![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Department of Medicine, Stanford University, Stanford, California 94305-5187
Received 4 February 2004/ Returned for modification 17 March 2004/ Accepted 28 April 2004
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
RACK1 is the founding member of a family of receptors for activated C kinase (PKC) collectively called RACKs (reviewed in references 22 and 34). Following serum or platelet-derived growth factor (PDGF) stimulation or PKC activation, we observed that RACK1 colocalizes with Src at the plasma membrane and functions as a substrate, binding partner, and inhibitor of Src (as measured in vitro) and as a growth inhibitor in NIH 3T3 cells (11-13). RACK1 inhibits cell growth, in part, by prolonging the G0/G1 phase of the cell cycle.
G1/S transition is controlled by two key families of proteins: cyclin-dependent kinases (CDKs) and cyclins. Cyclins bind to and activate CDKs (21, 46). Another critical event in cell cycle progression at G1/S is phosphorylation and inactivation of the retinoblastoma protein (pRb) and release of regulatory proteins such as E2F, which stimulate transcription of target genes that are required for cell proliferation. v-Src, the transforming homolog of c-Src, directly affects cell cycle proteins that regulate G1/S transition (26, 42, 51). For example, v-Src induces rapid transit through the G1 checkpoint and entry into S phase by simultaneously suppressing the CDK inhibitor p27 and inducing p21 and cyclins D1, E, and A (42, 49).
Growth factors trigger cascades of intracellular signals that lead to induction of the nuclear oncogene Myc (3, 23, 36). Cyclin/CDK complexes are then activated, and cells pass the G1 checkpoint and embark on DNA replication. c-Src activation is essential for PDGF-induced G1/S transition and DNA replication (4, 5, 44, 51, 53). Kinase-inactive Src induces a G1/S block that can be rescued by constitutive expression of Myc (4). Moreover, microinjection of antibodies that inhibit Src family kinases or treatment with a selective Src family kinase inhibitor, SU6656, inhibits PDGF- and Src-driven Myc induction and DNA synthesis (5, 44). Collectively, these results show that Src activity regulates the transcriptional activation of Myc and G1/S transition.
We hypothesized that RACK1 prolongs the G0/G1 phase of the cell cycle by inhibiting the activity of Src, and thereby Myc and other cell cycle regulators, at the G1 checkpoint. We found that RACK1 overexpression induces a partial G1 arrest by suppressing Src activity at the G1 checkpoint. RACK1 works through Src to inhibit Vav2, Rho GTPases, Stat3, and Myc. Consequently, cyclin D1 and CDK4 and CDK2 are suppressed, CDK inhibitor p27 and retinoblastoma protein are activated, E2F1 is sequestered, and G1/S progression is delayed. Conversely, short interference RNA (siRNA) inhibition of RACK1 expression activates Src-mediated signaling, induces Myc and cyclin D1, and accelerates G1/S transition. RACK1 suppresses Src- but not mitogen-activated protein kinase (MAPK)-dependent PDGF signaling.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Reagents. The plasmids pcDNA3-src, pcDNA3-HA-RACK1, pcDNA3-HA-RACK1Y228F, and pcDNA3-dl155 have been previously described (11-13). The HA-RACK1Y228F/Y246F mutant was created using pcDNA3-HA-RACK1Y228F (12, 13) as a template, the oligonucleotide primers 5' CTTCAGCCCTAACCGCTTCTGGCTGTGTGCTGC 3' and 5' GCAGCACACAGCCAGAAGCGGTTAGGGCTGAAG 3', and the QuickChange mutagenesis kit according to the protocol of the manufacturer (Stratagene, Cedar Creek, Tex.). The sequence of the mutant HA-RACK1Y228F/Y246F was confirmed by automated DNA sequencing (Protein and Nucleic Acid Facility, Stanford University, Stanford, Calif.). The mutant RACK1 gene was inserted into pcDNA3 (Invitrogen) to create pcDNA3-HA-RACK1Y228F/Y246F, as described previously (11, 12). The c-myc promoter reporter plasmid pMyc-Luc (24, 28) was kindly provided by Bert Vogelstein (Johns Hopkins University, Baltimore, Md.). Human RACK1 siRNA plasmids (38) were constructed according to the recommendations of the manufacturer (Imgenex, San Diego, Calif.). The target sequences of siRNA-A and siRNA-B are bp 146 to 166 and 195 to 215, respectively (human RACK1 sequence accession no. NM_006098). A BLAST search confirmed that the targeted sequences matched no other human cDNA sequence in GenBank. Briefly, for each siRNA plasmid, two complementary oligonucleotides were annealed and ligated into pSuppressor. The resulting short RNA transcript is predicted to have a 6-nucleotide loop. pCF1-Vav2-HA was a gift from Joan Brugge (Harvard University, Boston, Mass.). pcDNA3.1-Rac1-HA, pcDNA3.1-Rac1N17-HA, pcDNA3.1-Cdc42-HA, and pcDNA3.1-Cdc42N17-HA were purchased from Guthrie DNA Resource Center (Sayre, Pa.). pVR Stat3 and pIRES Stat3ß (Stat3ß) were kindly provided by Richard Jove (H. Lee Moffitt Cancer Center and Research Institute, Tampa, Fla.). Full-length human RACK1 cDNA was cloned into pEGFP-N1 (Clontech, Palo Alto, Calif.) as a HindIII/SalI fragment to generate a RACK1-green fluorescent protein (GFP) fusion. The fusion was subcloned into pcDNA3 to create pcDNA3-RACK1-GFP. pcDNA3-RACK1Y228F/Y246F-GFP was generated by ligating a HindIII/BglII fragment of HA-RACK1Y228F/Y246F and a BglII/NotI fragment of RACK1-GFP and subcloning the fusion into pcDNA3. pSP65 Myc was a gift from Roche Serge (Centre National de la Recherche Scientifique, Montpellier, France).
Reporter gene assays. NIH 3T3 and HEK 293 cells were transfected with the Lipofectamine Plus reagent (Invitrogen), with different expression plasmids together with 10 ng of pRL-Luc (Renilla luciferase) and 1 µg of the reporter plasmid pMyc-Luc. After incubation for 24 h, the cells were lysed with reporter lysis buffer (Promega, Madison, Wis.). Luciferase activity present in cellular lysates was assayed with D-luciferin and ATP as substrates (20), and light emission was quantified with the Monolight 2010 luminometer as specified by the manufacturer (Analytical Luminescence Laboratory, San Diego, Calif.).
Immunoblot analysis and antibodies. Lysates of total cellular proteins or immunoprecipitates were analyzed by protein immunoblotting after sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis with the specified rabbit or goat polyclonal or mouse monoclonal antibody (11-13). Immunocomplexes were detected by enhanced chemiluminescence (Amersham, Arlington Heights, Ill.) with the use of goat antiserum to rabbit or mouse immunoglobulin G coupled to horseradish peroxidase (Cappel, West Chester, Pa.). As primary antibodies, we used rabbit polyclonal antisera to CDK4 (C-22), Rac1 (C-14), cyclin D1 (M-20), E2F1 (KH95), and ERK2; goat polyclonal antisera to Vav2 (C-19; Santa Cruz Biotechnology, Santa Cruz, Calif.); and mouse monoclonal antibodies to c-Myc (9E10), CDK2 (D-12; Santa Cruz Biotechnology), RACK1, Stat3, Stat3 pY705, p21, Kip1/p27, phosphotyrosine (Py20; Transduction Laboratories, Lexington, Ky.), hemagglutinin (12CA5; Abgent, San Diego, Calif.), phospho-p44/42MAPK (Thr 202/Tyr 204; Cell Signaling Technology, Beverly, Mass.), retinoblastoma protein (pRb; G3-245; PharMingen, San Diego, Calif.), tubulin (Sigma, St. Louis, Mo.), and Src monoclonal antibody 327 (33).
In vitro protein kinase assays.
Methods to evaluate the phosphorylating activity of Src by kinase assays in vitro have been described previously (10-13). For CDK4 and CDK2 kinase assays (55) cell pellets were extracted in 100 µl of freshly prepared lysis buffer (50 mM Tris-HCl [pH 8], 150 mM NaCl, 0.1% Triton X-100, 1 mM dithiothreitol [DTT], 10 µg of aprotinin ml–1, 10 µg of leupeptin ml–1, 5 mM NaF, 10 mM Na3VO4). Equal amounts of cell lysate (500 µg in 1,000 µl of lysis buffer) were incubated with 4 µg of anti-CDK2 or anti-CDK4 for 2 h on ice and then with 50 µl of washed protein A-agarose (Santa Cruz Biotechnology) for 2 h at 4°C with rocking. The collected immunoprecipitate was washed two times with lysis buffer and then four times with cold kinase reaction buffer (20 mM HEPES [pH 8], 10 mM MgCl2, 0.1 mM DTT, 10 µg of aprotinin ml–1, 10 µg of leupeptin ml–1, 5 mM NaF, 10 mM Na3VO4). The washed immunoprecipitate was resuspended in 25 µl of kinase reaction buffer-20 µM ATP-20 µCi of [
-32P]ATP (4,500 Ci mmol–1; MP Biomedicals, Irvine, Calif.)-2.5 µg of pRb peptide (Santa Cruz Biotechnology) for CDK4 assays or 4 µg of histone H1 (Invitrogen) for CDK2 assays. The kinase reaction mixture was incubated for 10 min at 30°C, and the reaction was stopped by adding 5 µl of 2x SDS sample buffer and heating the suspension for 5 min at 95°C. Proteins were separated on gradient (4 to 20%) SDS-polyacrylamide gels and detected by autoradiography. ERK2 in vitro kinase assays were performed as described previously (15, 17, 19) with myelin basic protein (MBP) as an exogenous substrate. Briefly, extracellular signal-regulated kinase (ERK) immunoprecipitates were washed and resuspended in 25 µl of reaction buffer (25 mM HEPES [pH 7.4], 10 mM MgCl2, 0.1 mM Na3VO4, 1 mM DTT) containing 3 µg of MBP (Sigma) and 10 µCi of [-32P]ATP. The kinase reaction mixture was incubated for 30 min at 30°C.
Fluorescence microscopy. NIH 3T3 cells were transiently transfected for 24 h and then serum starved for 24 h, treated with 10% fetal bovine serum (FBS) for 3 h, and replated in 10% FBS onto Lab-Tek eight-well Permanox chamber slides (Nalgene Nunc International, Rochester, N.Y.) coated with 20 ng of fibronectin (Sigma) µl–1. Four hours later, cells were fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) for 20 min, quenched twice in 0.1 M glycine for 10 min, and permeabilized in 0.4% saponin-1% bovine serum albumin (BSA)-5% goat serum for 15 min (27). Cells were then incubated with anti-cyclin D1 (2.5 µg ml–1; BD Pharmingen) for 45 min, washed in 1% BSA in PBS, and incubated with 4 µg of Alexa Fluor 594 goat anti-mouse immunoglobulin G (Molecular Probes, Eugene, Oreg.) ml–1 for 30 min in the dark. Cells were washed again in 1% BSA in PBS, incubated with 0.2 µg of 4',6'-diamidino-2-phenylindole (DAPI; Pierce, Rockford, Ill.) ml–1 for 1 min, and washed quickly in distilled water. Slides were mounted with Vectashield mounting medium (Vector Laboratories, Burlingame, Calif.). Images were obtained by fluorescence microscopy at an x60 magnification under oil, captured using a SPOT RT camera, and analyzed with Openlab Imaging System software.
Flow cytometry. NIH 3T3 or HEK 293 cells (5 x 105/100-mm-diameter dish) were transfected, serum starved for 48 or 24 h (respectively), and then treated with 10% FBS for 6 h. Cells were then fixed in 70% ethanol for 30 min, collected by low-speed centrifugation, resuspended in PBS containing 10 µg of RNase A (Sigma) ml–1 and 20 µg of propidium iodide (Sigma) ml–1, and incubated in the dark at 37°C for 30 min (37). Cells (5,000 to 10,000) were analyzed for DNA content by FACScan cell sorting (Becton Dickinson, San Jose, Calif.). Histograms were prepared using ModFitLT software. RACK1 immunoblot analyses performed on lysates from plates of cells parallel to those used for flow cytometric analyses demonstrated consistent levels of HA-RACK1 expression for all transfections.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
|
|
|
Downregulation of RACK1 activates Src-mediated signaling pathways. In a complementary approach to the RACK1 overexpression studies, we examined the effect of RACK1 inhibition on downstream effectors of Src. As shown in Fig. 1C, downregulation of RACK1 by siRNA increased Src activity and Myc expression. Downregulation of RACK1 also increased tyrosine phosphorylation of Vav2 and Stat3 and expression of cyclin D1 but had no effect on phosphorylation of ERK1, ERK2, or MBP (Fig. 4E). Together, the results from the RACK1 overexpression and downregulation studies indicate that RACK1 negatively regulates a Src-dependent but MAPK-independent signaling pathway that culminates in activation of Myc and cyclin D1.
RACK1 inhibits cell cycle regulators in G1 by suppressing Src activity. To further explore the mechanism by which RACK1 overexpression prolongs the G0/G1 phase of the cell cycle, we next examined RACK1's effect on key regulators of cell cycle progression at the G1/S boundary. Cells were synchronized in G0 by serum withdrawal for 48 h and released into G1 by the addition of serum for 6 h. Src overexpression resulted in increased in vitro kinase activity of Src, CDK4, and CDK2; increased cyclin D1 and p21 expression; hyperphosphorylation of retinoblastoma protein (pRb); and release of the transcription factor E2F in G1 (Fig. 5A). Overexpression of wild-type but not mutant RACK1 abolished the Src-induced effects and induced expression of the CDK inhibitor p27. As a control, we showed that overexpression of Src and/or RACK1 had no effect on the expression of tubulin. In a complementary approach to the biochemical studies, we assessed RACK1's effect on Src-mediated cyclin D1 expression in G1 phase by coexpressing Src and GFP fused to wild-type or mutant RACK1 and assessing nuclear cyclin D1 staining by immunofluorescence microscopy. Src overexpression increased nuclear expression of cyclin D1 in G1 (Fig. 5B). Overexpression of wild-type but not mutant RACK1-GFP inhibited the Src-mediated cyclin D1 expression. This observation is internally consistent with those of our biochemical studies (Fig. 5A); both show that RACK1, via its interaction with Src, inhibits cyclin D1 expression in G1. Together, our results indicate that RACK1 inhibits key cell cycle regulators in G1 by suppressing Src kinase activity.
|
|
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Our study identifies an endogenous inhibitor of Src activity that works at the G1 checkpoint. Our results are consistent with those of Courtneidge and others, who, using three complementary approaches (microinjection of antibodies that inhibit Src family kinases, expression of kinase-inactive Src, or treatment with a selective Src family kinase inhibitor, SU6656), demonstrated that Src kinases are essential for PDGF-induced mitogenesis in NIH 3T3 cells (4, 5, 44, 51, 53). At first glance, these findings appear contradictory to those showing that an immortalized mouse embryo cell line that lacks Src, Yes, and Fyn (SYF cells) responds mitogenically to PDGF (31). However, the SYF cells were derived by immortalizing primary mouse embryo fibroblasts with simian virus 40 large T antigen, and expression of simian virus 40 large T antigen in fibroblasts has been shown to eliminate the need for Src family kinase (and Ras) signaling pathways (8). Consistent with this, SU6656 is unable to inhibit PDGF-stimulated DNA synthesis in SYF cells (5). Thus, one explanation for the apparent contradiction may be the different types of cells studied. Overall, the consistent finding in NIH 3T3 cells, whether with a small molecule, an antibody, or an endogenous inhibitor of Src, is that activation of Src family kinases is essential for PDGF-induced mitogenesis.
In addition to defining RACK1's influence on Src activity at the G1 checkpoint, our results reveal a mechanism whereby RACK1 works in Src signaling pathways: by inhibiting Src-dependent activation of Vav2, Rho GTPases, Stat3, and Myc (Fig. 1 to 4). Interestingly, we find that Rac1 and Stat3, each of which is known to be required for Src signaling and transformation, work together in a common Myc activation pathway, where Stat3 is required for Rac1 to activate Myc (Fig. 4A and B). The inability of RACK1 to inhibit PDGF- or Src-induced MAPK activation (Fig. 7B and 4D and E) suggests selectivity of RACK1 for some PDGF-Src activation pathways and not others. These results are consistent with published reports showing that in NIH 3T3 cells (i) treatment with the SU6656 Src family kinase inhibitor does not inhibit PDGF-stimulated ERK phosphorylation (5), (ii) PDGF is known to activate Myc by Src-dependent but Ras-MAPK-independent mechanisms (15), and (iii) RACK1 overexpression does not affect insulin-like growth factor I (IGF-I)-induced ERK phosphorylation (29). Collectively, the studies suggest that there are (i) growth factor-MAPK activation pathways that are independent of Src and RACK1 and (ii) Src-MAPK activation pathways that are independent of RACK1 and that (iii) RACK1's inhibitory influence on growth factor- and Src-induced mitogenesis does not involve MAPK pathways.
We propose a model for RACK1 function in Src-mediated mitogenesis (Fig. 8). Normally, engagement of PDGF with its cell surface tyrosine kinase receptor induces dimerization and autophosphorylation of the receptor; Src binding and activation; tyrosine phosphorylation of Vav2; activation of Rho GTPases; tyrosine phosphorylation of Stat3; dimerization and translocation of Stat3 to the nucleus; activation of Myc, cyclin D1, and other cell cycle regulators; G1/S progression; and cell proliferation (Fig. 8A). We submit that RACK1 works at the G1/S boundary by partially inhibiting Src activity and thereby the tyrosine phosphorylation of Vav2; activation of Rho GTPases; tyrosine phosphorylation of Stat3; and activation of Myc, cyclin D1, and other cell cycle regulators. Consequently, G1/S transition is delayed (Fig. 8B).
|
A recent study showed that RACK1 overexpression inhibits IGF-I-induced CDK2 activity; Rb phosphorylation; and cell cycle progression in G0, G1, or at the G1/S boundary but that it does not affect expression of cyclin D1 or the associated CDK4 (29). In contrast, in the Src pathway, we show that RACK1 inhibits cyclin D1 expression and CDK4 activity (both of which are critical for Src-mediated G1/S progression), and it does so specifically at the G1/S checkpoint (Fig. 6). Thus, RACK1 appears to regulate distinct targets at distinct times in G0/G1 in PDGF-Src and IGF-I signaling pathways.
One of the earliest G1 events to occur in response to growth factor stimulation is synthesis and assembly of D-type cyclins with their catalytic partners, CDK4 and CDK6 (14, 21, 47, 50). The catalytic activity of the cyclin D-CDK complex is first manifest in mid-G1 and increases to a maximum near G1/S transition. Activation of a temperature-sensitive v-Src in quiescent cells sequentially induces cyclins D1, E, and A and activates cyclin D1-CDK4-CDK6 and CDK E-CDK A-CDK2 at the G1/S boundary (26, 42, 49). Our findings that RACK1 partially inhibits Src-mediated cyclin D1 expression (Fig. 5A and B), cyclin E expression (data not shown), and CDK4 and CDK2 activity (Fig. 5A) identify a mechanism of cell cycle control in late G1 that works via an endogenous inhibitor of the Src kinase. An inhibitor governing this critical restriction point in the cycle would wield tight control over cell proliferation.
CDK activity is constrained by at least two families of inhibitors: the INK4 proteins and the Cip-Kip proteins p21 and p27 (reviewed in references 46, 47, and 50). Consistent with this known function for Cip-Kip proteins and with previous observations in v-Src-transformed NIH and BALB/c 3T3 cells (42), we found that p27 was inhibited in Src-overexpressing cells and induced in RACK1-overexpressing cells (Fig. 5A). In contrast, we found that p21 was induced in Src-overexpressing cells and inhibited in RACK1-overexpressing cells. While this latter finding is consistent with published observations for v-Src-transformed cells (49), it is puzzling in light of the traditional view of p21 as a CDK inhibitor. However, recent evidence indicates that p21 and p27 can also function as activators of CDKs because they are required for the expression of cyclin D, for assembly of cyclin D-CDK complexes, and for the transport of cyclin D proteins to the nucleus (14, 47). Moreover, p21 and p27 have also been implicated in the regulation of apoptosis and in transcriptional activation (reviewed in reference 16). Thus, new roles are emerging for Cip-Kip proteins, and their complex functions in cells need to be further delineated. Interestingly, in 35 to 40% of breast and colon cancer cells, p27 relocates from the nucleus to the cytoplasm, where it is presumably degraded, thus activating CDKs (50). Moreover, heterozygous p27+/– mice get tumors, even with only one mutant allele (25). In contrast, p21 has not been shown to relocate to the cytoplasm or to undergo mutation in cancer cells. This suggests that p21 and p27 may not always serve identical functions in cells and may explain why inhibiting Src activity elicits opposing effects on p21 and p27 expression. Another possibility is that established cell lines like NIH 3T3 have alterations in the p53 pathway, which might affect the regulation of p21 (30).
Our data on Vav2- and Src-induced myc promoter activity (Fig. 2B) and Myc protein expression (Fig. 2C) could be explained by Src working through Vav2 or in parallel with Vav2. However, Src overexpression or PDGF stimulation strongly induced the tyrosine phosphorylation of Vav2 in cells overexpressing mutant but not wild-type RACK1 (Fig. 2A and 7A), and Chiariello et al. demonstrated that PDGF activates Src and stimulates Vav2 through Src-mediated tyrosine phosphorylation, thereby initiating the activation of a Rac-dependent pathway that controls transcriptional activation of myc (15). Collectively, these results suggest that Vav2 participates in a PDGF-Src-Myc activation pathway that is regulated by RACK1. They do not exclude the possibility that there are other signaling pathways involved in the regulation of Myc by Src that are independent of Vav2.
Together, the studies indicate that RACK1 negatively regulates growth factor-activated pathways that control cell cycle progression at the G1/S checkpoint. The significance of these findings is that an endogenous inhibitor of mitogenic signals working at this pivotal cell cycle restriction point would have powerful and pervasive influence on control of cell growth. Endogenous inhibitors of oncogenic kinases are tumor suppressors; they represent exciting new targets for cancer therapy.
|
ACKNOWLEDGMENTS |
|---|
This work was supported by a grant from the National Institutes of Health to C.A.C. (DK43743).
|
FOOTNOTES |
|---|
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Abram, C. L., and S. A. Courtneidge. 2000. Src family tyrosine kinases and growth factor signaling. Exp. Cell Res. 254:1-13.[CrossRef][Medline]
3. Amati, B., K. Alevizopoulos, and J. Vlach. 1998. Myc and the cell cycle. Front. Biosci. 3:D250-D268.
4. Barone, M. V., and S. A. Courtneidge. 1995. Myc but not Fos rescue of PDGF signalling block caused by kinase-inactive Src. Nature 378:509-512.[CrossRef][Medline]
5. Blake, R. A., M. A. Broome, X. Liu, J. Wu, M. Gishizky, L. Sun, and S. A. Courtneidge. 2000. SU6656, a selective Src family kinase inhibitor, used to probe growth factor signaling. Mol. Cell. Biol. 20:9018-9027.
6. Bowman, T., M. A. Broome, D. Sinibaldi, W. Wharton, W. J. Pledger, J. M. Sedivy, R. Irby, T. Yeatman, S. A. Courtneidge, and R. Jove. 2001. Stat3-mediated Myc expression is required for Src transformation and PDGF-induced mitogenesis. Proc. Natl. Acad. Sci. USA 13:7319-7324.
7. Bromberg, J. F., M. H. Wrzeszczynska, G. Devgan, Y. Zhao, R. G. Pestell, C. Albanese, and J. E. Darnell, Jr. 1999. Stat3 as an oncogene. Cell 98:295-303.[CrossRef][Medline]
8. Broome, M. A., and S. A. Courtneidge. 2000. No requirement for src family kinases for PDGF signaling in fibroblasts expressing SV40 large T antigen. Oncogene 19:2867-2869.[CrossRef][Medline]
9. Bustelo, X. R. 2000. Regulatory and signaling properties of the Vav family. Mol. Cell. Biol. 20:1461-1477.
10. Cartwright, C. A., W. Eckhart, S. Simon, and P. L. Kaplan. 1987. Cell transformation by pp60c-src mutated in the carboxyl-terminal regulatory domain. Cell 49:83-91.[CrossRef][Medline]
11. Chang, B. Y., K. B. Conroy, E. M. Machleder, and C. A. Cartwright. 1998. RACK1, a receptor for activated C kinase and a homolog of the ß subunit of G proteins, inhibits activity of Src tyrosine kinases and growth of NIH 3T3 cells. Mol. Cell. Biol. 18:3245-3256.
12. Chang, B. Y., M. Chiang, and C. A. Cartwright. 2001. The interaction of Src and RACK1 is enhanced by PKC activation and tyrosine phosphorylation of RACK1. J. Biol. Chem. 276:20346-20356.
13. Chang, B. Y., R. Harte, and C. A. Cartwright. 2002. RACK1: a novel substrate for the Src protein-tyrosine kinase. Oncogene 21:7619-7629.[CrossRef][Medline]
14. Cheng, M. G., P. Olivier, J. A. Diehl, M. Fero, M. F. Roussel, J. M. Roberts, and C. J. Sherr. 1999. The p21Cip1 and p27Kip1 CDK 'inhibitors' are essential activators of cyclin D-dependent kinases in murine fibroblasts. EMBO J. 18:1571-1583.[CrossRef][Medline]
15. Chiariello, M., M. J. Marinissen, and J. S. Gutkind. 2001. Regulation of c-myc expression by PDGF through Rho GTPases. Nat. Cell Biol. 3:580-586.[CrossRef][Medline]
16. Coqueret, O. 2003. New roles for p21 and p27 cell-cycle inhibitors: a function for each cell compartment? Trends Cell Biol. 13:65-70.[CrossRef][Medline]
17. Coso, O. A., M. Chiariello, J. C. Yu, H. Teramoto, P. Crespo, N. Xu, T. Miki, and J. S. Gutkind. 1995. The small GTP-binding proteins Rac1 and Cdc42 regulate activity of the JNK/SAPK signaling pathway. Cell 81:1137-1146.[CrossRef][Medline]
18. Courtneidge, S. A. 2002. Role of Src in signal transduction pathways. Biochem. Soc. Trans. 30:11-17.[CrossRef][Medline]
19. Crespo, P., K. E. Schuebel, A. A. Ostrom, J. S. Gutkind, and X. R. Bustelo. 1997. Phosphotyrosine-dependent activation of Rac-1 GDP/GTP exchange by the vav proto-oncogene product. Nature 385:169-172.[CrossRef][Medline]
20. Diaz-Meco, M. T., M. M. Municio, S. Frutos, P. Sanchez, J. Lozano, L. Sanz, and J. Moscat. 1996. The product of par-4, a gene induced during apoptosis, interacts selectively with the atypical isoforms of protein kinase C. Cell 86:777-786.[CrossRef][Medline]
21. Donjerkovic, D., and D. W. Scott. 2000. Regulation of the G1 phase of the mammalian cell cycle. Cell Res. 1:1-16.
22. Dorn, G. W., and D. Mochly-Rosen. 2002. Intracellular transport mechanisms of signal transducers. Annu. Rev. Physiol. 64:407-429.[CrossRef][Medline]
23. Eisenman, R. N., and J. A. Cooper. 1995. Signal transduction. Beating a path to Myc. Nature 378:438-439.[CrossRef][Medline]
24. el-Deiry, W. S., T. Tokino, V. E. Velculescu, D. B. Levy, R. Parsons, J. M. Trent, D. Lin, W. E. Mercer, K. W. Kinzler, and B. Vogelstein. 1993. WAF1, a potential mediator of p53 tumor suppression. Cell 75:817-825.[CrossRef][Medline]
25. Fero, M. L., et al. 1998. The murine gene p27Kip1 is haplo-insufficient for tumour suppression. Nature 396:177-180.[CrossRef][Medline]
26. Furstoss, O., G. Manes, and S. Roche. 2002. Cyclin E and cyclin A are likely targets of Src for PDGF-induced DNA synthesis in fibroblasts. FEBS Lett. 526:82-86.[CrossRef][Medline]
27. Hay, J. C., H. Hirling, and R. H. Scheller. 1996. Mammalian vesicle trafficking proteins of the endoplasmic reticulum and Golgi apparatus. J. Biol. Chem. 271:5671-5679.
28. He, T. C., A. B. Sparks, C. Rago, H. Hermeking, L. Zawel, L. T. da Costa, P. J. Morin, B. Vogelstein, and K. W. Kinzler. 1998. Identification of c-MYC as a target of the APC pathway. Science 281:1509-1512.
29. Hermanto, U., C. S. Zong, W. W. Li, and L.-H. Wang. 2002. RACK1, an insulin-like growth factor I (IGF-I) receptor-interacting protein, modulates IGF-I-dependent integrin signaling and promotes cell spreading and contact with extracellular matrix. Mol. Cell. Biol. 22:2345-2365.
30. Huang, T. S., M. L. Kuo, J. Y. Shew, Y. W. Chou, and W. K. Yang. 1996. Distinct p53-mediated G1/S checkpoint responses in two NIH3T3 subclone cells following treatment with DNA-damaging agents. Oncogene 13:625-632.[Medline]
31. Klinghoffer, R. A., C. Sachsenmaier, J. A. Cooper, and P. Soriano. 1999. Src family kinases are required for integrin but not PDGFR signal transduction. EMBO J. 18:2459-2471.[CrossRef][Medline]
32. Kmiecik, T. E., and D. Shalloway. 1987. Activation and suppression of pp60c-src transforming ability by mutation of its primary sites of tyrosine phosphorylation. Cell 49:65-73.[CrossRef][Medline]
33. Lipsich, L. A., A. J. Lewis, and J. S. Brugge. 1983. Isolation of monoclonal antibodies that recognize the transforming proteins of avian sarcoma viruses. J. Virol. 48:352-360.
34. Mochly-Rosen, D. 1995. Localization of protein kinases by anchoring proteins: a theme in signal transduction. Science 268:247-251.
35. Moyers, J. S., A. H. Bouton, and S. J. Parsons. 1993. The sites of phosphorylation by protein kinase C and an intact SH2 domain are required for the enhanced response to ß-adrenergic agonists in cells overexpressing c-src. Mol. Cell. Biol. 13:2391-2400.
36. Nasi, S., R. Ciarapica, R. Jucker, J. Rosati, and L. Soucek. 2001. Making decisions through Myc. FEBS Lett. 490:153-162.[CrossRef][Medline]
37. Park, J., and C. A. Cartwright. 1995. Src activity increases and Yes activity decreases during mitosis of human colon carcinoma cells. Mol. Cell. Biol. 15:2374-2382.[Abstract]
38. Paul, C. P., P. D. Good, I. Winer, and D. R. Engelke. 2002. Effective expression of small interfering RNA in human cells. Nat. Biotechnol. 20:505-508.[CrossRef][Medline]
39. Pawson, T. 2004. Specificity in signal transduction: from phosphotyrosine-SH2 domain interactions to complex cellular systems. Cell 116:191-203.[CrossRef][Medline]
40. Piwnica-Worms, H., K. B. Saunders, T. M. Roberts, A. E. Smith, and S. H. Cheng. 1987. Tyrosine phosphorylation regulates the biochemical and biological properties of pp60c-src. Cell 49:75-82.[CrossRef][Medline]
41. Reynolds, A. B., J. Vila, T. J. Lansing, W. M. Potts, M. J. Weber, and J. T. Parsons. 1987. Activation of the oncogenic potential of the avian cellular Src protein by specific structural alteration of the carboxyl terminus. EMBO J. 6:2359-2364.[Medline]
42. Riley, D., N. O. Carragher, M. C. Frame, and J. A. Wyke. 2001. The mechanism of cell cycle regulation by v-Src. Oncogene 20:5941-5950.[CrossRef][Medline]
43. Robinson, M. J., and M. H. Cobb. 1997. Mitogen-activated protein kinase pathways. Curr. Opin. Cell Biol. 9:180-186.[CrossRef][Medline]
44. Roche, S., M. Koegl, M. V. Barone, M. F. Roussel, and S. A. Courtneidge. 1995. DNA synthesis induced by some but not all growth factors requires Src family protein tyrosine kinases. Mol. Cell. Biol. 15:1102-1109.[Abstract]
45. Servitja, J.-M., M. J. Marinissen, A. Sodhi, X. R. Bustelo, and J. S. Gutkind. 2003. Rac1 function is required for Src-induced transformation. J. Biol. Chem. 278:34339-34346.
46. Sherr, C. J. 1996. Cancer cell cycles. Science 274:1672-1677.
47. Sherr, C. J., and J. M. Roberts. 1999. CDK inhibitors: positive and negative regulators of G1 phase progression. Genes Dev. 13:1501-1512.
48. Simon, A. R., H. G. Vikis, S. Stewart, B. L. Fanburg, B. H. Cochran, and K. L. Guan. 2000. Regulation of STAT3 by direct binding to the Rac1 GTPase. Science 290:144-147.
49. Sinibaldi, D., W. Wharton, J. Turkson, T. Bowman, W. J. Pledger, and R. Jove. 2000. Induction of p21WAF1/CIP1 and cyclin D1 expression by the Src oncoprotein in mouse fibroblasts: role of activated STAT3 signaling. Oncogene 19:5419-5427.[CrossRef][Medline]
50. Slingerland, J., and M. Pagano. 2000. Regulation of the cdk inhibitor p27 and its deregulation in cancer. J. Cell. Physiol. 183:10-17.[CrossRef][Medline]
51. Thomas, S. M., and J. A. Brugge. 1997. Cellular functions regulated by Src family kinases. Annu. Rev. Cell Dev. Biol. 13:513-609.[CrossRef][Medline]
52. Turkson, J., T. Bowman, J. Adnane, Y. Zhang, J. Y. Djeu, M. Sekharam, D. A. Frank, L. B. Holzman, J. Wu, S. Sebti, and R. Jove. 1998. Stat3 activation by Src induces specific gene regulation and is required for cell transformation. Mol. Cell. Biol. 18:2545-2552.
53. Twamley-Stein, G. M., R. Pepperkok, W. Ansorge, and S. A. Courtneidge. 1993. The Src family tyrosine kinases are required for platelet-derived growth factor-mediated signal transduction in NIH 3T3 cells. Proc. Natl. Acad. Sci. USA 90:7696-7700.
54. Van Aelst, L., and C. D'Souza-Schorey. 1997. Rho GTPases and signaling networks. Genes Dev. 11:2295-2322.
55. Welsh, C. F., K. Roovers, J. Villanueva, Y. Liu, M. A. Schwartz, and R. K. Assoian. 2001. Timing of cyclin D1 expression within G1 phase is controlled by Rho. Nat. Cell Biol. 3:950-957.[CrossRef][Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
