MCB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mamidipudi, V.
Right arrow Articles by Cartwright, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mamidipudi, V.
Right arrow Articles by Cartwright, C. A.
Molecular and Cellular Biology, August 2004, p. 6788-6798, Vol. 24, No. 15
0270-7306/04/$08.00+0     DOI: 10.1128/MCB.24.15.6788-6798.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

RACK1 Regulates G1/S Progression by Suppressing Src Kinase Activity

Vidya Mamidipudi, Jian Zhang, Kelly C. Lee, and Christine A. Cartwright*

Department of Medicine, Stanford University, Stanford, California 94305-5187

Received 4 February 2004/ Returned for modification 17 March 2004/ Accepted 28 April 2004


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cancer genes exert their greatest influence on the cell cycle by targeting regulators of a critical checkpoint in late G1. Once cells pass this checkpoint, they are fated to replicate DNA and divide. Cancer cells subvert controls at work at this restriction point and remain in cycle. Previously, we showed that RACK1 inhibits the oncogenic Src tyrosine kinase and NIH 3T3 cell growth. RACK1 inhibits cell growth, in part, by prolonging G0/G1. Here we show that RACK1 overexpression induces a partial G1 arrest by suppressing Src activity at the G1 checkpoint. RACK1 works through Src to inhibit Vav2, Rho GTPases, Stat3, and Myc. Consequently, cyclin D1 and cyclin-dependent kinases 4 and 2 (CDK4 and CDK2, respectively) are suppressed, CDK inhibitor p27 and retinoblastoma protein are activated, E2F1 is sequestered, and G1/S progression is delayed. Conversely, downregulation of RACK1 by short interference RNA activates Src-mediated signaling, induces Myc and cyclin D1, and accelerates G1/S progression. RACK1 suppresses Src- but not mitogen-activated protein kinase-dependent platelet-derived growth factor signaling. We also show that Stat3 is required for Rac1 induction of Myc. Our results reveal a novel mechanism of cell cycle control in late G1 that works via an endogenous inhibitor of the Src kinase.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
When regulated, the Src tyrosine kinase participates in a wide array of signaling pathways that control cell proliferation, differentiation, adhesion and survival (reviewed in references 2, 18, 39, and 51). Deregulated Src is oncogenic (10, 32, 40, 41). Thus, identifying mechanisms that regulate Src will reveal important information about how normal cells regulate their growth.

RACK1 is the founding member of a family of receptors for activated C kinase (PKC) collectively called RACKs (reviewed in references 22 and 34). Following serum or platelet-derived growth factor (PDGF) stimulation or PKC activation, we observed that RACK1 colocalizes with Src at the plasma membrane and functions as a substrate, binding partner, and inhibitor of Src (as measured in vitro) and as a growth inhibitor in NIH 3T3 cells (11-13). RACK1 inhibits cell growth, in part, by prolonging the G0/G1 phase of the cell cycle.

G1/S transition is controlled by two key families of proteins: cyclin-dependent kinases (CDKs) and cyclins. Cyclins bind to and activate CDKs (21, 46). Another critical event in cell cycle progression at G1/S is phosphorylation and inactivation of the retinoblastoma protein (pRb) and release of regulatory proteins such as E2F, which stimulate transcription of target genes that are required for cell proliferation. v-Src, the transforming homolog of c-Src, directly affects cell cycle proteins that regulate G1/S transition (26, 42, 51). For example, v-Src induces rapid transit through the G1 checkpoint and entry into S phase by simultaneously suppressing the CDK inhibitor p27 and inducing p21 and cyclins D1, E, and A (42, 49).

Growth factors trigger cascades of intracellular signals that lead to induction of the nuclear oncogene Myc (3, 23, 36). Cyclin/CDK complexes are then activated, and cells pass the G1 checkpoint and embark on DNA replication. c-Src activation is essential for PDGF-induced G1/S transition and DNA replication (4, 5, 44, 51, 53). Kinase-inactive Src induces a G1/S block that can be rescued by constitutive expression of Myc (4). Moreover, microinjection of antibodies that inhibit Src family kinases or treatment with a selective Src family kinase inhibitor, SU6656, inhibits PDGF- and Src-driven Myc induction and DNA synthesis (5, 44). Collectively, these results show that Src activity regulates the transcriptional activation of Myc and G1/S transition.

We hypothesized that RACK1 prolongs the G0/G1 phase of the cell cycle by inhibiting the activity of Src, and thereby Myc and other cell cycle regulators, at the G1 checkpoint. We found that RACK1 overexpression induces a partial G1 arrest by suppressing Src activity at the G1 checkpoint. RACK1 works through Src to inhibit Vav2, Rho GTPases, Stat3, and Myc. Consequently, cyclin D1 and CDK4 and CDK2 are suppressed, CDK inhibitor p27 and retinoblastoma protein are activated, E2F1 is sequestered, and G1/S progression is delayed. Conversely, short interference RNA (siRNA) inhibition of RACK1 expression activates Src-mediated signaling, induces Myc and cyclin D1, and accelerates G1/S transition. RACK1 suppresses Src- but not mitogen-activated protein kinase (MAPK)-dependent PDGF signaling.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture and transfections. NIH 3T3 and HEK 293 cells were maintained in Dulbecco's modified Eagle's medium (Mediatech, Inc., Herndon, Va.) supplemented with 10% fetal bovine serum (FBS; HyClone, Logan, Utah), unless otherwise stated. Where indicated, cells were serum starved for 24 h before treatment with PDGF-BB (Invitrogen, Carlsbad, Calif.) at 30 ng ml–1 for 30 min. Methods for transient-transfection assays were described previously (11-13).

Reagents. The plasmids pcDNA3-src, pcDNA3-HA-RACK1, pcDNA3-HA-RACK1Y228F, and pcDNA3-dl155 have been previously described (11-13). The HA-RACK1Y228F/Y246F mutant was created using pcDNA3-HA-RACK1Y228F (12, 13) as a template, the oligonucleotide primers 5' CTTCAGCCCTAACCGCTTCTGGCTGTGTGCTGC 3' and 5' GCAGCACACAGCCAGAAGCGGTTAGGGCTGAAG 3', and the QuickChange mutagenesis kit according to the protocol of the manufacturer (Stratagene, Cedar Creek, Tex.). The sequence of the mutant HA-RACK1Y228F/Y246F was confirmed by automated DNA sequencing (Protein and Nucleic Acid Facility, Stanford University, Stanford, Calif.). The mutant RACK1 gene was inserted into pcDNA3 (Invitrogen) to create pcDNA3-HA-RACK1Y228F/Y246F, as described previously (11, 12). The c-myc promoter reporter plasmid pMyc-Luc (24, 28) was kindly provided by Bert Vogelstein (Johns Hopkins University, Baltimore, Md.). Human RACK1 siRNA plasmids (38) were constructed according to the recommendations of the manufacturer (Imgenex, San Diego, Calif.). The target sequences of siRNA-A and siRNA-B are bp 146 to 166 and 195 to 215, respectively (human RACK1 sequence accession no. NM_006098). A BLAST search confirmed that the targeted sequences matched no other human cDNA sequence in GenBank. Briefly, for each siRNA plasmid, two complementary oligonucleotides were annealed and ligated into pSuppressor. The resulting short RNA transcript is predicted to have a 6-nucleotide loop. pCF1-Vav2-HA was a gift from Joan Brugge (Harvard University, Boston, Mass.). pcDNA3.1-Rac1-HA, pcDNA3.1-Rac1N17-HA, pcDNA3.1-Cdc42-HA, and pcDNA3.1-Cdc42N17-HA were purchased from Guthrie DNA Resource Center (Sayre, Pa.). pVR Stat3 and pIRES Stat3ß (Stat3ß) were kindly provided by Richard Jove (H. Lee Moffitt Cancer Center and Research Institute, Tampa, Fla.). Full-length human RACK1 cDNA was cloned into pEGFP-N1 (Clontech, Palo Alto, Calif.) as a HindIII/SalI fragment to generate a RACK1-green fluorescent protein (GFP) fusion. The fusion was subcloned into pcDNA3 to create pcDNA3-RACK1-GFP. pcDNA3-RACK1Y228F/Y246F-GFP was generated by ligating a HindIII/BglII fragment of HA-RACK1Y228F/Y246F and a BglII/NotI fragment of RACK1-GFP and subcloning the fusion into pcDNA3. pSP65 Myc was a gift from Roche Serge (Centre National de la Recherche Scientifique, Montpellier, France).

Reporter gene assays. NIH 3T3 and HEK 293 cells were transfected with the Lipofectamine Plus reagent (Invitrogen), with different expression plasmids together with 10 ng of pRL-Luc (Renilla luciferase) and 1 µg of the reporter plasmid pMyc-Luc. After incubation for 24 h, the cells were lysed with reporter lysis buffer (Promega, Madison, Wis.). Luciferase activity present in cellular lysates was assayed with D-luciferin and ATP as substrates (20), and light emission was quantified with the Monolight 2010 luminometer as specified by the manufacturer (Analytical Luminescence Laboratory, San Diego, Calif.).

Immunoblot analysis and antibodies. Lysates of total cellular proteins or immunoprecipitates were analyzed by protein immunoblotting after sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis with the specified rabbit or goat polyclonal or mouse monoclonal antibody (11-13). Immunocomplexes were detected by enhanced chemiluminescence (Amersham, Arlington Heights, Ill.) with the use of goat antiserum to rabbit or mouse immunoglobulin G coupled to horseradish peroxidase (Cappel, West Chester, Pa.). As primary antibodies, we used rabbit polyclonal antisera to CDK4 (C-22), Rac1 (C-14), cyclin D1 (M-20), E2F1 (KH95), and ERK2; goat polyclonal antisera to Vav2 (C-19; Santa Cruz Biotechnology, Santa Cruz, Calif.); and mouse monoclonal antibodies to c-Myc (9E10), CDK2 (D-12; Santa Cruz Biotechnology), RACK1, Stat3, Stat3 pY705, p21, Kip1/p27, phosphotyrosine (Py20; Transduction Laboratories, Lexington, Ky.), hemagglutinin (12CA5; Abgent, San Diego, Calif.), phospho-p44/42MAPK (Thr 202/Tyr 204; Cell Signaling Technology, Beverly, Mass.), retinoblastoma protein (pRb; G3-245; PharMingen, San Diego, Calif.), tubulin (Sigma, St. Louis, Mo.), and Src monoclonal antibody 327 (33).

In vitro protein kinase assays. Methods to evaluate the phosphorylating activity of Src by kinase assays in vitro have been described previously (10-13). For CDK4 and CDK2 kinase assays (55) cell pellets were extracted in 100 µl of freshly prepared lysis buffer (50 mM Tris-HCl [pH 8], 150 mM NaCl, 0.1% Triton X-100, 1 mM dithiothreitol [DTT], 10 µg of aprotinin ml–1, 10 µg of leupeptin ml–1, 5 mM NaF, 10 mM Na3VO4). Equal amounts of cell lysate (500 µg in 1,000 µl of lysis buffer) were incubated with 4 µg of anti-CDK2 or anti-CDK4 for 2 h on ice and then with 50 µl of washed protein A-agarose (Santa Cruz Biotechnology) for 2 h at 4°C with rocking. The collected immunoprecipitate was washed two times with lysis buffer and then four times with cold kinase reaction buffer (20 mM HEPES [pH 8], 10 mM MgCl2, 0.1 mM DTT, 10 µg of aprotinin ml–1, 10 µg of leupeptin ml–1, 5 mM NaF, 10 mM Na3VO4). The washed immunoprecipitate was resuspended in 25 µl of kinase reaction buffer-20 µM ATP-20 µCi of [{gamma}-32P]ATP (4,500 Ci mmol–1; MP Biomedicals, Irvine, Calif.)-2.5 µg of pRb peptide (Santa Cruz Biotechnology) for CDK4 assays or 4 µg of histone H1 (Invitrogen) for CDK2 assays. The kinase reaction mixture was incubated for 10 min at 30°C, and the reaction was stopped by adding 5 µl of 2x SDS sample buffer and heating the suspension for 5 min at 95°C. Proteins were separated on gradient (4 to 20%) SDS-polyacrylamide gels and detected by autoradiography. ERK2 in vitro kinase assays were performed as described previously (15, 17, 19) with myelin basic protein (MBP) as an exogenous substrate. Briefly, extracellular signal-regulated kinase (ERK) immunoprecipitates were washed and resuspended in 25 µl of reaction buffer (25 mM HEPES [pH 7.4], 10 mM MgCl2, 0.1 mM Na3VO4, 1 mM DTT) containing 3 µg of MBP (Sigma) and 10 µCi of [{gamma}-32P]ATP. The kinase reaction mixture was incubated for 30 min at 30°C.

Fluorescence microscopy. NIH 3T3 cells were transiently transfected for 24 h and then serum starved for 24 h, treated with 10% fetal bovine serum (FBS) for 3 h, and replated in 10% FBS onto Lab-Tek eight-well Permanox chamber slides (Nalgene Nunc International, Rochester, N.Y.) coated with 20 ng of fibronectin (Sigma) µl–1. Four hours later, cells were fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) for 20 min, quenched twice in 0.1 M glycine for 10 min, and permeabilized in 0.4% saponin-1% bovine serum albumin (BSA)-5% goat serum for 15 min (27). Cells were then incubated with anti-cyclin D1 (2.5 µg ml–1; BD Pharmingen) for 45 min, washed in 1% BSA in PBS, and incubated with 4 µg of Alexa Fluor 594 goat anti-mouse immunoglobulin G (Molecular Probes, Eugene, Oreg.) ml–1 for 30 min in the dark. Cells were washed again in 1% BSA in PBS, incubated with 0.2 µg of 4',6'-diamidino-2-phenylindole (DAPI; Pierce, Rockford, Ill.) ml–1 for 1 min, and washed quickly in distilled water. Slides were mounted with Vectashield mounting medium (Vector Laboratories, Burlingame, Calif.). Images were obtained by fluorescence microscopy at an x60 magnification under oil, captured using a SPOT RT camera, and analyzed with Openlab Imaging System software.

Flow cytometry. NIH 3T3 or HEK 293 cells (5 x 105/100-mm-diameter dish) were transfected, serum starved for 48 or 24 h (respectively), and then treated with 10% FBS for 6 h. Cells were then fixed in 70% ethanol for 30 min, collected by low-speed centrifugation, resuspended in PBS containing 10 µg of RNase A (Sigma) ml–1 and 20 µg of propidium iodide (Sigma) ml–1, and incubated in the dark at 37°C for 30 min (37). Cells (5,000 to 10,000) were analyzed for DNA content by FACScan cell sorting (Becton Dickinson, San Jose, Calif.). Histograms were prepared using ModFitLT software. RACK1 immunoblot analyses performed on lysates from plates of cells parallel to those used for flow cytometric analyses demonstrated consistent levels of HA-RACK1 expression for all transfections.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
RACK1 inhibits Src-mediated Myc activation. To determine whether RACK1 works through Src and Myc to prolong the G0/G1 phase of the cell cycle, we first overexpressed RACK1 in NIH 3T3 cells and assessed Src and Myc activity (Fig. 1). In agreement with our previous observations (11), RACK1 overexpression inhibited Src in vitro kinase activity, as measured by phosphorylation of the exogenous substrate enolase (Fig. 1A). RACK1 overexpression also inhibited Src-induced Myc expression, indicating that Myc participates in a Src pathway that is influenced by RACK1. To determine whether RACK1 exerts its effect on Src and Myc via direct interaction with Src, we utilized a RACK1 mutant (RACK1 Y228F/Y246F) that lacks the Src phosphorylation and binding sites and consequently is no longer a substrate or binding partner for Src (12, 13). Unlike that of wild-type RACK1, expression of the mutant had no effect on Src activity or Src-induced Myc expression. Thus, RACK1 exerts its inhibitory influence through direct interaction with Src. Overexpression of wild-type RACK1 also inhibited Myc expression in cells that had not been transfected with Src, presumably by inhibiting endogenous Src. To further investigate the mechanism whereby RACK1 regulates Src-mediated Myc expression, we transfected cells with a reporter plasmid carrying the luciferase gene under the control of the human c-myc promoter (pMyc-Luc [4, 28]) and assessed RACK1's influence on Src-induced myc promoter activity (Fig. 1B). Src strongly induced myc promoter activity in a concentration-dependent manner. Wild-type but not mutant RACK1 inhibited Src-induced myc promoter activity in a similar manner. Interestingly, a Src mutant that contains a 3-amino-acid deletion in the phosphotyrosine-binding pocket of its SH2 domain (dl155 [35]) and has reduced binding to RACK1 (12) was unable to induce myc promoter activity. Therefore, an intact SH2 domain is required for Src induction of myc. Overexpression of wild-type RACK1 had a small inhibitory effect on myc promoter activity in cells that had not been transfected with Src, presumably by inhibiting endogenous Src. In a complementary approach to the RACK1 overexpression studies, we introduced two different RACK1 siRNAs (generated from different regions of the RACK1 gene) into HEK 293 cells and examined their effect on RACK1 and Myc expression and on Src activity (Fig. 1C). Introduction of either siRNA significantly inhibited RACK1 expression and enhanced Src activity and Myc expression. Together, our results indicate that RACK1 inhibits myc promoter activity and Myc protein expression by suppressing Src activity.



View larger version (24K):
[in this window]
[in a new window]
 
FIG. 1. RACK1 inhibits Src-mediated Myc activation. (A) Effect of RACK1 overexpression on Src in vitro kinase activity and Myc expression. NIH 3T3 cells were transfected with vector (lane 1), Src (lane 2), Src and wild-type HA-RACK1 (lane 3), Src and a mutant RACK1 (Y228F/Y246F HA-RACK1) containing a phenylalanine substitution for tyrosine at positions 228 and 246 (lane 4), mutant HA-RACK1 (lane 5), or wild-type HA-RACK1 (lane 6). Top panel, proteins were immunoprecipitated with excess anti-Src (MAb 327) from lysate containing 500 µg of cellular protein and incubated with [{gamma}-32P]ATP, MnCl2, and enolase for 10 min at 30°C in an in vitro protein kinase assay. Bottom three panels, proteins from lysate containing 20 µg of total cellular protein were subjected to immunoblot analysis with anti-Myc, Src, or RACK1. Data are representative of three independent experiments. (B) Stimulation of myc promoter activity in cells cotransfected with pMyc-Luc and expression vectors containing Src (0.5 or 1 µg), RACK1 (0.5, 1, or 1.5 µg), mutant RACK1 (0.5, 1, or 1.5 µg), and dl155 Src (1 µg), as indicated. +, the highest concentration of Src or RACK1 was transfected. Results represent luciferase activity in each sample normalized to efficiency of transfection. Luciferase activity was normalized to a simultaneously transfected internal control plasmid (pRL-TK, Renilla luciferase). Data represent mean values ± standard errors from triplicate samples and are representative of three independent experiments. (C) Effect of introducing RACK1 siRNAs on RACK1 and Myc expression and Src in vitro kinase activity. HEK 293 cells were transfected with 5 µg of vector (lane 1), RACK1 siRNA-A (lane 2), or RACK1 siRNA-B (lane 3), and lysate proteins were subjected to immunoblot analysis with anti-RACK1 (top panel) or anti-Myc (bottom panel) or were immunoprecipitated with anti-Src and assayed for in vitro protein kinase activity or subjected to immunoblot analysis with anti-Src (middle panels) as described for panel A. Data are representative of three independent experiments.

 
RACK1 works through Src to suppress Vav2 and Myc activation. On the basis of these observations, we next examined RACK1's influence on Src-mediated signaling pathways that result in Myc activation. Previously, we showed that PDGF treatment enhances Src phosphorylation of and binding to RACK1 (12). PDGF also activates Src and stimulates the Vav2 guanine nucleotide exchange factor through Src-mediated tyrosine phosphorylation, thereby activating the Rac1-dependent pathway that controls transcriptional activation of myc (9, 15, 19). Therefore, we assessed RACK1's influence on this Src-mediated signaling pathway. We found that Src induced the tyrosine phosphorylation of Vav2, and that wild-type but not mutant RACK1 inhibited the Src effect (Fig. 2A). Similarly, Src enhanced Vav2-induced myc promoter activity (Fig. 2B) and Myc expression (Fig. 2C), and wild-type but not mutant RACK1 abolished the Src effect. Thus, RACK1 appears to work through Src to suppress Vav2 and thereby Myc activation.



View larger version (47K):
[in this window]
[in a new window]
 
FIG. 2. RACK1 works through Src to suppress Vav2 and Myc activation. (A) Effect of RACK1 overexpression on Src-mediated Vav2 tyrosine phosphorylation. Cells were transfected as indicated. Top panel, proteins were immunoprecipitated with antiphosphotyrosine from lysates containing 500 µg of cellular protein and subjected to immunoblot analysis with anti-Vav2. Bottom three panels, proteins from lysate containing 20 µg of total cellular protein were subjected to immunoblot analysis with anti-Vav2, Src, or RACK1. Data are representative of three independent experiments. (B) Stimulation of myc promoter activity in cells cotransfected with pMyc-Luc and expression vectors containing Vav2 (1 µg), Src (0.5 µg), RACK1 (1 µg), and mutant RACK1 (1 µg), as indicated. Luciferase activity was measured as described in the legend to Fig. 1. Data represent mean values ± standard errors from triplicate samples and are representative of three independent experiments. (C) Effect of Src, RACK1, and Vav2 overexpression on Myc protein expression. Cells were transfected as indicated, and lysate proteins containing 20 µg of total cellular protein were subjected to immunoblot analysis with anti-Myc, Vav2, Src, or RACK1. Data are representative of three independent experiments.

 
RACK1 works through Src to suppress Rho GTPases and Myc activation. Vav family proteins function as guanine nucleotide exchange factors for the Rho family of small GTPases (1, 9, 19, 54). Rac1 and Cdc42 are Rho family members that are activated by Vav2 and participate in the induction of Myc by PDGF and Src. Moreover, Rac1 function is required for Src transformation (45). Therefore, we examined RACK1's influence on these downstream effectors of Src. We observed that Src enhanced Rac1-induced myc promoter activity (Fig. 3A) and Myc protein expression (Fig. 3B). Wild-type but not mutant RACK1 abolished the Src effect. Expression of a dominant-negative Rac1 that cannot bind GTP (Rac1N17 [17]) inhibited Src-mediated myc promoter activity (Fig. 3A) and Myc expression (Fig. 3C), confirming that Rac1 plays a key role in the regulation of Myc expression by Src (15). RACK1 inhibited the small amount of Src-mediated myc promoter activity and Myc protein expression that occurred independently of Rac1. Wild-type RACK1 had an inhibitory influence on the Cdc42 activation pathway similar to, although smaller than, what it had on the Rac1 pathway (data not shown). Thus, RACK1 works through Src to suppress Vav2, the Rho family of GTPases, and Myc activation.



View larger version (41K):
[in this window]
[in a new window]
 
FIG. 3. RACK1 works through Src to suppress Rho GTPases and Myc activation. Shown are the effects of Src and RACK1 overexpression on Rac1-stimulated myc promoter activity (A) and Myc protein expression (B and C). Dominant-negative Rac1N17 contains a threonine-to-asparagine change and cannot bind GTP. (A) Stimulation of myc promoter activity in cells cotransfected with pMyc-Luc and expression vectors containing Rac1 (1.5 µg), Src (0.5 µg), RACK1 (1 µg), mutant RACK1 (1 µg), and Rac1N17 (1.5 µg) as indicated. Luciferase activity was measured as described. Data represent mean values ± standard errors from triplicate plates and are representative of three independent experiments. (B and C) Cells were transfected as indicated, and lysate proteins containing 20 µg of total cellular protein were subjected to immunoblot analysis with anti-Myc, Rac1, Rac1N17, Src, or RACK1. Data are representative of three independent experiments.

 
RACK1 works through Src to suppress Stat3 and Myc activation. PDGF stimulates Stat3 through Src-mediated tyrosine phosphorylation to dimerize, translocate to the nucleus, and bind promoter elements of responsive genes involved in cell proliferation including myc and cyclin D1 (7, 49). Moreover, Stat3-mediated Myc expression is required for Src transformation (6, 52). Constitutively active Rac1 also induces the tyrosine phosphorylation, dimerization, and translocation of Stat3 (48). These observations prompted us to determine whether Stat3 is a downstream effector of Rac1 in a common Myc activation pathway and, if so, whether RACK1, via its interaction with Src, inhibits the pathway. We found that Rac1 and Stat3 independently and, to a greater extent, together induced the transcriptional activity of the myc promoter (Fig. 4A) and Myc expression (Fig. 4B). Moreover, Stat3ß, a naturally occurring isoform of Stat3 that lacks the C-terminal transcriptional activation domain and, consequently, blocks Stat3 signaling in a dominant-negative fashion (6), abolished the Rac1-mediated Myc induction. Therefore, Stat3 appears to be a downstream effector of Rac1 in a common Myc activation pathway. We found that Src induced Stat3 tyrosine phosphorylation and Myc expression (Fig. 4C). Wild-type but not mutant RACK1 eliminated the Src effect. Thus, RACK1 works through Src to suppress Vav2, Rho GTPases, Stat3, and Myc activation.



View larger version (43K):
[in this window]
[in a new window]
 
FIG. 4. RACK1 works through Src to suppress Stat3 and Myc activation. Shown are the effects of Stat3 on Rac1-stimulated myc promoter activity (A) and Myc protein expression (B). Dominant-negative Stat3ß is a naturally occurring splice variant with a deletion in the C terminus that harbors the transcriptional activation domain and the Ser 727 residue, phosphorylation of which is required for efficient transcriptional activation. As a result of this deletion, dimers formed with Stat3ß lack transcriptional activity. (A) Stimulation of myc promoter activity in cells cotransfected with pMyc-Luc and expression vectors containing Rac1 (1 µg), Stat3 (1 µg), and Stat3ß (1 µg), as indicated. Luciferase activity was measured as described in Materials and Methods. Data represent mean values ± standard errors from triplicate plates and are representative of three independent experiments. (B) Cells were transfected as indicated, and lysate proteins containing 20 µg of total cellular protein were subjected to immunoblot analysis with anti-Myc, Rac1, or Stat3. (C) Effect of Src and RACK1 overexpression on Stat3 tyrosine phosphorylation. Top panel, lysate proteins were immunoprecipitated with anti-Stat3 and immunoblotted with an antibody that recognizes phosphorylated Tyr 705, the Src-mediated phosphorylation site on Stat3. Bottom panels, proteins from lysate containing 20 µg of total cellular protein were subjected to immunoblot analysis with anti-Stat3, Myc, Src, or RACK1. (D) Effect of Src and RACK1 overexpression on ERK signaling. Lysate proteins were subjected to immunoblot analysis with an antibody that recognizes phosphorylated ERK1 and ERK2 (Thr 202/Tyr 204), ERK1 and ERK2, or RACK1 as indicated. Lysate proteins were immunoprecipitated with anti-ERK and assayed for in vitro protein kinase activity with MBP as a substrate. Data are representative of two or three independent experiments. (E) Effect of RACK1 inhibition on downstream effectors of Src. HEK 293 cells were transfected with RACK1 siRNAs as described in the legend to Fig. 1. Tyrosine phosphorylation of Vav2 and Stat3 was assayed as described in the legends to Fig. 2A and panel C, respectively. Lysate proteins were subjected to immunoblot analysis with anti-Vav2, Stat3, cyclin D1, phospho-ERK, or ERK as indicated. ERK in vitro kinase activity was assayed as described for panel D.

 
RACK1 does not influence Src-mediated activation of ERKs. The Ras-MAPK pathway is important for the proliferative response to many growth factors (43). The ERKs are members of a subfamily of MAPKs that are involved in control of cell division. This prompted us to assess the influence of Src and RACK1 on ERK signaling (Fig. 4D). Src overexpression resulted in increased phosphorylation of ERK1 and, to a lesser extent, ERK2 and increased ERK activity as measured by ERK phosphorylation of MBP. RACK1 overexpression had little effect on Src-mediated phosphorylation of ERKs or on ERK activity. These results suggested that the Src-mediated Ras-MAPK activation pathway is not inhibited by RACK1. Induction of Myc by the PDGF receptor-Src pathway is known, for the most part, to be independent of Ras-MAPK activation (15).

Downregulation of RACK1 activates Src-mediated signaling pathways. In a complementary approach to the RACK1 overexpression studies, we examined the effect of RACK1 inhibition on downstream effectors of Src. As shown in Fig. 1C, downregulation of RACK1 by siRNA increased Src activity and Myc expression. Downregulation of RACK1 also increased tyrosine phosphorylation of Vav2 and Stat3 and expression of cyclin D1 but had no effect on phosphorylation of ERK1, ERK2, or MBP (Fig. 4E). Together, the results from the RACK1 overexpression and downregulation studies indicate that RACK1 negatively regulates a Src-dependent but MAPK-independent signaling pathway that culminates in activation of Myc and cyclin D1.

RACK1 inhibits cell cycle regulators in G1 by suppressing Src activity. To further explore the mechanism by which RACK1 overexpression prolongs the G0/G1 phase of the cell cycle, we next examined RACK1's effect on key regulators of cell cycle progression at the G1/S boundary. Cells were synchronized in G0 by serum withdrawal for 48 h and released into G1 by the addition of serum for 6 h. Src overexpression resulted in increased in vitro kinase activity of Src, CDK4, and CDK2; increased cyclin D1 and p21 expression; hyperphosphorylation of retinoblastoma protein (pRb); and release of the transcription factor E2F in G1 (Fig. 5A). Overexpression of wild-type but not mutant RACK1 abolished the Src-induced effects and induced expression of the CDK inhibitor p27. As a control, we showed that overexpression of Src and/or RACK1 had no effect on the expression of tubulin. In a complementary approach to the biochemical studies, we assessed RACK1's effect on Src-mediated cyclin D1 expression in G1 phase by coexpressing Src and GFP fused to wild-type or mutant RACK1 and assessing nuclear cyclin D1 staining by immunofluorescence microscopy. Src overexpression increased nuclear expression of cyclin D1 in G1 (Fig. 5B). Overexpression of wild-type but not mutant RACK1-GFP inhibited the Src-mediated cyclin D1 expression. This observation is internally consistent with those of our biochemical studies (Fig. 5A); both show that RACK1, via its interaction with Src, inhibits cyclin D1 expression in G1. Together, our results indicate that RACK1 inhibits key cell cycle regulators in G1 by suppressing Src kinase activity.




View larger version (76K):
[in this window]
[in a new window]
 
FIG. 5. RACK1 inhibits cell cycle regulators in G1 by suppressing Src activity. NIH 3T3 cells were transiently transfected with vector, Src, and wild-type or mutant HA-RACK1 or GFP-RACK1, as indicated. (A) Effect of RACK1 overexpression on cell cycle regulators in G1. Transfectants were synchronized and held in G0 by serum starvation for 48 h and then released into G1 with the addition of 10% FBS for 6 h. First, third, and fourth panels from the top, proteins were precipitated with antibody to Src, CDK4, or CDK2, respectively, from lysates containing 500 µg of cellular protein and incubated with [{gamma}-32P]ATP together with MnCl2 and enolase (Src immunoprecipitates), MgCl2 and Rb peptide (CDK4 immunoprecipitates), or MgCl2 and histone H1 (CDK2 immunoprecipitates) for 10 min at 30°C and analyzed for in vitro protein kinase activity. Other panels, proteins from lysates containing 20 µg of total cellular protein were subjected to immunoblot analysis with antibodies to cyclin D1, p27, p21, pRb, E2F1, or tubulin. (B) Effect of RACK1 overexpression on nuclear cyclin D1 expression in G1. Transfectants were serum starved for 24 h, incubated with 10% FBS for 3 h, replated onto fibronectin-coated chamber slides in 10% FBS, and fixed 4 h later. Cells were analyzed for cyclin D1 expression by immunofluorescence with an Alexa Fluor 594-conjugated secondary antibody (red), for GFP by fluorescence with a GFP filter (green), and for nuclei with DAPI (blue).

 
RACK1 regulates G1/S progression via its interaction with Src. Next we examined RACK1's influence on cell cycle progression at the G1/S boundary by synchronizing cells in G0, releasing them into G1, and analyzing cellular DNA content by flow cytometry (Fig. 6A). After treatment of serum-starved cells for 6 h with serum, most of the vector-transfected cells were in G1 (79%) and few had entered S phase (12%). As expected, many more of the Src-overexpressing cells had entered S phase (33%) and mitosis, and fewer remained in G1 (51%). In contrast, most cells coexpressing both RACK1 and Src (85%), or expressing RACK1 alone (88%), were arrested in G1. Cells coexpressing Src and mutant RACK1 progressed through the cell cycle at a rate similar to that of those expressing Src alone. Cells expressing mutant RACK1 alone progressed at a rate similar to that of vector-transfected cells. Therefore, RACK1 overexpression delays G1/S progression via its interaction with Src. Cells coexpressing Src, RACK1, and Myc progressed to S phase at the highest rate, with 42% in S phase and only 17% remaining in G1 after treatment of G0 cells with serum for 6 h (data not shown). Therefore, Myc overexpression rescued the RACK1-induced G1 arrest. In a complementary approach to the RACK1 overexpression studies, we examined G1/S progression in HEK 293 cells where RACK1 expression was inhibited by transfection with RACK1 siRNAs (Fig. 6B). Consistent with our results in NIH 3T3 cells, most of the vector-transfected cells were in G1 (79%) and few had entered S phase (14%) following treatment of G0 cells for 6 h with serum. In contrast, many more of the cells expressing RACK1 siRNA-A or siRNA-B had entered S phase (36 and 28%, respectively), and fewer remained in G1 (53 and 58%, respectively). Interestingly, the RACK1-inhibited cells progressed through the cycle at a rate similar to that of those overexpressing Src alone (Fig. 6A). Thus, inhibition of RACK1 expression accelerates the G1/S transition. Collectively, our results show that RACK1 negatively regulates G1/S progression by suppressing Src activity at the G1 checkpoint.



View larger version (36K):
[in this window]
[in a new window]
 
FIG. 6. RACK1 regulates G1/S progression via its interaction with Src. (A) Effect of RACK1 overexpression on G1/S transition. NIH 3T3 cells were transiently transfected with vector, Src, RACK1, and RACK1 mutant (as indicated) and synchronized and held in G0 by serum starvation for 48 h. Cells were released into G1 with the addition of 10% FBS, harvested 6 h later, and analyzed for cellular DNA content by flow cytometry. (B) Effect of inhibiting RACK1 expression on G1/S transition. HEK 293 cells were transfected with vector or RACK1 siRNA-A or siRNA-B, synchronized in G0 by serum withdrawal for 24 h, released into G1, and analyzed for cellular DNA content as described for panel A.

 
RACK1 inhibits Src- but not MAPK-dependent PDGF signaling. Previously we showed that stimulation of NIH 3T3 cells with either serum or PDGF produced the same effect on the Src-RACK interaction: increased tyrosine phosphorylation of RACK1 by Src and increased binding of RACK1 to Src (12). Moreover, the PDGF effect was concentration and time dependent. These observations suggested that RACK1 modulates Src activity downstream of the PDGF receptor and prompted us to examine RACK1's influence on PDGF signaling (Fig. 7). We observed that overexpression of wild-type but not mutant RACK1 partially inhibited PDGF-induced tyrosine phosphorylation of Vav2 and Stat3 and expression of Myc and cyclin D1 in quiescent NIH 3T3 cells (Fig. 7A). However, overexpression of either wild-type or mutant RACK1 had no effect on PDGF-stimulated phosphorylation of ERK1 and ERK2 or ERK phosphorylation of MBP (Fig. 7B). Together, the results suggest that RACK1 regulates a Src-dependent but MAPK-independent PDGF signaling pathway that culminates in activation of Myc and cyclin D1.



View larger version (45K):
[in this window]
[in a new window]
 
FIG. 7. RACK1 inhibits Src- but not MAPK-dependent PDGF signaling. NIH 3T3 cells were transiently transfected with vector, RACK1, or mutant RACK1 as indicated; serum starved to quiescence; and treated with PDGF (30 ng ml–1) for 30 min prior to lysis, as indicated (+). (A) Effect of RACK1 overexpression on Src-mediated PDGF signaling. Tyrosine phosphorylation of Vav2 and Stat3 was assayed as described in the text. Lysate proteins were subjected to immunoblot analysis with anti-Vav2, Stat3, Myc, cyclin D1, or RACK1 as indicated. (B) Effect of RACK1 overexpression on MAPK-mediated PDGF signaling. Lysate proteins were subjected to immunoblot analysis with antibody that recognizes phospho-ERK (top panel) or ERK (middle panel). ERK in vitro kinase activity was assayed as described in the text (bottom panel).

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Overall, our results demonstrate that RACK1 prolongs the G0/G1 phase of the cell cycle, in part by suppressing Src activity and thereby a major, mitogenic, Src-dependent signaling pathway that culminates in activation of Myc and other key cell cycle regulators in late G1. Consequently, cell cycle progression is restrained at a critical time in the cycle.

Our study identifies an endogenous inhibitor of Src activity that works at the G1 checkpoint. Our results are consistent with those of Courtneidge and others, who, using three complementary approaches (microinjection of antibodies that inhibit Src family kinases, expression of kinase-inactive Src, or treatment with a selective Src family kinase inhibitor, SU6656), demonstrated that Src kinases are essential for PDGF-induced mitogenesis in NIH 3T3 cells (4, 5, 44, 51, 53). At first glance, these findings appear contradictory to those showing that an immortalized mouse embryo cell line that lacks Src, Yes, and Fyn (SYF cells) responds mitogenically to PDGF (31). However, the SYF cells were derived by immortalizing primary mouse embryo fibroblasts with simian virus 40 large T antigen, and expression of simian virus 40 large T antigen in fibroblasts has been shown to eliminate the need for Src family kinase (and Ras) signaling pathways (8). Consistent with this, SU6656 is unable to inhibit PDGF-stimulated DNA synthesis in SYF cells (5). Thus, one explanation for the apparent contradiction may be the different types of cells studied. Overall, the consistent finding in NIH 3T3 cells, whether with a small molecule, an antibody, or an endogenous inhibitor of Src, is that activation of Src family kinases is essential for PDGF-induced mitogenesis.

In addition to defining RACK1's influence on Src activity at the G1 checkpoint, our results reveal a mechanism whereby RACK1 works in Src signaling pathways: by inhibiting Src-dependent activation of Vav2, Rho GTPases, Stat3, and Myc (Fig. 1 to 4). Interestingly, we find that Rac1 and Stat3, each of which is known to be required for Src signaling and transformation, work together in a common Myc activation pathway, where Stat3 is required for Rac1 to activate Myc (Fig. 4A and B). The inability of RACK1 to inhibit PDGF- or Src-induced MAPK activation (Fig. 7B and 4D and E) suggests selectivity of RACK1 for some PDGF-Src activation pathways and not others. These results are consistent with published reports showing that in NIH 3T3 cells (i) treatment with the SU6656 Src family kinase inhibitor does not inhibit PDGF-stimulated ERK phosphorylation (5), (ii) PDGF is known to activate Myc by Src-dependent but Ras-MAPK-independent mechanisms (15), and (iii) RACK1 overexpression does not affect insulin-like growth factor I (IGF-I)-induced ERK phosphorylation (29). Collectively, the studies suggest that there are (i) growth factor-MAPK activation pathways that are independent of Src and RACK1 and (ii) Src-MAPK activation pathways that are independent of RACK1 and that (iii) RACK1's inhibitory influence on growth factor- and Src-induced mitogenesis does not involve MAPK pathways.

We propose a model for RACK1 function in Src-mediated mitogenesis (Fig. 8). Normally, engagement of PDGF with its cell surface tyrosine kinase receptor induces dimerization and autophosphorylation of the receptor; Src binding and activation; tyrosine phosphorylation of Vav2; activation of Rho GTPases; tyrosine phosphorylation of Stat3; dimerization and translocation of Stat3 to the nucleus; activation of Myc, cyclin D1, and other cell cycle regulators; G1/S progression; and cell proliferation (Fig. 8A). We submit that RACK1 works at the G1/S boundary by partially inhibiting Src activity and thereby the tyrosine phosphorylation of Vav2; activation of Rho GTPases; tyrosine phosphorylation of Stat3; and activation of Myc, cyclin D1, and other cell cycle regulators. Consequently, G1/S transition is delayed (Fig. 8B).



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 8. Model for RACK1 function in Src-mediated mitogenic signaling and cell cycle progression. (A) Engagement of PDGF with its cell surface tyrosine kinase receptor induces dimerization and autophosphorylation of the receptor; Src binding and activation; tyrosine phosphorylation of Vav2; activation of Rho GTPases; tyrosine phosphorylation of Stat3; dimerization and translocation of Stat3 to the nucleus; activation of Myc, cyclin D1, and other cell cycle regulators; cell cycle progression through the G1/S checkpoint; and cell proliferation. (B) RACK1 works by inhibiting Src activity and thereby the tyrosine phosphorylation of Vav2; activation of Rho GTPases; tyrosine phosphorylation of Stat3; and activation of Myc, cyclin D1, and other cell cycle regulators. Consequently, G1/S transition is delayed.

 
The striking effect that downregulating RACK1 has on G1/S progression (Fig. 6B) could be due to abolishing the interaction of RACK1 with any of its binding partners. However, the equally striking effect that downregulation of RACK1 has on activation of Src and many of Src's known downstream effectors (Vav2, Rho GTPases, Stat3, Myc, and cyclin D1) (Fig. 1C and 4E) indicates that Src is one of the binding partners that is no longer constrained by RACK1's inhibitory influence.

A recent study showed that RACK1 overexpression inhibits IGF-I-induced CDK2 activity; Rb phosphorylation; and cell cycle progression in G0, G1, or at the G1/S boundary but that it does not affect expression of cyclin D1 or the associated CDK4 (29). In contrast, in the Src pathway, we show that RACK1 inhibits cyclin D1 expression and CDK4 activity (both of which are critical for Src-mediated G1/S progression), and it does so specifically at the G1/S checkpoint (Fig. 6). Thus, RACK1 appears to regulate distinct targets at distinct times in G0/G1 in PDGF-Src and IGF-I signaling pathways.

One of the earliest G1 events to occur in response to growth factor stimulation is synthesis and assembly of D-type cyclins with their catalytic partners, CDK4 and CDK6 (14, 21, 47, 50). The catalytic activity of the cyclin D-CDK complex is first manifest in mid-G1 and increases to a maximum near G1/S transition. Activation of a temperature-sensitive v-Src in quiescent cells sequentially induces cyclins D1, E, and A and activates cyclin D1-CDK4-CDK6 and CDK E-CDK A-CDK2 at the G1/S boundary (26, 42, 49). Our findings that RACK1 partially inhibits Src-mediated cyclin D1 expression (Fig. 5A and B), cyclin E expression (data not shown), and CDK4 and CDK2 activity (Fig. 5A) identify a mechanism of cell cycle control in late G1 that works via an endogenous inhibitor of the Src kinase. An inhibitor governing this critical restriction point in the cycle would wield tight control over cell proliferation.

CDK activity is constrained by at least two families of inhibitors: the INK4 proteins and the Cip-Kip proteins p21 and p27 (reviewed in references 46, 47, and 50). Consistent with this known function for Cip-Kip proteins and with previous observations in v-Src-transformed NIH and BALB/c 3T3 cells (42), we found that p27 was inhibited in Src-overexpressing cells and induced in RACK1-overexpressing cells (Fig. 5A). In contrast, we found that p21 was induced in Src-overexpressing cells and inhibited in RACK1-overexpressing cells. While this latter finding is consistent with published observations for v-Src-transformed cells (49), it is puzzling in light of the traditional view of p21 as a CDK inhibitor. However, recent evidence indicates that p21 and p27 can also function as activators of CDKs because they are required for the expression of cyclin D, for assembly of cyclin D-CDK complexes, and for the transport of cyclin D proteins to the nucleus (14, 47). Moreover, p21 and p27 have also been implicated in the regulation of apoptosis and in transcriptional activation (reviewed in reference 16). Thus, new roles are emerging for Cip-Kip proteins, and their complex functions in cells need to be further delineated. Interestingly, in 35 to 40% of breast and colon cancer cells, p27 relocates from the nucleus to the cytoplasm, where it is presumably degraded, thus activating CDKs (50). Moreover, heterozygous p27+/– mice get tumors, even with only one mutant allele (25). In contrast, p21 has not been shown to relocate to the cytoplasm or to undergo mutation in cancer cells. This suggests that p21 and p27 may not always serve identical functions in cells and may explain why inhibiting Src activity elicits opposing effects on p21 and p27 expression. Another possibility is that established cell lines like NIH 3T3 have alterations in the p53 pathway, which might affect the regulation of p21 (30).

Our data on Vav2- and Src-induced myc promoter activity (Fig. 2B) and Myc protein expression (Fig. 2C) could be explained by Src working through Vav2 or in parallel with Vav2. However, Src overexpression or PDGF stimulation strongly induced the tyrosine phosphorylation of Vav2 in cells overexpressing mutant but not wild-type RACK1 (Fig. 2A and 7A), and Chiariello et al. demonstrated that PDGF activates Src and stimulates Vav2 through Src-mediated tyrosine phosphorylation, thereby initiating the activation of a Rac-dependent pathway that controls transcriptional activation of myc (15). Collectively, these results suggest that Vav2 participates in a PDGF-Src-Myc activation pathway that is regulated by RACK1. They do not exclude the possibility that there are other signaling pathways involved in the regulation of Myc by Src that are independent of Vav2.

Together, the studies indicate that RACK1 negatively regulates growth factor-activated pathways that control cell cycle progression at the G1/S checkpoint. The significance of these findings is that an endogenous inhibitor of mitogenic signals working at this pivotal cell cycle restriction point would have powerful and pervasive influence on control of cell growth. Endogenous inhibitors of oncogenic kinases are tumor suppressors; they represent exciting new targets for cancer therapy.


    ACKNOWLEDGMENTS
 
We thank Betty Chang for generating pcDNA3-HA-RACK1, pcDNA3-HA-RACK1Y228F, and pcDNA3-src. We thank Joan Brugge for HA-Vav2, Richard Jove for pVR Stat3 and pIRES Stat3ß, Bert Vogelstein for pMyc-Luc, and Roche Serge for pSP65 Myc. We thank Tony Hunter and Sara Courtneidge for helpful discussions. We are grateful to Blanca Pineda for assistance with the manuscript.

This work was supported by a grant from the National Institutes of Health to C.A.C. (DK43743).


    FOOTNOTES
 
* Corresponding author. Mailing address: M211 Alway Building, 300 Pasteur Dr., Stanford University School of Medicine, Stanford, CA 94305-5187. Phone: (650) 725-8464. Fax: (650) 723-5488. E-mail: chris.cartwright{at}stanford.edu. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Abe, K., K. L. Rossman, B. Liu, K. D. Ritola, D. Chiang, S. L. Campbell, K. Burridge, and C. J. Der. 2000. Vav2 is an activator of Cdc42, Rac1, and RhoA. J. Biol. Chem. 275:10141-10149.[Abstract/Free Full Text]

2. Abram, C. L., and S. A. Courtneidge. 2000. Src family tyrosine kinases and growth factor signaling. Exp. Cell Res. 254:1-13.[CrossRef][Medline]

3. Amati, B., K. Alevizopoulos, and J. Vlach. 1998. Myc and the cell cycle. Front. Biosci. 3:D250-D268.

4. Barone, M. V., and S. A. Courtneidge. 1995. Myc but not Fos rescue of PDGF signalling block caused by kinase-inactive Src. Nature 378:509-512.[CrossRef][Medline]

5. Blake, R. A., M. A. Broome, X. Liu, J. Wu, M. Gishizky, L. Sun, and S. A. Courtneidge. 2000. SU6656, a selective Src family kinase inhibitor, used to probe growth factor signaling. Mol. Cell. Biol. 20:9018-9027.[Abstract/Free Full Text]

6. Bowman, T., M. A. Broome, D. Sinibaldi, W. Wharton, W. J. Pledger, J. M. Sedivy, R. Irby, T. Yeatman, S. A. Courtneidge, and R. Jove. 2001. Stat3-mediated Myc expression is required for Src transformation and PDGF-induced mitogenesis. Proc. Natl. Acad. Sci. USA 13:7319-7324.

7. Bromberg, J. F., M. H. Wrzeszczynska, G. Devgan, Y. Zhao, R. G. Pestell, C. Albanese, and J. E. Darnell, Jr. 1999. Stat3 as an oncogene. Cell 98:295-303.[CrossRef][Medline]

8. Broome, M. A., and S. A. Courtneidge. 2000. No requirement for src family kinases for PDGF signaling in fibroblasts expressing SV40 large T antigen. Oncogene 19:2867-2869.[CrossRef][Medline]

9. Bustelo, X. R. 2000. Regulatory and signaling properties of the Vav family. Mol. Cell. Biol. 20:1461-1477.[Free Full Text]

10. Cartwright, C. A., W. Eckhart, S. Simon, and P. L. Kaplan. 1987. Cell transformation by pp60c-src mutated in the carboxyl-terminal regulatory domain. Cell 49:83-91.[CrossRef][Medline]

11. Chang, B. Y., K. B. Conroy, E. M. Machleder, and C. A. Cartwright. 1998. RACK1, a receptor for activated C kinase and a homolog of the ß subunit of G proteins, inhibits activity of Src tyrosine kinases and growth of NIH 3T3 cells. Mol. Cell. Biol. 18:3245-3256.[Abstract/Free Full Text]

12. Chang, B. Y., M. Chiang, and C. A. Cartwright. 2001. The interaction of Src and RACK1 is enhanced by PKC activation and tyrosine phosphorylation of RACK1. J. Biol. Chem. 276:20346-20356.[Abstract/Free Full Text]

13. Chang, B. Y., R. Harte, and C. A. Cartwright. 2002. RACK1: a novel substrate for the Src protein-tyrosine kinase. Oncogene 21:7619-7629.[CrossRef][Medline]

14. Cheng, M. G., P. Olivier, J. A. Diehl, M. Fero, M. F. Roussel, J. M. Roberts, and C. J. Sherr. 1999. The p21Cip1 and p27Kip1 CDK 'inhibitors' are essential activators of cyclin D-dependent kinases in murine fibroblasts. EMBO J. 18:1571-1583.[CrossRef][Medline]

15. Chiariello, M., M. J. Marinissen, and J. S. Gutkind. 2001. Regulation of c-myc expression by PDGF through Rho GTPases. Nat. Cell Biol. 3:580-586.[CrossRef][Medline]

16. Coqueret, O. 2003. New roles for p21 and p27 cell-cycle inhibitors: a function for each cell compartment? Trends Cell Biol. 13:65-70.[CrossRef][Medline]

17. Coso, O. A., M. Chiariello, J. C. Yu, H. Teramoto, P. Crespo, N. Xu, T. Miki, and J. S. Gutkind. 1995. The small GTP-binding proteins Rac1 and Cdc42 regulate activity of the JNK/SAPK signaling pathway. Cell 81:1137-1146.[CrossRef][Medline]

18. Courtneidge, S. A. 2002. Role of Src in signal transduction pathways. Biochem. Soc. Trans. 30:11-17.[CrossRef][Medline]

19. Crespo, P., K. E. Schuebel, A. A. Ostrom, J. S. Gutkind, and X. R. Bustelo. 1997. Phosphotyrosine-dependent activation of Rac-1 GDP/GTP exchange by the vav proto-oncogene product. Nature 385:169-172.[CrossRef][Medline]

20. Diaz-Meco, M. T., M. M. Municio, S. Frutos, P. Sanchez, J. Lozano, L. Sanz, and J. Moscat. 1996. The product of par-4, a gene induced during apoptosis, interacts selectively with the atypical isoforms of protein kinase C. Cell 86:777-786.[CrossRef][Medline]

21. Donjerkovic, D., and D. W. Scott. 2000. Regulation of the G1 phase of the mammalian cell cycle. Cell Res. 1:1-16.

22. Dorn, G. W., and D. Mochly-Rosen. 2002. Intracellular transport mechanisms of signal transducers. Annu. Rev. Physiol. 64:407-429.[CrossRef][Medline]

23. Eisenman, R. N., and J. A. Cooper. 1995. Signal transduction. Beating a path to Myc. Nature 378:438-439.[CrossRef][Medline]

24. el-Deiry, W. S., T. Tokino, V. E. Velculescu, D. B. Levy, R. Parsons, J. M. Trent, D. Lin, W. E. Mercer, K. W. Kinzler, and B. Vogelstein. 1993. WAF1, a potential mediator of p53 tumor suppression. Cell 75:817-825.[CrossRef][Medline]

25. Fero, M. L., et al. 1998. The murine gene p27Kip1 is haplo-insufficient for tumour suppression. Nature 396:177-180.[CrossRef][Medline]

26. Furstoss, O., G. Manes, and S. Roche. 2002. Cyclin E and cyclin A are likely targets of Src for PDGF-induced DNA synthesis in fibroblasts. FEBS Lett. 526:82-86.[CrossRef][Medline]

27. Hay, J. C., H. Hirling, and R. H. Scheller. 1996. Mammalian vesicle trafficking proteins of the endoplasmic reticulum and Golgi apparatus. J. Biol. Chem. 271:5671-5679.[Abstract/Free Full Text]

28. He, T. C., A. B. Sparks, C. Rago, H. Hermeking, L. Zawel, L. T. da Costa, P. J. Morin, B. Vogelstein, and K. W. Kinzler. 1998. Identification of c-MYC as a target of the APC pathway. Science 281:1509-1512.[Abstract/Free Full Text]

29. Hermanto, U., C. S. Zong, W. W. Li, and L.-H. Wang. 2002. RACK1, an insulin-like growth factor I (IGF-I) receptor-interacting protein, modulates IGF-I-dependent integrin signaling and promotes cell spreading and contact with extracellular matrix. Mol. Cell. Biol. 22:2345-2365.[Abstract/Free Full Text]

30. Huang, T. S., M. L. Kuo, J. Y. Shew, Y. W. Chou, and W. K. Yang. 1996. Distinct p53-mediated G1/S checkpoint responses in two NIH3T3 subclone cells following treatment with DNA-damaging agents. Oncogene 13:625-632.[Medline]

31. Klinghoffer, R. A., C. Sachsenmaier, J. A. Cooper, and P. Soriano. 1999. Src family kinases are required for integrin but not PDGFR signal transduction. EMBO J. 18:2459-2471.[CrossRef][Medline]

32. Kmiecik, T. E., and D. Shalloway. 1987. Activation and suppression of pp60c-src transforming ability by mutation of its primary sites of tyrosine phosphorylation. Cell 49:65-73.[CrossRef][Medline]

33. Lipsich, L. A., A. J. Lewis, and J. S. Brugge. 1983. Isolation of monoclonal antibodies that recognize the transforming proteins of avian sarcoma viruses. J. Virol. 48:352-360.[Abstract/Free Full Text]

34. Mochly-Rosen, D. 1995. Localization of protein kinases by anchoring proteins: a theme in signal transduction. Science 268:247-251.[Abstract/Free Full Text]

35. Moyers, J. S., A. H. Bouton, and S. J. Parsons. 1993. The sites of phosphorylation by protein kinase C and an intact SH2 domain are required for the enhanced response to ß-adrenergic agonists in cells overexpressing c-src. Mol. Cell. Biol. 13:2391-2400.[Abstract/Free Full Text]

36. Nasi, S., R. Ciarapica, R. Jucker, J. Rosati, and L. Soucek. 2001. Making decisions through Myc. FEBS Lett. 490:153-162.[CrossRef][Medline]

37. Park, J., and C. A. Cartwright. 1995. Src activity increases and Yes activity decreases during mitosis of human colon carcinoma cells. Mol. Cell. Biol. 15:2374-2382.[Abstract]

38. Paul, C. P., P. D. Good, I. Winer, and D. R. Engelke. 2002. Effective expression of small interfering RNA in human cells. Nat. Biotechnol. 20:505-508.[CrossRef][Medline]

39. Pawson, T. 2004. Specificity in signal transduction: from phosphotyrosine-SH2 domain interactions to complex cellular systems. Cell 116:191-203.[CrossRef][Medline]

40. Piwnica-Worms, H., K. B. Saunders, T. M. Roberts, A. E. Smith, and S. H. Cheng. 1987. Tyrosine phosphorylation regulates the biochemical and biological properties of pp60c-src. Cell 49:75-82.[CrossRef][Medline]

41. Reynolds, A. B., J. Vila, T. J. Lansing, W. M. Potts, M. J. Weber, and J. T. Parsons. 1987. Activation of the oncogenic potential of the avian cellular Src protein by specific structural alteration of the carboxyl terminus. EMBO J. 6:2359-2364.[Medline]

42. Riley, D., N. O. Carragher, M. C. Frame, and J. A. Wyke. 2001. The mechanism of cell cycle regulation by v-Src. Oncogene 20:5941-5950.[CrossRef][Medline]

43. Robinson, M. J., and M. H. Cobb. 1997. Mitogen-activated protein kinase pathways. Curr. Opin. Cell Biol. 9:180-186.[CrossRef][Medline]

44. Roche, S., M. Koegl, M. V. Barone, M. F. Roussel, and S. A. Courtneidge. 1995. DNA synthesis induced by some but not all growth factors requires Src family protein tyrosine kinases. Mol. Cell. Biol. 15:1102-1109.[Abstract]

45. Servitja, J.-M., M. J. Marinissen, A. Sodhi, X. R. Bustelo, and J. S. Gutkind. 2003. Rac1 function is required for Src-induced transformation. J. Biol. Chem. 278:34339-34346.[Abstract/Free Full Text]

46. Sherr, C. J. 1996. Cancer cell cycles. Science 274:1672-1677.[Abstract/Free Full Text]

47. Sherr, C. J., and J. M. Roberts. 1999. CDK inhibitors: positive and negative regulators of G1 phase progression. Genes Dev. 13:1501-1512.[Free Full Text]

48. Simon, A. R., H. G. Vikis, S. Stewart, B. L. Fanburg, B. H. Cochran, and K. L. Guan. 2000. Regulation of STAT3 by direct binding to the Rac1 GTPase. Science 290:144-147.[Abstract/Free Full Text]

49. Sinibaldi, D., W. Wharton, J. Turkson, T. Bowman, W. J. Pledger, and R. Jove. 2000. Induction of p21WAF1/CIP1 and cyclin D1 expression by the Src oncoprotein in mouse fibroblasts: role of activated STAT3 signaling. Oncogene 19:5419-5427.[CrossRef][Medline]

50. Slingerland, J., and M. Pagano. 2000. Regulation of the cdk inhibitor p27 and its deregulation in cancer. J. Cell. Physiol. 183:10-17.[CrossRef][Medline]

51. Thomas, S. M., and J. A. Brugge. 1997. Cellular functions regulated by Src family kinases. Annu. Rev. Cell Dev. Biol. 13:513-609.[CrossRef][Medline]

52. Turkson, J., T. Bowman, J. Adnane, Y. Zhang, J. Y. Djeu, M. Sekharam, D. A. Frank, L. B. Holzman, J. Wu, S. Sebti, and R. Jove. 1998. Stat3 activation by Src induces specific gene regulation and is required for cell transformation. Mol. Cell. Biol. 18:2545-2552.[Abstract/Free Full Text]

53. Twamley-Stein, G. M., R. Pepperkok, W. Ansorge, and S. A. Courtneidge. 1993. The Src family tyrosine kinases are required for platelet-derived growth factor-mediated signal transduction in NIH 3T3 cells. Proc. Natl. Acad. Sci. USA 90:7696-7700.[Abstract/Free Full Text]

54. Van Aelst, L., and C. D'Souza-Schorey. 1997. Rho GTPases and signaling networks. Genes Dev. 11:2295-2322.[Free Full Text]

55. Welsh, C. F., K. Roovers, J. Villanueva, Y. Liu, M. A. Schwartz, and R. K. Assoian. 2001. Timing of cyclin D1 expression within G1 phase is controlled by Rho. Nat. Cell Biol. 3:950-957.[CrossRef][Medline]


Molecular and Cellular Biology, August 2004, p. 6788-6798, Vol. 24, No. 15
0270-7306/04/$08.00+0     DOI: 10.1128/MCB.24.15.6788-6798.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mamidipudi, V.
Right arrow Articles by Cartwright, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mamidipudi, V.