heterochromatic silencing and histone H3 lysine-9 methylation by RNAi. Science 297:1833-1837.
52. Wilkie, G. S., A. W. Shermoen, P. H. O'Farrell, and I. Davis. 1999. Transcribed genes are localized according to chromosomal position within polarized Drosophila embryonic nuclei. Curr. Biol. 9:1263-1266.[CrossRef][Medline]
53. Wu-Scharf, D., B. Jeong, C. Zhang, and H. Cerutti. 2000. Transgene and transposon silencing in Chlamydomonas reinhardtii by a DEAH-Box RNA helicase. Science 290:1159-1163.
54. Zamore, P. D., T. Tuschl, P. A. Sharp, and D. P. Bartel. 2000. RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 101:25-33.[CrossRef][Medline]
55. Zhang, H., F. A. Kolb, V. Brondani, E. Billy, and W. Filipowicz. 2002. Human Dicer preferentially cleaves dsRNAs at their termini without a requirement for ATP. EMBO J. 21:5875-5885.[CrossRef][Medline]
56. Zilberman, D., X. Cao, and S. E. Jacobsen. 2003. ARGONAUTE4 control of locus-specific siRNA accumulation and DNA and histone methylation. Science 299:716-719.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
