Regulation of the Rapsyn Promoter by Kaiso and {delta}-Catenin

Rapsyn is a synapse-specific protein that is required for clusteringacetylcholine receptors at the neuromuscular junction. Analysisof the rapsyn promoter revealed a consensus site for the transcriptionfactor Kaiso within a region that is mutated in a subset ofpatients with congenital myasthenic syndrome. Kaiso is a POZ-zincfinger family transcription factor which recognizes the specificcore consensus sequence CTGCNA (where N is any nucleotide).Previously, the only known binding partner for Kaiso was thecell adhesion cofactor, p120 catenin. Here we show that ${delta}$ -catenin,a brain-specific member of the p120 catenin subfamily, formsa complex with Kaiso. Antibodies against Kaiso and ${delta}$ -cateninrecognize proteins in the nuclei of C2C12 myocytes and at thepostsynaptic domain of the mouse neuromuscular junction. EndogenousKaiso in C2C12 cells coprecipitates with the rapsyn promoterin vivo as shown by chromatin immunoprecipitation assay. Minimalpromoter assays demonstrated that the rapsyn promoter can beactivated by Kaiso and ${delta}$ -catenin; this activation is apparentlymuscle specific. These results provide the first experimentalevidence that rapsyn is a direct sequence-specific target ofKaiso and ${delta}$ -catenin. We propose a new model of synapse-specifictranscription that involves the interaction of Kaiso, ${delta}$ -catenin,and myogenic transcription factors at the neuromuscular junction.

INTRODUCTION

Top

Introduction

Rapsyn (receptor associated protein of the synapse) is a 43-kDapostsynaptic protein that is essential in the proper functioningof the neuromuscular junction. It is a critical effector ofacetylcholine receptor (AChR) clustering upon neural agrin signaling;no AChR clusters form in muscles of rapsyn-deficient mutantmice even following treatment with agrin (17). Messenger RNAsthat encode rapsyn are highly concentrated in the subsynapticregion of skeletal muscle (28). These results strongly suggestthat there is a mechanism to control rapsyn expression in subsynapticnuclei.

According to one model of synapse-specific transcription, thesix-base-pair element CCGGAA, termed the N box, is requiredfor regulating transcription in subsynaptic nuclei. This motifconfers synapse-specific transcription of AChR ${gamma}$ and AChR ${varepsilon}$ subunits,utrophin, and acetylcholine esterase genes (11, 25). N-box-dependentsynaptic expression is stimulated by agrin and neuregulin, whichtriggers the mitogen-activated protein kinase and Jun N-terminalkinase signaling pathways to ultimately allow activation bythe N-box binding Ets transcription factor, GABP (reviewed inreference 41). However, the level of some synaptic genes, includingrapsyn, was not perturbed in the muscles of mutant mice expressinga skeletal muscle-targeted, general Ets dominant-negative mutant(9). This suggests that rapsyn expression is controlled by amechanism that does not involve the Ets transcription factorand N box and that other synapse-specific mechanisms are likelyto control the expression of rapsyn.

Recent observations of congenital myasthenic syndromes (CMS)that result from genetic defects in endplate-specific presynaptic,synaptic, or postsynaptic proteins revealed the significanceof rapsyn gene regulation. Rapsyn mutations were identifiedin a subset of patients with endplate AChR deficiencies (12,29, 32, 33, 38). Furthermore, two novel E-box mutations in therapsyn promoter region have been recently reported in eightpatients with CMS (33). These results focused our attentionto a specific region of the rapsyn promoter. Sequence analysisof this region revealed two consensus Kaiso binding sites (8).One site partially overlaps with a previously identified E-boxmotif, and interestingly a mutation within this E-box-Kaisosite was identified in a subset of patients with CMS (32, 33).Collectively, these observations implicate Kaiso as a key regulatorof rapsyn transcription.

Kaiso is a ubiquitously expressed new member of the POZ-zincfinger family of transcription factors and was identified asa specific binding partner for p120 catenin (6). Kaiso has beenshown to mediate transcriptional repression at methylated loci(36, 45). In addition, Daniel et al. (8) have shown Kaiso tobe a dual-specificity DNA-binding protein that recognizes theminimal core sequence CTGCNA (where N is any nucleotide) inaddition to the methyl-CpG dinucleotides. However, in electrophoreticmobility shift assays (EMSAs), Kaiso has a higher affinity forthe consensus binding site than for the methyl-CpG sites (8).In addition, Kaiso target gene recognition is apparently regulatedby interactions with members of the p120 catenin subfamily.To support this notion, the interaction of Kaiso with eitherthe sequence-specific binding site or the methyl-CpG sites,as well as Kaiso-mediated transcriptional repression via theKaiso binding site, was indeed inhibited by p120 catenin (8,21).

Notably, the p120 subfamily member ${delta}$ -catenin (or neural plakophilin-relatedarm-repeat protein) is specifically expressed in the nervoussystem (26, 31), where it is thought to partake in neuronalsignaling pathways (20, 22, 26). Since the neuromuscular junctionis a model synapse and since many of the mechanisms that functionat the neuromuscular junction are similar to those in the centralnervous system (CNS), it is feasible that ${delta}$ -catenin also functionsat the neuromuscular junction. The possibility therefore existsthat Kaiso and ${delta}$ -catenin partake in a signaling pathway at theneuromuscular junction.

Here we report that the rapsyn promoter is a transcriptionaltarget of Kaiso and ${delta}$ -catenin in mouse C2C12 myotubes and chickenprimary myotubes. Minimal promoter assays showed that the rapsynpromoter can be activated by Kaiso and ${delta}$ -catenin and that thisactivation is muscle specific. Site-specific mutation of therapsyn promoter, which mimics the mutation found in human CMS,resulted in a significant reduction in Kaiso-mediated activationof the rapsyn promoter. This result may explain the reducedlevels of rapsyn expression at the endplates of CMS patientswho carry this mutation. We demonstrate via the chromatin immunoprecipitation(ChIP) assay that endogenous Kaiso in C2C12 cells binds therapsyn promoter. Furthermore, antibodies to ${delta}$ -catenin and Kaisorecognize proteins at the mouse neuromuscular junction and inthe nuclei of C2C12 myotubes. We also provide the first experimentalevidence that ${delta}$ -catenin, a brain-specific member of the p120catenin subfamily, forms a complex with Kaiso in vivo. Collectively,these results demonstrate that Kaiso, ${delta}$ -catenin, and myogenictranscription factors are components of a novel pathway thatregulates synapse-specific transcription of rapsyn.

MATERIALS AND METHODS

Top

Materials and Methods

Constructs. The human and mouse rapsyn promoter-reporter constructs weregenerated by cloning promoters in the forward orientation intoBglII/HindIII sites of promoterless pGL3 Basic vector (Promega).Both promoters were amplified by PCR from human genomic DNA;appropriate restriction sites were incorporated in the primers.The primer pair to amplify human promoter consists of (forward)5'-CCCAGATCTTAGTGGCAATTAATGTGCATC and (reverse) 5'-CCCAAGCTTGCCCTGTGTCCCACGTGG;the primers for the mouse promoter are (forward) 5'-CCCAGATCTGGGGGAATGGGGTGGAATand (reverse) 5'-CCCAAGCTTATCTCTTTGTAGCGGCCCATC. Three nesteddeletion constructs of human rapsyn promoter were also generatedby PCR by using primers with an incorporated BglII site as follows:5'-CCCAGATCTGGAAGAAGCAGGGCTGGGCG for deletion 1, 5'-CCCAGATCTGACGGGCTGAACCAGCTTTGfor deletion 2, and 5'-CCCAGATCTCTCGCGGGTGGGTGCAGCAGAG for deletion3. Two more deletion constructs were made by using unique KpnIand ApaI restriction sites. All the constructs were verifiedby sequencing. Site-directed mutagenesis was performed withthe QuikChange site-directed mutagenesis kit (Stratagene).

Full-length mouse ${delta}$ -catenin in plasmid pcDNA4/His was kindlysupplied by K. S. Kosik, Harvard Medical School, Boston, Mass.The pcDNA3-Kaiso expression plasmids are as described by Danieland Reynolds (6).

Cell lines and transient transfections. Human embryonic kidney 293T cells and mouse C2C12 myoblastsand myotubes were obtained from the American Type Culture Collection.The 293T cells were cultured in Dulbecco's modified Eagle'smedium (DMEM) with 4.5 g of glucose per liter and 10% heat-inactivatedfetal bovine serum (FBS).

Mouse C2C12 cells were cultured in DMEM supplemented with 10%FBS. Myoblasts were allowed to fuse into multinucleated cellsfor 2 days, and then FBS was replaced with 10% horse serum topromote myotube formation. The myoblasts were transfected atabout 70% of confluence, and luciferase activity was measuredin 48 h.

Chicken myotube cultures were prepared from the hind limb ofWhite Leghorn chicken embryos on day 11 by the method of Fischbach(16) with minor modifications (42). Myotubes were cultured inDMEM supplemented with 10% (vol/vol) horse serum, 2% chickenembryo extract (42), 100 U of penicillin per ml, 100 µgof streptomycin per ml, and 1 mM L-glutamine. Cultures weretreated on day 3 with 10^–5 M cytosine arabinoside for24 h to reduce the number of fibroblasts. Transient transfectionswere performed on 4- to 6-day-old cultures.

All transient transfections are performed by the calcium phosphatemethod as described by Rodova et al. (39). A ß-galactosidaseexpression plasmid is included in each transfection to monitortransfection efficiency. After 48 h the cells are lysed, andactivities are determined by using enzyme assay kits for luciferase(Promega) and ß-galactosidase (Promega). Relativelight units are the luciferase units normalized to ß-galactosidase.All experiments are carried out in triplicate and repeated atleast three times.

Immunoprecipitation and immunoblotting. C2C12 myotubes were scraped in M-PER mammalian protein extractionreagent (Pierce) supplemented with protease inhibitor mixture(Roche Applied Science). Cell lysates were centrifuged (at 15,000x g for 20 min at 4°C), and the resulting clarified supernatantswere collected. For the mouse brain samples, mice were killedand brains removed and rinsed in ice-cold phosphate-bufferedsaline (PBS). The washed brain tissues were homogenized in M-PERwith protease inhibitors and spun at 15,000 x g for 20 min at4°C, and the clarified lysates were used. Immunoprecipitationswere performed with G-protein beads (Pierce) according to themanufacturer's instructions. After being boiled for 5 min, immunoprecipitateswere separated by sodium dodecyl sulfate (SDS)-polyacrylamidegel electrophoresis and electrotransferred onto nitrocellulosemembranes. The detection of individual proteins was carriedout by immunoblotting with anti- ${delta}$ -catenin (C-20; Santa-Cruz)or polyclonal Kaiso (6) antibodies and visualized by enhancedchemiluminescence.

EMSAs. EMSAs were performed as previously described (39). The followingoligonucleotides were synthesized (core consensus Kaiso sitesare italicized): wild-type CTGTCGCTGCCAGTTGGGGCC from humanpromoter at position –45; mutant Kaiso site CTGTCGCTAACAGCTGGGGCC;and wild-type with a mutation of A to G (T to C in reversedstrand) CTGTCGCTGCCAGCTGGGGCC. An aliquot of 10 pM double-strandedoligonucleotides was end labeled with polynucleotide kinase(Promega) and [ ${gamma}$ -³²P]ATP for 45 min at 37°C. The labeledprobe was purified by centrifugation through a Clontech Chroma-spinTE-10 column according to the manufacturer's instructions.

pGEX-Kaiso construct-transformed Escherichia coli DH5 ${alpha}$ cultureswere grown to isolate glutathione transferase (GST) fusion proteinsby using glutathione-Sepharose beads as described by Danielet al. (8). The proteins were subjected to SDS-polyacrylamidegel electrophoresis, followed by Coomassie blue staining tocheck purity and concentration. Protein concentration was determinedby the bicinchoninic acid assay (Pierce). Binding reactionscontaining 50,000 cpm of labeled DNA were incubated for 10 minat room temperature, followed by a 30-min incubation on icewith 300 ng of fusion protein or 5 µg of nuclear extractand 160 ng of poly(dI · dC) in 25 mM HEPES, 100 mM KCl,10 mM MgCl₂, 1 mM dithiothreitol, 1 mM EDTA, 0.1% NP-40, and5% (vol/vol) glycerol. The binding buffer for fusion proteinGST-zinc finger 2 and 3 (GST-ZF2,3) did not contain NP-40. DNA-proteincomplexes were electrophoresed in 4% native polyacrylamide gelsand visualized by autoradiography.

ChIP. ChIP assays were performed as previously described (43). Inbrief, C2C12 murine myoblast cells were washed in PBS solutionand incubated for 1 h with the cross-linking solution containing1% formaldehyde. The cross-linking reaction was then stoppedwith glycine at a concentration of 0.125 M. The cells were washedtwice with cold 1x PBS and harvested into tubes in PBS-phenylmethylsulfonylfluoride. The cells were pelleted at 3,000 to 4,000 rpm at 4°Cfor 5 min and resuspended in cell lysis solution [5 mM piperazine-N,N'-bis(2-ethanesulfonicacid) (PIPES; pH 8), 85 mM KCl, 0.5% NP-40]. Cross-linked materialwas sonicated, and the chromatin was broken into fragments ofan average length of $~$ 500 to 600 bp. The sonicated samples werecentrifuged at 14,000 rpm (Eppendorf) for 10 min at 4°C,and the supernatants were precleared with equilibrated proteinA-Sepharose. Lysates were incubated overnight with 4 µgof each antibody at 4°C. The immune complexes were capturedby rabbit anti-mouse antibody-conjugated protein A-Sepharosebeads and subsequently washed three times in immunoprecipitationwash buffer (100 mM Tris-Cl [pH 8], 500 mM LiCl, 1% NP-40, 1%deoxycholic acid). The antibody-antigen-promoter complexes wereeluted by adding 35 µl of immunoprecipitation elutionbuffer (50 mM NaHCO₃, 1% SDS) to each sample, followed by lightvortexing for 30 min. Each sample was then treated with RNaseA at 67°C for 5 h to remove RNA and to reverse formaldehydecross-links, followed by ethanol precipitation. The precipitatedproducts were treated with proteinase K at 45°C for 2 h,followed by two rounds of phenol-chloroform extraction and ethanolprecipitation. The DNA pellets were resuspended in 10 to 20µl of distilled H₂O, and one-fifth of this volume wasused for PCR analysis. Ten percent input C2C12 genomic DNA (untreatedwith antibody) was used as a positive control in the PCR. Thefollowing primers specific for a region flanking the two Kaisobinding sites within the murine rapsyn promoter were used forPCR: 5'-GCCTTTGACAAGGCTTCCAAAGAGCAT-3' (forward) and 5'-GGCTGGTTCAGCCCCTGTCTGCAGCTG-3'(reverse).

Immunofluorescence and antibodies. The cells prepared for fluorescence staining were grown on 35-mmdishes. They were rinsed twice with PBS and fixed with ice-cold100% methanol for 15 min at –20°C. Immunostainingwas performed as described previously (39). Confocal microscopywas performed with a Zeiss LSM 510 microscope equipped withPlan-Neofluar oil objectives (either 25x, 0.8 numerical aperture,or 40x, 1.3 numerical aperture). The images were obtained byusing 1,024 by 1,024 pixel density, excitation at 488 nm, andemission filter BP 505-550.

Frozen mouse gastrocnemius muscle sections were fixed with 1%paraformaldehyde. The neuromuscular junctions were stained with6 x 10 ^–8 M rhodamine-conjugated ${alpha}$ -bungarotoxin (MolecularProbes) and immunostained with either ${delta}$ -catenin C-20 antibodiesor with affinity-purified rabbit polyclonal antibodies to Kaiso,followed by a fluorescein isothiocyanate (FITC)-conjugated secondaryantibody (Jackson Laboratories). The sections were examinedwith a Zeiss Axioskop photomicroscope equipped with a 63x oilobjective, 1.4 numerical aperture, in antifade medium (80% glycerol,20% 0.5 M phosphate buffer [pH 8.0], and 0.2% N-propyl gallate).Images were captured at room temperature by using an OptronicsMagnifier CCD camera with the Magnifier image acquisition software.The images were processed by using Adobe Photoshop software.

The following antibodies were used: two monoclonal (6F and 11D)and rabbit polyclonal antibodies against Kaiso (described inreference 7), two polyclonal antibodies against ${delta}$ -catenin (K-20and C-20; Santa Cruz), and polyclonal antibodies against p120(m-19; Santa Cruz). Secondary FITC-conjugated anti-rabbit immunoglobulinG (IgG), anti-mouse IgG, and anti-goat IgG were purchased fromJackson Laboratories.

RESULTS

Top

Results

The core rapsyn promoter contains a conserved Kaiso site and a cluster of E boxes. Comparison of the 5' ends of genes of evolutionarily distantorganisms may reveal potential regulatory promoter elementsthat are conserved, implying a functional significance. Figure1A shows a sequence comparison between mouse and human rapsynpromoters, highlighting regions of strong similarity. The transcriptionalstart site was determined by Ohno et al. (33) for the humanrapsyn promoter (Fig. 1A). Sequence analysis revealed the absenceof TATA and CAAT motifs. However, promoter activity can relyon a conserved consensus initiator element which overlaps thetranscription start site (19). An E-box element is defined bythe nucleotides CANNTG and is involved in regulating a numberof muscle-specific genes (44). A cluster of three consensusE boxes is conserved between the mouse and human rapsyn promoters.Interestingly, one of these E boxes overlaps with a consensusbinding site for the newly discovered transcription factor Kaiso,which encodes an N-terminal protein-protein interaction POZdomain and three C-terminal Kruppel-like C₂H₂ zinc fingers (6).DNA-binding analysis of Kaiso revealed that the specific coresequence, CTGCNA, is sufficient for Kaiso-DNA interactions (8).We identified two conservative Kaiso core consensus sites inthe rapsyn promoter (hereafter called Kaiso 1 and Kaiso 2).Kaiso 1 carries a reverse complementary sequence of CTGCNA andpartially overlaps with the second conserved E box at the –36position (Fig. 1A). These conserved Kaiso sites are in closeproximity to the E boxes, which led us to hypothesize that Kaisois involved in rapsyn transcriptional regulation.

View larger version (38K):
[in this window]
[in a new window]
FIG. 1. Rapsyn promoter has high activity in myotubes and contains a conserved cluster of E boxes and Kaiso binding sites. (A) Sequence comparison of the mouse and human promoter regions. The E boxes and Kaiso core sequences are boxed. The location of the major transcription initiation site in the human promoter is indicated by +1. Asterisks mark identical sequences in both mouse and human promoters. Arrows show the starts of nested deletions in the luciferase fusion constructs of the human promoter. A double mutation (GC to TT) was introduced at the Kaiso 1 site in the –372m and –110m constructs and is shown above the Kaiso 1 site in lowercase font. A mutation of A to G was introduced in the –110 construct to make the –110G construct and is shown above the –40 E box. (B) Deletion mapping of the human rapsyn promoter shows its high level of transcriptional activity in primary chicken myotubes. The bars on the left represent deletion constructs that were used as a reporter in the transient transfection assay shown on the right. The histogram on the right shows the mean of triplicate samples ± standard deviations. Each experiment was repeated at least three separate times with similar results. Reporter activity is plotted as relative light units (RLU); relative light units are the luciferase units normalized to ß-galactosidase. The core rapsyn promoter region between positions –17 and –110 maintains a high level of promoter activity in myotubes and contains four E boxes, one of which overlaps with the Kaiso site.

To test rapsyn promoter activity, we first amplified the humanrapsyn promoter from human genomic DNA. Nested deletions weremade and fused with luciferase in the pGL3Basic vector. Thereporters obtained were then tested for promoter activity intransient transfection assays in human embryonic kidney 293Tcells, chicken primary myotubes, and mouse C2C12 myotubes. InHEK 293T cells, all the reporters had negligible promoter activity(data not shown). In contrast, high levels of transcriptionalactivity of all constructs were found in chicken primary myotubes,as shown in Fig. 1B, as well as in mouse C2C12 myotubes (datanot shown). These data indicate a strong muscle-specific componentin rapsyn transcription regulation. The minimal promoter sequencewhich retained a high level of activity was the construct beginningat position –110 (–110 construct), and this constructcontains a cluster of three conserved E boxes and a proximalKaiso binding site. The promoter activity of the –17 constructwas minimal and similar to that of the promoterless GL3 plasmid.These results delineate a core promoter activity in the –110to –17 region of the rapsyn promoter which contains fourE boxes and a conserved Kaiso site.

Activation of the rapsyn promoter by Kaiso and ${delta}$ -catenin. To ascertain whether Kaiso is capable of regulating transcriptionvia the rapsyn promoter, we cotransfected the promoter-reporterconstructs and a Kaiso expression vector. Cotransfection ofthe Kaiso expression vector into primary chicken myotubes resultedin a dramatic increase in the activity of both the –215and the –110 rapsyn promoter-reporter constructs, whileno increase was observed in the –17 construct which lacksany Kaiso consensus binding sites (Fig. 2 A, B, and C). Previously,the only reported Kaiso binding partner was the ubiquitouslyexpressed p120 catenin (6). ${delta}$ -Catenin is a member of the p120catenin subfamily and is enriched in the CNS (18). We demonstratethat ${delta}$ -catenin complexes with Kaiso (see below). To determineif ${delta}$ -catenin is involved in rapsyn transcription regulation,we cotransfected a ${delta}$ -catenin expression construct with our rapsynpromoter-reporter constructs into chicken primary myotubes.Similar to the results obtained for Kaiso, ${delta}$ -catenin inducedrapsyn promoter reporter activity and, like Kaiso, ${delta}$ -cateninhad no effect on the –17 construct that lacks any Kaisobinding sites (Fig. 2A, B, and C). This suggests that the proximalKaiso site which overlaps the E box is functional and is involvedin Kaiso- and ${delta}$ -catenin-mediated activation of the rapsyn promoter.Transfection of primary chicken myotubes with a mouse rapsynpromoter-reporter construct which contained the Kaiso siteswas also activated by cotransfection with Kaiso or ${delta}$ -cateninexpression constructs (Fig. 2D). Similar results were obtainedwith mouse C2C12 myotubes (data not shown). However, we failedto detect any induction when these constructs were cotransfectedinto nonmuscle 293T cells (data not shown). Since myogenic transcriptionfactors are highly expressed in myotubes, these results suggestthe involvement of such factors in Kaiso- and ${delta}$ -catenin-mediatedactivation of the rapsyn promoter.

View larger version (22K):
[in this window]
[in a new window]
FIG. 2. Minimal promoter experiments show that the rapsyn promoter can be induced by Kaiso and ${delta}$ -catenin in primary chicken myotubes. Three micrograms of effector expression plasmid were cotransfected with promoter-reporter constructs; this was replaced by an equal amount of pcDNA3 in the controls. Each bar represents the average of triplicate samples ± standard deviations. Each experiment was repeated at least three separate times with similar results. (A) The –215 construct which contains two Kaiso sites and five E boxes can be induced with the indicated effectors. (B) The –110 construct which contains only one Kaiso site and three conservative E boxes still can be induced with the same effectors. This indicates that the proximal Kaiso site in the –110 construct is functional. (C) There is no induction of the –17 construct which lacks Kaiso and E-box sites. (D) The 1,024-bp mouse rapsyn promoter contains two conserved Kaiso sites and several E boxes. Similar to the human promoter, it can be induced by Kaiso and ${delta}$ -catenin. (E) The Kaiso 1 site at position –36 was mutated (TGGCAG to TGTTAG) in the –372m construct (white bars) and in the –110m construct (gray bars). The E box which overlaps the Kaiso 1 site at position –40 was also mutated (CAACTG to CAGCTG). This is the same mutation of A to G at the –38 position which is reported in patients with myasthenic syndrome (34). Mutation at either location affects Kaiso and ${delta}$ -catenin induction of the rapsyn promoter.

To determine whether the response to Kaiso and ${delta}$ -catenin dependsspecifically on the Kaiso binding site, we tested the activitiesof the constructs beginning at positions –372 and –110and containing a mutation (CTGCCA to CTAACA) in the Kaiso bindingsite (–372m construct and –110m construct, respectively).Constructs that contain this mutation could not be induced byany Kaiso or ${delta}$ -catenin effector plasmids (Fig. 2E). This confirmedthe involvement of the Kaiso binding site in the induction byKaiso and ${delta}$ -catenin. We also tested a construct with a mutationof A to G at position –38 (–38A to G) in the overlappingKaiso-E-box site; this is the same rapsyn promoter mutationreported in a subset of CMS patients (33). This reporter constructwas not induced by Kaiso or ${delta}$ -catenin effector expression (Fig.2E). Altogether, these results support the hypothesis that Kaisoand ${delta}$ -catenin are involved in rapsyn promoter regulation.

Rapsyn-derived promoter sequences bind Kaiso in vitro and in vivo. To determine whether the rapsyn-derived probe harboring theKaiso binding site is capable of binding Kaiso in vitro, weperformed EMSAs with a synthetic rapsyn-derived double-strandedoligonucleotide (CTGTCGCTGCCAGTTGGGGCC). This oligonucleotidecontains the core consensus Kaiso binding motif (italicized).Since Kaiso contains a POZ domain that inhibits but does notabolish DNA binding of POZ-zinc finger transcription factors(3), we used a truncated Kaiso-GST fusion protein containingonly Kaiso's three zinc fingers (GST-ZF1,2,3) (Fig. 3A). Previously,Kaiso zinc fingers 2 and 3 were shown to be necessary and sufficientfor binding to human and murine matrilysin promoter-derivedprobes (8). We therefore also tested GST fusion proteins containingonly Kaiso zinc fingers 2 and 3 (GST-ZF2,3) (Fig. 3B). The rapsyn-derivedprobe was able to form a DNA-protein complex with both proteins,although GST-ZF1,2,3 bound much more efficiently than GST-ZF2,3.Both wild-type rapsyn and matrilysin-derived cold competitors(100-fold excess) out-competed the probe, confirming the specificityof DNA binding. A probe containing a mutation within the Kaisobinding site, previously shown to inhibit Kaiso-DNA binding(8) and shown in this study to be crucial for Kaiso and ${delta}$ -cateninactivation of the rapsyn promoter (Fig. 2E), displayed significantlyreduced binding to GST-ZF1,2,3 and did not bind GST-ZF2,3. Aprobe that contains the mutation –38A to G in the E-boxsite had slightly reduced GST-ZF1,2,3 binding and no bindingto GST-ZF2,3. These results suggest that Kaiso can bind therapsyn promoter and that rapsyn may be a direct Kaiso targetin C2C12 myotubes.

View larger version (44K):
[in this window]
[in a new window]
FIG. 3. Kaiso specifically binds a rapsyn-derived probe with a Kaiso core binding site by EMSA. Radiolabeled CTGTCGCTGCCAGTTGGGGCC oligonucleotide (Kaiso binding motif in italics) was used as a wild-type (wt) probe. The following mutated probes carrying the same mutations that abolish Kaiso induction of the rapsyn promoter in transient transfection assays were also used: CTGTCGCTAACAGTTGGGGCC (mut) and CTGTCGCTGCCAGCTGGGGCC (G) (Kaiso binding motif in italics). A 100-fold excess of wild-type unlabeled oligonucleotide (wt comp) as well as human matrilysin promoter-derived Kaiso binding unlabeled oligonucleotide GTGCTTCCTGCCAATAACG (matr comp; Kaiso binding site in italics) were used as competitors to show specificity of the binding. (A) A total of 30 ng of GST-Kaiso zinc fingers 1, 2, and 3 fusion protein (GST-ZF1,2,3) was incubated with the indicated probes. Wild-type probe and the probe with a mutation of A to G bind GST-ZF1,2,3 fusion protein, whereas the probe with a mutation in the Kaiso site has greatly reduced binding. (B) Thirty nanograms of GST-Kaiso zinc fingers 2 and 3 fusion protein (GST-ZF2,3) was incubated with the indicated probes. The wild-type probe was able to shift the specific band only in the absence of 0.1% NP-40, which is present in the incubation buffer for the binding reactions shown in panel A.

To investigate whether endogenous Kaiso in C2C12 cells bindsto the rapsyn promoter in vivo, we performed a ChIP assay. Rapsyn-specificprimers were designed to amplify a promoter region harboringboth Kaiso binding sites. A rapsyn promoter fragment of $~$ 230bp was successfully amplified by PCR from C2C12 genomic DNA(Fig. 4, Input). PCR analyses with chromatin from Kaiso immunoprecipitatesamplified the $~$ 230-bp rapsyn promoter fragment (Fig. 4, 6F Kaiso),while neither antihemagglutinin (12CA5) immunoprecipitates norKaiso immunoprecipitations lacking input genomic DNA amplifiedthis region (Fig. 4). Taken together, these results demonstratedefinitively that Kaiso interacts with the rapsyn promoter bothin vitro and in vivo.

View larger version (19K):
[in this window]
[in a new window]
FIG. 4. Kaiso binds the rapsyn promoter in vivo. Murine C2C12 genomic DNA was isolated and fragmented by sonication, and endogenous Kaiso was immunoprecipitated by using the 6F monoclonal antibody. A 237-bp fragment of the murine rapsyn promoter was amplified by PCR from Kaiso immunoprecipitates (6F Kaiso), while negligible amounts of rapsyn promoter were amplified from the irrelevant antihemagglutinin antibody immunoprecipitates (12CA5). PCRs from Kaiso immunoprecipitates lacking input chromatin (No Input) or a PCR lacking template (No Template) are presented as controls. Lane 1 (Input) represents the PCR amplification of the rapsyn promoter directly from C2C12 genomic DNA, which was purified from 1/10 of the amount of lysate that was used for each Kaiso immunoprecipitation. IP, immunoprecipitate.

View larger version (129K):
[in this window]
[in a new window]
FIG. 6. Immunohistochemistry of Kaiso and ${delta}$ -catenin in C2C12 cells. Images were obtained by laser-scanning confocal microscopy. (A and C) ${delta}$ -Catenin immunostaining following treatment with 10 ng of LMB per ml for 3 h shows that LMB inhibits nuclear export of ${delta}$ -catenin in C2C12 cells. (B) Nuclear Kaiso immunostaining with 6F monoclonal antibodies. (D) LMB treatment induces the rapsyn promoter transfected into C2C12 cells. C2C12 myoblasts were transfected overnight with the indicated promoter-reporters; the luciferase assay was performed 18 h after transfection. Cells were treated with 10 ng of LMB per ml for 3 h before harvesting. LMB treatment induces rapsyn promoter-reporter (–215 construct), whereas LMB failed to induce the –110m construct with a Kaiso site mutation. However, the –110 construct with the mutation of A to G (–110G) in the overlapping Kaiso site E box still can be induced by LMB. Data are presented as the means of triplicate samples ± standard deviations. Each experiment was repeated at least three separate times with similar results. Scale bar, 20 µm.

Coimmunoprecipitation of Kaiso with antibodies to ${delta}$ -catenin. Our hypothesis that both Kaiso and ${delta}$ -catenin are involved inrapsyn regulation suggests that these proteins may form a complexat the neuromuscular junction. Coimmunoprecipitation experimentswere performed by using whole-cell lysates of C2C12 myotubes.Because ${delta}$ -catenin is specifically expressed in the nervous system(46), mouse brain was also used for immunoprecipitation analysisas a positive control. As shown in the right panel of Fig. 5B,Kaiso was detected in anti- ${delta}$ -catenin immunoprecipitates fromC2C12 myotubes (lane 1) but not in immunoprecipitates of preimmunesera captured with protein A- and protein G-Sepharose, respectively(lanes 3 and 4). The specificity of this experiment was verifiedby probing the same ${delta}$ -catenin immunoprecipitates with irrelevantSp1 antibodies, which yielded no signal (data not shown). Theseresults reveal that Kaiso forms a complex not only with p120catenin, as has been shown by Daniel and Reynolds (6), but alsowith the highly related p120 subfamily member, ${delta}$ -catenin.

View larger version (41K):
[in this window]
[in a new window]
FIG. 5. Kaiso and ${delta}$ -catenin are expressed and form a complex in C2C12 myotubes. (A) Antibodies to ${delta}$ -catenin (C-20; Santa Cruz) recognize a band of approximately 160 kDa in total cell lysate of C2C12 myotubes (left panel). Immunoprecipitations with antibodies to ${delta}$ -catenin (C-20; Santa Cruz) precipitated the same proteins that migrate at 160 kDa from both C2C12 myotubes and mouse brain (right panel). Mouse brain is included in the immunoprecipitation experiment to verify the size of ${delta}$ -catenin (160 kDa); C2C12 lysate (1/50 of the lysate used for immunoprecipitation) represents the input. Thus, the anti- ${delta}$ -catenin antibodies can be used to immunoprecipitate ${delta}$ -catenin from C2C12 myotubes. (B) Polyclonal antibodies to Kaiso recognize a band of approximately 110 kDa in lysate from C2C12 myotubes (left panel). Immunoprecipitation with monoclonal antibodies to Kaiso (6F or 12G) precipitated these same proteins from C2C12 myotubes (lane 2, right panel). In the right panel, lane 1 demonstrates specific coprecipitation of Kaiso by ${delta}$ -catenin antibodies (C20; Santa Cruz) from C2C12 myotube lysates, whereas Kaiso is not precipitated by the preimmune sera in the context of protein G- or protein A-Sepharose (lanes 3 and 4, respectively). This indicates that Kaiso is a binding partner of ${delta}$ -catenin. IP, immunoprecipitate.

Leptomycin B sensitivity of ${delta}$ -catenin in C2C12 myotubes: evidence for nucleocytoplasmic shuttling of ${delta}$ -catenin. To further test our hypothesis that Kaiso and ${delta}$ -catenin regulaterapsyn transcription, we examined the subcellular localizationof these proteins by using immunofluorescence staining of methanol-fixedC2C12 myotubes. While at steady state ${delta}$ -catenin localizes predominantlyto the cytosol, the possibility remained that, like p120 (21), ${delta}$ -catenin shuttles between nuclear and cytoplasmic subcellularcompartments. To test this hypothesis, we utilized a specificinhibitor of CRM-1-mediated nuclear export called leptomycinB (LMB) to assess the nucleocytoplasmic shuttling activity of ${delta}$ -catenin in these cells. Prior to fixation and immunofluorescencestaining, C2C12 cells were treated with 10 ng of LMB per mlfor 3 h. This treatment significantly increased nuclear levelsof ${delta}$ -catenin, indicating that it is subject to nucleocytoplasmicshuttling in C2C12 cells (Fig. 6A and C). In contrast, thistreatment led to the cytoplasmic perinuclear localization ofp120 catenin in these cells (data not shown). Immunofluorescencestaining with Kaiso monoclonal antibodies (Fig. 6B) revealeda diffuse nuclear localization, consistent with previous reports(6). These data suggest that in C2C12 cells, ${delta}$ -catenin, ratherthan p120, undergoes rapid nucleocytoplasmic shuttling.

To ascertain whether the activity of rapsyn promoter-reportersin myoblasts is sensitive to LMB, C2C12 cells were treated with10 ng of LMB per ml for 3 h before harvesting (16 h after transfection)(Fig. 6D). The –215 construct containing two Kaiso bindingsites was induced up to threefold upon the treatment. The –110reporter construct containing a mutation in the core Kaiso bindingsite did not respond to LMB treatment whereas the –110construct with the mutation –38A to G could be induced,although to a lesser extent than the –215 reporter construct.These results imply that rapsyn promoter activity is mediatedby a CRM-1-dependent factor, possibly ${delta}$ -catenin.

Kaiso and ${delta}$ -catenin are present at the neuromuscular junction. Our hypothesis that Kaiso and ${delta}$ -catenin are involved in rapsynpromoter regulation requires both proteins to be present atthe neuromuscular junction. To address this issue we performedimmunohistochemistry of mouse muscle sections with antibodiesto Kaiso and ${delta}$ -catenin, in addition to ${alpha}$ -bungarotoxin, to identifythe location of neuromuscular junctions. Both Kaiso and ${delta}$ -cateninwere localized at the neuromuscular junction (Fig. 7). The identicalpattern of colocalization was observed at the chicken neuromuscularjunction (data not shown). These data are consistent with ourhypothesis of rapsyn promoter regulation at the neuromuscularjunction and suggest a new pathway of synapse-specific transcriptioninvolving the POZ-zinc finger transcription factor Kaiso.

View larger version (47K):
[in this window]
[in a new window]
FIG. 7. Antibodies to Kaiso and ${delta}$ -catenin recognize proteins concentrated at the mouse neuromuscular junction. Confocal micrographs of sections of mouse thigh muscle stained with antibodies to Kaiso (upper left panel) and ${delta}$ -catenin (upper right panel), followed by FITC-conjugated secondary antibodies. The locations of neuromuscular junctions are indicated by the concentrations of rhodamine-conjugated ${alpha}$ -bungarotoxin which binds to the AChR (second row). Combined images of the antibody staining (green) and AChR staining (red) are presented in the bottom row to show the extent of the synaptic localization. Anti- ${delta}$ -catenin and anti-Kaiso staining are found in the region of the muscle directly under the AChRs, but there is also staining that extends beyond the limits of the AChR staining. Scale bar, 20 µm.

To determine whether Kaiso and ${delta}$ -catenin have a postsynapticlocalization that is consistent with such a function, we denervatedmouse gastrocnemius muscle by sciatic nerve resection and comparedtheir localization in innervated and denervated tissue. Twoweeks after nerve resection, postsynaptic AChR clusters stillremained. Kaiso and ${delta}$ -catenin staining persisted after denervationand colocalized with postsynaptic AChR clusters (Fig. 8). Thus,Kaiso and ${delta}$ -catenin at the neuromuscular junction concentratepostsynaptically, consistent with a role in rapsyn regulation.

View larger version (62K):
[in this window]
[in a new window]
FIG. 8. Antibodies to Kaiso and ${delta}$ -catenin recognize molecules in the postsynaptic apparatus of mouse gastrocnemius muscle. Denervation of the muscles was performed by sectioning the sciatic nerve at midthigh 2 weeks previously. Images from denervated muscles are shown in the right column and images from the contralateral innervated muscles are shown in the left column. Neuromuscular junctions are identified by rhodamine-conjugated ${alpha}$ -bungarotoxin. Antibodies to ${delta}$ -catenin (top row) and Kaiso (third row) recognize molecules concentrated at the synaptic regions in both the innervated and denervated muscles. The presence of staining in the denervated muscles reveals that antibodies are recognizing molecules located in the postsynaptic apparatus. Scale bar, 10 µm.

DISCUSSION

Top

Discussion

Here we demonstrate that the rapsyn promoter has functionalKaiso binding sites and that rapsyn promoter activity is regulatedby Kaiso and ${delta}$ -catenin in mouse and chicken myotubes. Immunofluorescenceanalyses verified that Kaiso and ${delta}$ -catenin are concentrated atthe postsynaptic region of mouse and chicken skeletal muscles.Based on these observations, we hypothesize that there is apathway involving Kaiso and ${delta}$ -catenin that regulates synapse-specifictranscription at the neuromuscular junction. Since Kaiso and ${delta}$ -catenin specifically induced the rapsyn promoter in musclecells, and not in nonmuscle 293T cells, we further hypothesizethat myogenic factors are also involved in this pathway. Currentexperiments are directed at determining the exact interactionsof these components both in vitro and in vivo. We have shownthat Kaiso and ${delta}$ -catenin induce rapsyn promoter activity, butwe have yet to show that Kaiso and/or ${delta}$ -catenin are requiredfor rapsyn transcription in vivo. However, our results stronglysupport the existence of a pathway that would explain the synapse-specifictranscription of rapsyn and other synapse-specific proteinsat the neuromuscular junction and also at other synapses throughoutthe body.

The neuromuscular junction has long served as a model synapse(reviewed in reference 40). The fact that we find antibody stainingof Kaiso and ${delta}$ -catenin at the neuromuscular junction is not surprisingsince many proteins found concentrated at synapses in the CNSare also found at the neuromuscular junction. Recently, anothernewly discovered member of the POZ-zinc finger family, myoneurin,has been reported to localize preferentially to subsynapticnuclei at the neuromuscular junction (5). Kaiso is ubiquitouslyexpressed; however, Xenopus Kaiso expression was detected predominantlyin neural tissues (23), providing the first clue that Kaisomay function in neural tissues. The Kaiso binding partner, p120catenin, is also ubiquitously expressed (37). However, the p120family member ${delta}$ -catenin has an expression pattern reported tobe limited to the nervous system (18, 34). The observed colocalizationbetween Kaiso and ${delta}$ -catenin at the neuromuscular junction isconsistent with our hypothesis that the Kaiso and ${delta}$ -catenin interactionis integral in regulating synapse-specific transcription atthe neuromuscular junction and raises the strong possibilitythat these molecules are involved with the regulation of synapse-specifictranscription throughout the nervous system.

${delta}$ -Catenin was discovered in a two-hybrid assay as a bona fideinteractor with presenilin-1 (46), a protein which carries mutationsthat cause familial Alzheimer's disease. Presenilin-1 is expressedin the brain as well as at the postsynaptic domain of the neuromuscularjunction (2). ${delta}$ -Catenin is a potent substrate and forms a stablecomplex with Abl kinase (27). Abl kinase has been found in thepostsynaptic domain of the neuromuscular junction and is a criticalcomponent of the tyrosine kinase signaling cascade downstreamof agrin (15). These results raise the possibility that ${delta}$ -catenincan be phosphorylated by Abl kinase at the neuromuscular junctionand this phosphorylation can modulate its activity. Experimentsdirected at testing this hypothesis are currently under way.

We found Kaiso and ${delta}$ -catenin localized to nuclei of C2C12 myotubes.We additionally demonstrated for the first time that Kaiso eitherdirectly binds or forms an indirect complex with ${delta}$ -catenin. Ourdata show that LMB treatment, which is a specific inhibitorof CRM-1-mediated nuclear export, leads to nuclear ${delta}$ -cateninaccumulation in C2C12 cells. Intriguingly, the rapsyn promoteris induced by LMB treatment in chicken myotubes. This inductionis inhibited by mutations of the Kaiso binding site. Altogether,this supports the hypothesis that nuclearly localized ${delta}$ -cateninis involved in transcriptional regulation in C2C12 myotubesand at the neuromuscular junction.

Mutations in the promoter regions of genes can often lead todisease. The mutation in the N box of the AChR ${varepsilon}$ -subunit promotercauses AChR deficiency at the neuromuscular junction and, consequently,CMS (1, 30, 31). This strongly implies a functional significanceof the N box for transcription regulation of the AChR at theneuromuscular junction (41). Similarly, two point mutationsin the E box of the rapsyn promoter have been reported in asubset of patients with CMS (33). One of these mutations (–38Ato G) is located in the E box that partially overlaps the functionalKaiso binding site that we describe here. However, this mutationdoes not impact the core consensus Kaiso sequence as definedby Daniel et al. (8). In contrast, it changes the nonconserveddinucleotide of the E-box consensus (CANNTG) and does not disruptthe binding of DNA with myogenic factors. Consistent with thisview, Ohno et al. (33) did not find the expected induction byMyoD of the simian virus 40 promoter when fused with severalcopies of this E box or the E box carrying the mutation –38Ato G. In our study, however, this mutation reduces the activationof the rapsyn promoter by Kaiso and ${delta}$ -catenin and implicatesthe influence of bases adjacent to the consensus Kaiso bindingsite. The possibility therefore exists that CMS associated withthis mutation may result from disruption of the Kaiso bindingsite and not the adjacent E box.

Kaiso is a sequence-specific DNA-binding protein, and CTGCNA(where N is any nucleotide) was identified as the core consensussequence (8). Two copies of the optimal consensus were foundin both the human and mouse matrilysin promoters, and Kaisowas shown to demonstrate sequence-specific binding to matrilysin-derivedoligonucleotides (8). These and other data implicate matrilysinas a Kaiso target gene (C. M. Spring, K. F. Kelly, I. O'Kelly,M. Graham, H. C. Crawford, and J. M. Daniel, submitted for publication).While most POZ-zinc finger proteins are transcriptional repressors(10, 14), some are activators (24, 35), and some repress aswell as activate transcription (4, 13). In our system, Kaisobehaves as a transcriptional activator, suggesting that thetranscriptional properties of Kaiso may be context dependent.Consistent with this, Kaiso fails to activate the rapsyn promoter-reporterin nonmuscle human embryonic kidney 293T cells which do notexpress ${delta}$ -catenin or myogenic factors. We hypothesize that thenuclear targeting of ${delta}$ -catenin induces rapsyn transcription inmuscle cells. We speculate that there is a balance between theinducing activity of the E-box-binding myogenic factors andKaiso activity; this balance is likely regulated by ${delta}$ -cateninnuclear trafficking. The mutation –38A to G decreasesthe induction by Kaiso and ${delta}$ -catenin and apparently shifts thebalance between myogenic factors and Kaiso and ${delta}$ -catenin. Thismay cause the reduction or loss of rapsyn protein at the neuromuscularjunction and the consequent endplate AChR deficiency and mayexplain the phenotype observed in CMS patients with a mutationin this region of the rapsyn promoter.

In conclusion, these results strongly suggest that Kaiso and ${delta}$ -catenin are components of a mechanism that regulates synapse-specifictranscription. We therefore propose the following novel modelof synapse-specific transcription: activation of relevant targetgenes, including rapsyn, requires the binding of Kaiso and ${delta}$ -cateninin addition to myogenic transcription factors. Promoter activationis modulated by the expression levels of Kaiso and ${delta}$ -cateninas well as the translocation of ${delta}$ -catenin from the subsynapticcytoplasm to the subsynaptic nuclei. The proposed Kaiso/ ${delta}$ -catenincomplex regulates the affinity of Kaiso-DNA binding and modulatesthe transcriptional activity of Kaiso target genes at synapsesthroughout the body.

ACKNOWLEDGMENTS

We thank K. S. Kosik (Department of Neurology, Harvard MedicalSchool) for the ${delta}$ -catenin expression construct. We also thankDouglas Wright, Robin L. Maser, and Gregory Vanden Heuvel (Universityof Kansas Medical Center) for critical readings of the manuscript.

This work was supported by grants from the NIH (NS33320) toM.J.W. and from CIHR (MOP-42405) to J.M.D.

FOOTNOTES

* Corresponding author. Mailing address: Department of Anatomy and Cell Biology, Mail Stop 3038, University of Kansas Medical Center, 3901 Rainbow Blvd., Kansas City, KS 66160-7421. Phone: (913) 588-7491. Fax: (913) 588-2710. E-mail: mwerle{at}kumc.edu.

REFERENCES

Top