-Catenin
Department of Anatomy and Cell Biology, University of Kansas Medical Center, Kansas City, Kansas 66160,1 Department of Biology, McMaster University, Hamilton, Ontario L8S 4K1, Canada2
Received 26 January 2004/ Returned for modification 21 March 2004/ Accepted 20 May 2004
| ABSTRACT |
|---|
|
|
|---|
-catenin, a brain-specific member of the p120 catenin subfamily, forms a complex with Kaiso. Antibodies against Kaiso and
-catenin recognize proteins in the nuclei of C2C12 myocytes and at the postsynaptic domain of the mouse neuromuscular junction. Endogenous Kaiso in C2C12 cells coprecipitates with the rapsyn promoter in vivo as shown by chromatin immunoprecipitation assay. Minimal promoter assays demonstrated that the rapsyn promoter can be activated by Kaiso and
-catenin; this activation is apparently muscle specific. These results provide the first experimental evidence that rapsyn is a direct sequence-specific target of Kaiso and
-catenin. We propose a new model of synapse-specific transcription that involves the interaction of Kaiso,
-catenin, and myogenic transcription factors at the neuromuscular junction. | INTRODUCTION |
|---|
|
|
|---|
According to one model of synapse-specific transcription, the six-base-pair element CCGGAA, termed the N box, is required for regulating transcription in subsynaptic nuclei. This motif confers synapse-specific transcription of AChR
and AChR
subunits, utrophin, and acetylcholine esterase genes (11, 25). N-box-dependent synaptic expression is stimulated by agrin and neuregulin, which triggers the mitogen-activated protein kinase and Jun N-terminal kinase signaling pathways to ultimately allow activation by the N-box binding Ets transcription factor, GABP (reviewed in reference 41). However, the level of some synaptic genes, including rapsyn, was not perturbed in the muscles of mutant mice expressing a skeletal muscle-targeted, general Ets dominant-negative mutant (9). This suggests that rapsyn expression is controlled by a mechanism that does not involve the Ets transcription factor and N box and that other synapse-specific mechanisms are likely to control the expression of rapsyn.
Recent observations of congenital myasthenic syndromes (CMS) that result from genetic defects in endplate-specific presynaptic, synaptic, or postsynaptic proteins revealed the significance of rapsyn gene regulation. Rapsyn mutations were identified in a subset of patients with endplate AChR deficiencies (12, 29, 32, 33, 38). Furthermore, two novel E-box mutations in the rapsyn promoter region have been recently reported in eight patients with CMS (33). These results focused our attention to a specific region of the rapsyn promoter. Sequence analysis of this region revealed two consensus Kaiso binding sites (8). One site partially overlaps with a previously identified E-box motif, and interestingly a mutation within this E-box-Kaiso site was identified in a subset of patients with CMS (32, 33). Collectively, these observations implicate Kaiso as a key regulator of rapsyn transcription.
Kaiso is a ubiquitously expressed new member of the POZ-zinc finger family of transcription factors and was identified as a specific binding partner for p120 catenin (6). Kaiso has been shown to mediate transcriptional repression at methylated loci (36, 45). In addition, Daniel et al. (8) have shown Kaiso to be a dual-specificity DNA-binding protein that recognizes the minimal core sequence CTGCNA (where N is any nucleotide) in addition to the methyl-CpG dinucleotides. However, in electrophoretic mobility shift assays (EMSAs), Kaiso has a higher affinity for the consensus binding site than for the methyl-CpG sites (8). In addition, Kaiso target gene recognition is apparently regulated by interactions with members of the p120 catenin subfamily. To support this notion, the interaction of Kaiso with either the sequence-specific binding site or the methyl-CpG sites, as well as Kaiso-mediated transcriptional repression via the Kaiso binding site, was indeed inhibited by p120 catenin (8, 21).
Notably, the p120 subfamily member
-catenin (or neural plakophilin-related arm-repeat protein) is specifically expressed in the nervous system (26, 31), where it is thought to partake in neuronal signaling pathways (20, 22, 26). Since the neuromuscular junction is a model synapse and since many of the mechanisms that function at the neuromuscular junction are similar to those in the central nervous system (CNS), it is feasible that
-catenin also functions at the neuromuscular junction. The possibility therefore exists that Kaiso and
-catenin partake in a signaling pathway at the neuromuscular junction.
Here we report that the rapsyn promoter is a transcriptional target of Kaiso and
-catenin in mouse C2C12 myotubes and chicken primary myotubes. Minimal promoter assays showed that the rapsyn promoter can be activated by Kaiso and
-catenin and that this activation is muscle specific. Site-specific mutation of the rapsyn promoter, which mimics the mutation found in human CMS, resulted in a significant reduction in Kaiso-mediated activation of the rapsyn promoter. This result may explain the reduced levels of rapsyn expression at the endplates of CMS patients who carry this mutation. We demonstrate via the chromatin immunoprecipitation (ChIP) assay that endogenous Kaiso in C2C12 cells binds the rapsyn promoter. Furthermore, antibodies to
-catenin and Kaiso recognize proteins at the mouse neuromuscular junction and in the nuclei of C2C12 myotubes. We also provide the first experimental evidence that
-catenin, a brain-specific member of the p120 catenin subfamily, forms a complex with Kaiso in vivo. Collectively, these results demonstrate that Kaiso,
-catenin, and myogenic transcription factors are components of a novel pathway that regulates synapse-specific transcription of rapsyn.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Full-length mouse
-catenin in plasmid pcDNA4/His was kindly supplied by K. S. Kosik, Harvard Medical School, Boston, Mass. The pcDNA3-Kaiso expression plasmids are as described by Daniel and Reynolds (6).
Cell lines and transient transfections. Human embryonic kidney 293T cells and mouse C2C12 myoblasts and myotubes were obtained from the American Type Culture Collection. The 293T cells were cultured in Dulbecco's modified Eagle's medium (DMEM) with 4.5 g of glucose per liter and 10% heat-inactivated fetal bovine serum (FBS).
Mouse C2C12 cells were cultured in DMEM supplemented with 10% FBS. Myoblasts were allowed to fuse into multinucleated cells for 2 days, and then FBS was replaced with 10% horse serum to promote myotube formation. The myoblasts were transfected at about 70% of confluence, and luciferase activity was measured in 48 h.
Chicken myotube cultures were prepared from the hind limb of White Leghorn chicken embryos on day 11 by the method of Fischbach (16) with minor modifications (42). Myotubes were cultured in DMEM supplemented with 10% (vol/vol) horse serum, 2% chicken embryo extract (42), 100 U of penicillin per ml, 100 µg of streptomycin per ml, and 1 mM L-glutamine. Cultures were treated on day 3 with 105 M cytosine arabinoside for 24 h to reduce the number of fibroblasts. Transient transfections were performed on 4- to 6-day-old cultures.
All transient transfections are performed by the calcium phosphate method as described by Rodova et al. (39). A ß-galactosidase expression plasmid is included in each transfection to monitor transfection efficiency. After 48 h the cells are lysed, and activities are determined by using enzyme assay kits for luciferase (Promega) and ß-galactosidase (Promega). Relative light units are the luciferase units normalized to ß-galactosidase. All experiments are carried out in triplicate and repeated at least three times.
Immunoprecipitation and immunoblotting.
C2C12 myotubes were scraped in M-PER mammalian protein extraction reagent (Pierce) supplemented with protease inhibitor mixture (Roche Applied Science). Cell lysates were centrifuged (at 15,000 x g for 20 min at 4°C), and the resulting clarified supernatants were collected. For the mouse brain samples, mice were killed and brains removed and rinsed in ice-cold phosphate-buffered saline (PBS). The washed brain tissues were homogenized in M-PER with protease inhibitors and spun at 15,000 x g for 20 min at 4°C, and the clarified lysates were used. Immunoprecipitations were performed with G-protein beads (Pierce) according to the manufacturer's instructions. After being boiled for 5 min, immunoprecipitates were separated by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis and electrotransferred onto nitrocellulose membranes. The detection of individual proteins was carried out by immunoblotting with anti-
-catenin (C-20; Santa-Cruz) or polyclonal Kaiso (6) antibodies and visualized by enhanced chemiluminescence.
EMSAs.
EMSAs were performed as previously described (39). The following oligonucleotides were synthesized (core consensus Kaiso sites are italicized): wild-type CTGTCGCTGCCAGTTGGGGCC from human promoter at position 45; mutant Kaiso site CTGTCGCTAACAGCTGGGGCC; and wild-type with a mutation of A to G (T to C in reversed strand) CTGTCGCTGCCAGCTGGGGCC. An aliquot of 10 pM double-stranded oligonucleotides was end labeled with polynucleotide kinase (Promega) and [
-32P]ATP for 45 min at 37°C. The labeled probe was purified by centrifugation through a Clontech Chroma-spin TE-10 column according to the manufacturer's instructions.
pGEX-Kaiso construct-transformed Escherichia coli DH5
cultures were grown to isolate glutathione transferase (GST) fusion proteins by using glutathione-Sepharose beads as described by Daniel et al. (8). The proteins were subjected to SDS-polyacrylamide gel electrophoresis, followed by Coomassie blue staining to check purity and concentration. Protein concentration was determined by the bicinchoninic acid assay (Pierce). Binding reactions containing 50,000 cpm of labeled DNA were incubated for 10 min at room temperature, followed by a 30-min incubation on ice with 300 ng of fusion protein or 5 µg of nuclear extract and 160 ng of poly(dI · dC) in 25 mM HEPES, 100 mM KCl, 10 mM MgCl2, 1 mM dithiothreitol, 1 mM EDTA, 0.1% NP-40, and 5% (vol/vol) glycerol. The binding buffer for fusion protein GST-zinc finger 2 and 3 (GST-ZF2,3) did not contain NP-40. DNA-protein complexes were electrophoresed in 4% native polyacrylamide gels and visualized by autoradiography.
ChIP.
ChIP assays were performed as previously described (43). In brief, C2C12 murine myoblast cells were washed in PBS solution and incubated for 1 h with the cross-linking solution containing 1% formaldehyde. The cross-linking reaction was then stopped with glycine at a concentration of 0.125 M. The cells were washed twice with cold 1x PBS and harvested into tubes in PBS-phenylmethylsulfonyl fluoride. The cells were pelleted at 3,000 to 4,000 rpm at 4°C for 5 min and resuspended in cell lysis solution [5 mM piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES; pH 8), 85 mM KCl, 0.5% NP-40]. Cross-linked material was sonicated, and the chromatin was broken into fragments of an average length of
500 to 600 bp. The sonicated samples were centrifuged at 14,000 rpm (Eppendorf) for 10 min at 4°C, and the supernatants were precleared with equilibrated protein A-Sepharose. Lysates were incubated overnight with 4 µg of each antibody at 4°C. The immune complexes were captured by rabbit anti-mouse antibody-conjugated protein A-Sepharose beads and subsequently washed three times in immunoprecipitation wash buffer (100 mM Tris-Cl [pH 8], 500 mM LiCl, 1% NP-40, 1% deoxycholic acid). The antibody-antigen-promoter complexes were eluted by adding 35 µl of immunoprecipitation elution buffer (50 mM NaHCO3, 1% SDS) to each sample, followed by light vortexing for 30 min. Each sample was then treated with RNase A at 67°C for 5 h to remove RNA and to reverse formaldehyde cross-links, followed by ethanol precipitation. The precipitated products were treated with proteinase K at 45°C for 2 h, followed by two rounds of phenol-chloroform extraction and ethanol precipitation. The DNA pellets were resuspended in 10 to 20 µl of distilled H2O, and one-fifth of this volume was used for PCR analysis. Ten percent input C2C12 genomic DNA (untreated with antibody) was used as a positive control in the PCR. The following primers specific for a region flanking the two Kaiso binding sites within the murine rapsyn promoter were used for PCR: 5'-GCCTTTGACAAGGCTTCCAAAGAGCAT-3' (forward) and 5'-GGCTGGTTCAGCCCCTGTCTGCAGCTG-3' (reverse).
Immunofluorescence and antibodies. The cells prepared for fluorescence staining were grown on 35-mm dishes. They were rinsed twice with PBS and fixed with ice-cold 100% methanol for 15 min at 20°C. Immunostaining was performed as described previously (39). Confocal microscopy was performed with a Zeiss LSM 510 microscope equipped with Plan-Neofluar oil objectives (either 25x, 0.8 numerical aperture, or 40x, 1.3 numerical aperture). The images were obtained by using 1,024 by 1,024 pixel density, excitation at 488 nm, and emission filter BP 505-550.
Frozen mouse gastrocnemius muscle sections were fixed with 1% paraformaldehyde. The neuromuscular junctions were stained with 6 x 10 8 M rhodamine-conjugated
-bungarotoxin (Molecular Probes) and immunostained with either
-catenin C-20 antibodies or with affinity-purified rabbit polyclonal antibodies to Kaiso, followed by a fluorescein isothiocyanate (FITC)-conjugated secondary antibody (Jackson Laboratories). The sections were examined with a Zeiss Axioskop photomicroscope equipped with a 63x oil objective, 1.4 numerical aperture, in antifade medium (80% glycerol, 20% 0.5 M phosphate buffer [pH 8.0], and 0.2% N-propyl gallate). Images were captured at room temperature by using an Optronics Magnifier CCD camera with the Magnifier image acquisition software. The images were processed by using Adobe Photoshop software.
The following antibodies were used: two monoclonal (6F and 11D) and rabbit polyclonal antibodies against Kaiso (described in reference 7), two polyclonal antibodies against
-catenin (K-20 and C-20; Santa Cruz), and polyclonal antibodies against p120 (m-19; Santa Cruz). Secondary FITC-conjugated anti-rabbit immunoglobulin G (IgG), anti-mouse IgG, and anti-goat IgG were purchased from Jackson Laboratories.
| RESULTS |
|---|
|
|
|---|
|
Activation of the rapsyn promoter by Kaiso and
-catenin.
To ascertain whether Kaiso is capable of regulating transcription via the rapsyn promoter, we cotransfected the promoter-reporter constructs and a Kaiso expression vector. Cotransfection of the Kaiso expression vector into primary chicken myotubes resulted in a dramatic increase in the activity of both the 215 and the 110 rapsyn promoter-reporter constructs, while no increase was observed in the 17 construct which lacks any Kaiso consensus binding sites (Fig. 2 A, B, and C). Previously, the only reported Kaiso binding partner was the ubiquitously expressed p120 catenin (6).
-Catenin is a member of the p120 catenin subfamily and is enriched in the CNS (18). We demonstrate that
-catenin complexes with Kaiso (see below). To determine if
-catenin is involved in rapsyn transcription regulation, we cotransfected a
-catenin expression construct with our rapsyn promoter-reporter constructs into chicken primary myotubes. Similar to the results obtained for Kaiso,
-catenin induced rapsyn promoter reporter activity and, like Kaiso,
-catenin had no effect on the 17 construct that lacks any Kaiso binding sites (Fig. 2A, B, and C). This suggests that the proximal Kaiso site which overlaps the E box is functional and is involved in Kaiso- and
-catenin-mediated activation of the rapsyn promoter. Transfection of primary chicken myotubes with a mouse rapsyn promoter-reporter construct which contained the Kaiso sites was also activated by cotransfection with Kaiso or
-catenin expression constructs (Fig. 2D). Similar results were obtained with mouse C2C12 myotubes (data not shown). However, we failed to detect any induction when these constructs were cotransfected into nonmuscle 293T cells (data not shown). Since myogenic transcription factors are highly expressed in myotubes, these results suggest the involvement of such factors in Kaiso- and
-catenin-mediated activation of the rapsyn promoter.
|
-catenin depends specifically on the Kaiso binding site, we tested the activities of the constructs beginning at positions 372 and 110 and containing a mutation (CTGCCA to CTAACA) in the Kaiso binding site (372m construct and 110m construct, respectively). Constructs that contain this mutation could not be induced by any Kaiso or
-catenin effector plasmids (Fig. 2E). This confirmed the involvement of the Kaiso binding site in the induction by Kaiso and
-catenin. We also tested a construct with a mutation of A to G at position 38 (38A to G) in the overlapping Kaiso-E-box site; this is the same rapsyn promoter mutation reported in a subset of CMS patients (33). This reporter construct was not induced by Kaiso or
-catenin effector expression (Fig. 2E). Altogether, these results support the hypothesis that Kaiso and
-catenin are involved in rapsyn promoter regulation.
Rapsyn-derived promoter sequences bind Kaiso in vitro and in vivo.
To determine whether the rapsyn-derived probe harboring the Kaiso binding site is capable of binding Kaiso in vitro, we performed EMSAs with a synthetic rapsyn-derived double-stranded oligonucleotide (CTGTCGCTGCCAGTTGGGGCC). This oligonucleotide contains the core consensus Kaiso binding motif (italicized). Since Kaiso contains a POZ domain that inhibits but does not abolish DNA binding of POZ-zinc finger transcription factors (3), we used a truncated Kaiso-GST fusion protein containing only Kaiso's three zinc fingers (GST-ZF1,2,3) (Fig. 3A). Previously, Kaiso zinc fingers 2 and 3 were shown to be necessary and sufficient for binding to human and murine matrilysin promoter-derived probes (8). We therefore also tested GST fusion proteins containing only Kaiso zinc fingers 2 and 3 (GST-ZF2,3) (Fig. 3B). The rapsyn-derived probe was able to form a DNA-protein complex with both proteins, although GST-ZF1,2,3 bound much more efficiently than GST-ZF2,3. Both wild-type rapsyn and matrilysin-derived cold competitors (100-fold excess) out-competed the probe, confirming the specificity of DNA binding. A probe containing a mutation within the Kaiso binding site, previously shown to inhibit Kaiso-DNA binding (8) and shown in this study to be crucial for Kaiso and
-catenin activation of the rapsyn promoter (Fig. 2E), displayed significantly reduced binding to GST-ZF1,2,3 and did not bind GST-ZF2,3. A probe that contains the mutation 38A to G in the E-box site had slightly reduced GST-ZF1,2,3 binding and no binding to GST-ZF2,3. These results suggest that Kaiso can bind the rapsyn promoter and that rapsyn may be a direct Kaiso target in C2C12 myotubes.
|
230 bp was successfully amplified by PCR from C2C12 genomic DNA (Fig. 4, Input). PCR analyses with chromatin from Kaiso immunoprecipitates amplified the
230-bp rapsyn promoter fragment (Fig. 4, 6F Kaiso), while neither antihemagglutinin (12CA5) immunoprecipitates nor Kaiso immunoprecipitations lacking input genomic DNA amplified this region (Fig. 4). Taken together, these results demonstrate definitively that Kaiso interacts with the rapsyn promoter both in vitro and in vivo.
|
|
-catenin.
Our hypothesis that both Kaiso and
-catenin are involved in rapsyn regulation suggests that these proteins may form a complex at the neuromuscular junction. Coimmunoprecipitation experiments were performed by using whole-cell lysates of C2C12 myotubes. Because
-catenin is specifically expressed in the nervous system (46), mouse brain was also used for immunoprecipitation analysis as a positive control. As shown in the right panel of Fig. 5B, Kaiso was detected in anti-
-catenin immunoprecipitates from C2C12 myotubes (lane 1) but not in immunoprecipitates of preimmune sera captured with protein A- and protein G-Sepharose, respectively (lanes 3 and 4). The specificity of this experiment was verified by probing the same
-catenin immunoprecipitates with irrelevant Sp1 antibodies, which yielded no signal (data not shown). These results reveal that Kaiso forms a complex not only with p120 catenin, as has been shown by Daniel and Reynolds (6), but also with the highly related p120 subfamily member,
-catenin.
|
-catenin in C2C12 myotubes: evidence for nucleocytoplasmic shuttling of
-catenin.
To further test our hypothesis that Kaiso and
-catenin regulate rapsyn transcription, we examined the subcellular localization of these proteins by using immunofluorescence staining of methanol-fixed C2C12 myotubes. While at steady state
-catenin localizes predominantly to the cytosol, the possibility remained that, like p120 (21),
-catenin shuttles between nuclear and cytoplasmic subcellular compartments. To test this hypothesis, we utilized a specific inhibitor of CRM-1-mediated nuclear export called leptomycin B (LMB) to assess the nucleocytoplasmic shuttling activity of
-catenin in these cells. Prior to fixation and immunofluorescence staining, C2C12 cells were treated with 10 ng of LMB per ml for 3 h. This treatment significantly increased nuclear levels of
-catenin, indicating that it is subject to nucleocytoplasmic shuttling in C2C12 cells (Fig. 6A and C). In contrast, this treatment led to the cytoplasmic perinuclear localization of p120 catenin in these cells (data not shown). Immunofluorescence staining with Kaiso monoclonal antibodies (Fig. 6B) revealed a diffuse nuclear localization, consistent with previous reports (6). These data suggest that in C2C12 cells,
-catenin, rather than p120, undergoes rapid nucleocytoplasmic shuttling.
To ascertain whether the activity of rapsyn promoter-reporters in myoblasts is sensitive to LMB, C2C12 cells were treated with 10 ng of LMB per ml for 3 h before harvesting (16 h after transfection) (Fig. 6D). The 215 construct containing two Kaiso binding sites was induced up to threefold upon the treatment. The 110 reporter construct containing a mutation in the core Kaiso binding site did not respond to LMB treatment whereas the 110 construct with the mutation 38A to G could be induced, although to a lesser extent than the 215 reporter construct. These results imply that rapsyn promoter activity is mediated by a CRM-1-dependent factor, possibly
-catenin.
Kaiso and
-catenin are present at the neuromuscular junction.
Our hypothesis that Kaiso and
-catenin are involved in rapsyn promoter regulation requires both proteins to be present at the neuromuscular junction. To address this issue we performed immunohistochemistry of mouse muscle sections with antibodies to Kaiso and
-catenin, in addition to
-bungarotoxin, to identify the location of neuromuscular junctions. Both Kaiso and
-catenin were localized at the neuromuscular junction (Fig. 7). The identical pattern of colocalization was observed at the chicken neuromuscular junction (data not shown). These data are consistent with our hypothesis of rapsyn promoter regulation at the neuromuscular junction and suggest a new pathway of synapse-specific transcription involving the POZ-zinc finger transcription factor Kaiso.
|
-catenin have a postsynaptic localization that is consistent with such a function, we denervated mouse gastrocnemius muscle by sciatic nerve resection and compared their localization in innervated and denervated tissue. Two weeks after nerve resection, postsynaptic AChR clusters still remained. Kaiso and
-catenin staining persisted after denervation and colocalized with postsynaptic AChR clusters (Fig. 8). Thus, Kaiso and
-catenin at the neuromuscular junction concentrate postsynaptically, consistent with a role in rapsyn regulation.
|
| DISCUSSION |
|---|
|
|
|---|
-catenin in mouse and chicken myotubes. Immunofluorescence analyses verified that Kaiso and
-catenin are concentrated at the postsynaptic region of mouse and chicken skeletal muscles. Based on these observations, we hypothesize that there is a pathway involving Kaiso and
-catenin that regulates synapse-specific transcription at the neuromuscular junction. Since Kaiso and
-catenin specifically induced the rapsyn promoter in muscle cells, and not in nonmuscle 293T cells, we further hypothesize that myogenic factors are also involved in this pathway. Current experiments are directed at determining the exact interactions of these components both in vitro and in vivo. We have shown that Kaiso and
-catenin induce rapsyn promoter activity, but we have yet to show that Kaiso and/or
-catenin are required for rapsyn transcription in vivo. However, our results strongly support the existence of a pathway that would explain the synapse-specific transcription of rapsyn and other synapse-specific proteins at the neuromuscular junction and also at other synapses throughout the body.
The neuromuscular junction has long served as a model synapse (reviewed in reference 40). The fact that we find antibody staining of Kaiso and
-catenin at the neuromuscular junction is not surprising since many proteins found concentrated at synapses in the CNS are also found at the neuromuscular junction. Recently, another newly discovered member of the POZ-zinc finger family, myoneurin, has been reported to localize preferentially to subsynaptic nuclei at the neuromuscular junction (5). Kaiso is ubiquitously expressed; however, Xenopus Kaiso expression was detected predominantly in neural tissues (23), providing the first clue that Kaiso may function in neural tissues. The Kaiso binding partner, p120 catenin, is also ubiquitously expressed (37). However, the p120 family member
-catenin has an expression pattern reported to be limited to the nervous system (18, 34). The observed colocalization between Kaiso and
-catenin at the neuromuscular junction is consistent with our hypothesis that the Kaiso and
-catenin interaction is integral in regulating synapse-specific transcription at the neuromuscular junction and raises the strong possibility that these molecules are involved with the regulation of synapse-specific transcription throughout the nervous system.
-Catenin was discovered in a two-hybrid assay as a bona fide interactor with presenilin-1 (46), a protein which carries mutations that cause familial Alzheimer's disease. Presenilin-1 is expressed in the brain as well as at the postsynaptic domain of the neuromuscular junction (2).
-Catenin is a potent substrate and forms a stable complex with Abl kinase (27). Abl kinase has been found in the postsynaptic domain of the neuromuscular junction and is a critical component of the tyrosine kinase signaling cascade downstream of agrin (15). These results raise the possibility that
-catenin can be phosphorylated by Abl kinase at the neuromuscular junction and this phosphorylation can modulate its activity. Experiments directed at testing this hypothesis are currently under way.
We found Kaiso and
-catenin localized to nuclei of C2C12 myotubes. We additionally demonstrated for the first time that Kaiso either directly binds or forms an indirect complex with
-catenin. Our data show that LMB treatment, which is a specific inhibitor of CRM-1-mediated nuclear export, leads to nuclear
-catenin accumulation in C2C12 cells. Intriguingly, the rapsyn promoter is induced by LMB treatment in chicken myotubes. This induction is inhibited by mutations of the Kaiso binding site. Altogether, this supports the hypothesis that nuclearly localized
-catenin is involved in transcriptional regulation in C2C12 myotubes and at the neuromuscular junction.
Mutations in the promoter regions of genes can often lead to disease. The mutation in the N box of the AChR
-subunit promoter causes AChR deficiency at the neuromuscular junction and, consequently, CMS (1, 30, 31). This strongly implies a functional significance of the N box for transcription regulation of the AChR at the neuromuscular junction (41). Similarly, two point mutations in the E box of the rapsyn promoter have been reported in a subset of patients with CMS (33). One of these mutations (38A to G) is located in the E box that partially overlaps the functional Kaiso binding site that we describe here. However, this mutation does not impact the core consensus Kaiso sequence as defined by Daniel et al. (8). In contrast, it changes the nonconserved dinucleotide of the E-box consensus (CANNTG) and does not disrupt the binding of DNA with myogenic factors. Consistent with this view, Ohno et al. (33) did not find the expected induction by MyoD of the simian virus 40 promoter when fused with several copies of this E box or the E box carrying the mutation 38A to G. In our study, however, this mutation reduces the activation of the rapsyn promoter by Kaiso and
-catenin and implicates the influence of bases adjacent to the consensus Kaiso binding site. The possibility therefore exists that CMS associated with this mutation may result from disruption of the Kaiso binding site and not the adjacent E box.
Kaiso is a sequence-specific DNA-binding protein, and CTGCNA (where N is any nucleotide) was identified as the core consensus sequence (8). Two copies of the optimal consensus were found in both the human and mouse matrilysin promoters, and Kaiso was shown to demonstrate sequence-specific binding to matrilysin-derived oligonucleotides (8). These and other data implicate matrilysin as a Kaiso target gene (C. M. Spring, K. F. Kelly, I. O'Kelly, M. Graham, H. C. Crawford, and J. M. Daniel, submitted for publication). While most POZ-zinc finger proteins are transcriptional repressors (10, 14), some are activators (24, 35), and some repress as well as activate transcription (4, 13). In our system, Kaiso behaves as a transcriptional activator, suggesting that the transcriptional properties of Kaiso may be context dependent. Consistent with this, Kaiso fails to activate the rapsyn promoter-reporter in nonmuscle human embryonic kidney 293T cells which do not express
-catenin or myogenic factors. We hypothesize that the nuclear targeting of
-catenin induces rapsyn transcription in muscle cells. We speculate that there is a balance between the inducing activity of the E-box-binding myogenic factors and Kaiso activity; this balance is likely regulated by
-catenin nuclear trafficking. The mutation 38A to G decreases the induction by Kaiso and
-catenin and apparently shifts the balance between myogenic factors and Kaiso and
-catenin. This may cause the reduction or loss of rapsyn protein at the neuromuscular junction and the consequent endplate AChR deficiency and may explain the phenotype observed in CMS patients with a mutation in this region of the rapsyn promoter.
In conclusion, these results strongly suggest that Kaiso and
-catenin are components of a mechanism that regulates synapse-specific transcription. We therefore propose the following novel model of synapse-specific transcription: activation of relevant target genes, including rapsyn, requires the binding of Kaiso and
-catenin in addition to myogenic transcription factors. Promoter activation is modulated by the expression levels of Kaiso and
-catenin as well as the translocation of
-catenin from the subsynaptic cytoplasm to the subsynaptic nuclei. The proposed Kaiso/
-catenin complex regulates the affinity of Kaiso-DNA binding and modulates the transcriptional activity of Kaiso target genes at synapses throughout the body.
| ACKNOWLEDGMENTS |
|---|
-catenin expression construct. We also thank Douglas Wright, Robin L. Maser, and Gregory Vanden Heuvel (University of Kansas Medical Center) for critical readings of the manuscript. This work was supported by grants from the NIH (NS33320) to M.J.W. and from CIHR (MOP-42405) to J.M.D.
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
2. Askanas, V., W. K. Engel, C. C. Yang, R. B. Alvarez, V. M. Lee, and T. Wisniewski. 1998. Light and electron microscopic immunolocalization of presenilin 1 in abnormal muscle fibers of patients with sporadic inclusion-body myositis and autosomal-recessive inclusion-body myopathy. Am. J. Pathol. 152:889-895.[Abstract]
3. Bardwell, V. J., and R. Treisman. 1994. The POZ domain: a conserved protein-protein interaction motif. Genes Dev. 8:1664-1677.
4. Bereshchenko, O. R., W. Gu, and R. Dalla-Favera. 2002. Acetylation inactivates the transcriptional repressor BCL6. Nat. Genet. 32:606-613.[CrossRef][Medline]
5. Cifuentes-Diaz, C., M. Bitoun, D. Goudou, N. Seddiqi, N. Romero, F. Rieger, J. P. Perin, and P. M. Alliel. 2004. Neuromuscular expression of the BTB/POZ and zinc finger protein myoneurin. Muscle Nerve 29:59-65.[CrossRef][Medline]
6. Daniel, J. M., and A. B. Reynolds. 1999. The catenin p120ctn interacts with Kaiso, a novel BTB/POZ domain zinc finger transcription factor. Mol. Cell. Biol. 19:3614-3623.
7. Daniel, J. M., R. C. Ireton, and A. B. Reynolds. 2001. Monoclonal antibodies to Kaiso: a novel transcription factor and p120ctn-binding protein. Hybridoma 20:159-166.[CrossRef][Medline]
8. Daniel, J. M., C. M. Spring, H. C. Crawford, A. B. Reynolds, and A. Baig. 2002. The p120(ctn)-binding partner Kaiso is a bi-modal DNA-binding protein that recognizes both a sequence-specific consensus and methylated CpG dinucleotides. Nucleic Acids Res. 30:2911-2919.
9. de Kerchove D'Exaerde, A., J. R. Cartaud, and L. Schaeffer. 2002. Expression of mutant Ets protein at the neuromuscular synapse causes alterations in morphology and gene expression. EMBO Rep. 3:1075-1081. (First published 22 October 2002; 10.1093/embo-reports/kvf220.)[CrossRef][Medline]
10. Deltour, S., S. Pinte, C. Guerardel, B.Wasylyk, and D. Leprince. 2002. The human candidate tumor suppressor gene HIC1 recruits CtBP through a degenerate GLDLSKK motif. Mol. Cell. Biol. 22:4890-4901.
11. Duclert, A., N. Savatier, L. Schaeffer, and J. P. Changeux. 1996. Identification of an element crucial for the sub-synaptic expression of the acetylcholine receptor epsilon-subunit gene. J. Biol. Chem. 271:17433-17438.
12. Dunne, V., and R. A. Maselli. 2003. Identification of pathogenic mutations in the human rapsyn gene. J. Hum. Genet. 48:204-207.[CrossRef][Medline]
13. Faucheux, M., J. Y. Roignant, S. Netter, J. Charollais, C. Antoniewski, and L. Theodore. 2003. batman interacts with Polycomb and trithorax group genes and encodes a BTB/POZ protein that is included in a complex containing GAGA factor. Mol. Cell. Biol. 23:1181-1195.
14. Fedele, M., G. Benvenuto, R. Pero, B. Majello, S. Battista, F. Lembo, E. Vollono, P. M. Day, M. Santoro, L. Lania, C. B. Bruni, A. Fusco, and L. Chiariotti. 2000. A novel member of the BTB/POZ family, PATZ, associates with the RNF4 RING finger protein and acts as a transcriptional repressor. J. Biol. Chem. 275:7894-7901.
15. Finn, A. J., G. Feng, and A. M. Pendergast. 2003. Postsynaptic requirement for Abl kinases in assembly of the neuromuscular junction. Nat. Neurosci. 6:717-723.[CrossRef][Medline]
16. Fischbach, G. D. 1972. Synapse formation between dissociated nerve and muscle cells in low density cell cultures. Dev. Biol. 28:407-429.[CrossRef][Medline]
17. Gautam, M., P. G. Noakes, J. Mudd, M. Nichol, G. C. Chu, J. R. Sanes, and J. P. Merlie. 1995. Failure of postsynaptic specialization to develop at neuromuscular junctions of rapsyn-deficient mice. Nature 377:232-236.[CrossRef][Medline]
18. Ho, C., J. Zhou, M. Medina, T. Goto, M. Jacobson, P. G. Bhide, and K. S. Kosik. 2000.
-Catenin is a nervous system-specific adherens junction protein which undergoes dynamic relocalization during development. J. Comp. Neurol. 420:261-276.[CrossRef][Medline]
19. Javahery, R., A. Khachi, K. Lo, B. Zenzie-Gregory, and S. T. Smale. 1994. DNA sequence requirements for transcriptional initiator activity in mammalian cells. Mol. Cell. Biol. 14:116-127.
20. Jones, S. B., G. W. Lanford, Y. H. Chen, M. Moribito, K. Kim, and Q. Lu. 2002. Glutamate-induced delta-catenin redistribution and dissociation from postsynaptic receptor complexes. Neuroscience 115:1009-1021.[CrossRef][Medline]
21. Kelly, K. F., C. M. Spring, A. A. Otchere, and J. M. Daniel. 2004. NLS-dependant nuclear localization of p120 ctn is necessary to relieve Kaiso-mediated transcriptional repression. J. Cell Sci. 117:2675-2686.
22. Kim, K., A. Sirota, Y. H. Chen, S. B. Jones, R. Dudek, G. W. Lanford, C. Thakore, and Q. Lu. 2002. Dendrite-like process formation and cytoskeletal remodeling regulated by delta-catenin expression. Exp. Cell Res. 275:171-184.[CrossRef][Medline]
23. Kim, S. W., X. Fang, H. Ji, A. F. Paulson, J. M. Daniel, M. Ciesiolka, F. van Roy, and P. D. McCrea. 2002. Isolation and characterization of XKaiso, a transcriptional repressor that associates with the catenin Xp120(ctn) in Xenopus laevis. J. Biol. Chem. 277:8202-8208.
24. Kobayashi, A., H. Yamagiwa, H. Hoshino, A. Muto, K. Sato, M. Morita, N. Hayashi, M. Yamamoto, and K. Igarashi. 2000. A combinatorial code for gene expression generated by transcription factor Bach2 and MAZR (MAZ-related factor) through the BTB/POZ domain. Mol. Cell. Biol. 20:1733-1746.
25. Koike, S., L. Schaeffer, and J. P. Changeux. 1995. Identification of a DNA element determining synaptic expression of the mouse acetylcholine receptor delta-subunit gene. Proc. Natl. Acad. Sci. USA 92:10624-10628.
26. Lu, Q., M. Paredes, M. Medina, J. Zhou, R. Cavallo, M. Peifer, L. Orecchio, and K. S. Kosik. 1999.
-Catenin, an adhesive junction-associated protein which promotes cell scattering. J. Cell Biol. 144:519-532.
27. Lu, Q., N. K. Mukhopadhyay, J. D. Griffin, M. Paredes, M. Medina, and K. S. Kosik. 2002. Brain armadillo protein delta-catenin interacts with Abl tyrosine kinase and modulates cellular morphogenesis in response to growth factors. J. Neurosci. Res. 67:618-624.[CrossRef][Medline]
28. Moscoso, L. M., J. P. Merlie, and J. R. Sanes. 1995. N-CAM, 43K-rapsyn, and S-laminin mRNAs are concentrated at synaptic sites in muscle fibers. Mol. Cell. Neurosci. 6:80-89.[CrossRef][Medline]
29. Muller, J. S., G. Mildner, W. Muller-Felber, U. Schara, K. Krampfl, B. Petersen, S. Petrova, R. Stucka, W. Mortier, J. Bufler, G. Kurlemann, A. Huebner, L. Merlini, H. Lochmuller, and A. Abicht. 2003. Rapsyn N88K is a frequent cause of congenital myasthenic syndromes in European patients. Neurology 60:1805-1810.
30. Nichols, P., R. Croxen, A. Vincent, R. Rutter, M. Hutchinson, J. Newsom-Davis, and D. Beeson. 1999. Mutation of the acetylcholine receptor epsilon-subunit promoter in congenital myasthenic syndrome. Ann. Neurol. 45:439-443.[CrossRef][Medline]
31. Ohno, K., B. Anlar, and A. G. Engel. 1999. Congenital myasthenic syndrome caused by a mutation in the Ets-binding site of the promoter region of the acetylcholine receptor epsilon subunit gene. Neuromuscul. Disord. 9:131-135.[CrossRef][Medline]
32. Ohno, K., A. G. Engel, X. M. Shen, D. Selcen, J. Brengman, C. M. Harper, A. Tsujino, and M. Milone. 2002. Rapsyn mutations in humans cause endplate acetylcholine-receptor deficiency and myasthenic syndrome. Am. J. Hum. Genet. 70:875-885.[CrossRef][Medline]
33. Ohno, K., M. Sadeh, I. Blatt, J. M. Brengman, and A. G. Engel. 2003. E-box mutations in the RAPSN promoter region in eight cases with congenital myasthenic syndrome. Hum. Mol. Genet. 12:739-748.
34. Paffenholz, R., and W. W. Franke. 1997. Identification and localization of a neurally expressed member of the plakoglobin/armadillo multigene family. Differentiation 61:293-304.[CrossRef][Medline]
35. Peukert, K., P. Staller, A. Schneider, G. Carmichael, F. Hänel, and M. Eilers. 1997. An alternative pathway for gene regulation by Myc. EMBO J. 16:5672-5686.[CrossRef][Medline]
36. Prokhortchouk, A., B. Hendrich, H. Jorgensen, A. Ruzov, M. Wilm, G. Georgiev, A. Bird, and E. Prokhortchouk. 2001. The p120 catenin partner Kaiso is a DNA methylation-dependent transcriptional repressor. Genes Dev. 15:1613-1618.
37. Reynolds, A. B., J. Daniel, P. D. McCrea, M. J. Wheelock, J. Wu, and Z. Zhang. 1994. Identification of a new catenin: the tyrosine kinase substrate p120cas associates with E-cadherin complexes. Mol. Cell. Biol. 14:8333-8342.
38. Richard, P., K. Gaudon, F. Andreux, E. Yasaki, C. Prioleau, S. Bauche, A. Barois, C. Ioos, M. Mayer, M. C. Routon, M. Mokhtari, J. P. Leroy, E. Fournier, B. Hainque, J. Koenig, M. Fardeau, B. Eymard, and D. Hantai. 2003. Possible founder effect of rapsyn N88K mutation and identification of novel rapsyn mutations in congenital myasthenic syndromes. J. Med. Genet. 40:e81. [Online.]
39. Rodova, M., M. R. Islam, R. L. Maser, and J. P. Calvet. 2002. The polycystic kidney disease-1 promoter is a target of the beta-catenin/T-cell factor pathway. J. Biol. Chem. 277:29577-29583.
40. Sanes, J. R., and J. W. Lichtman. 1999. Development of the vertebrate neuromuscular junction. Annu. Rev. Neurosci. 22:389-442.[CrossRef][Medline]
41. Schaeffer, L., A. de Kerchove D'Exaerde, and J. P. Changeux. 2001. Targeting transcription to the neuromuscular synapse. Neuron 31:15-22.[CrossRef][Medline]
42. Wallace, B. G. 1986. Aggregating factor from Torpedo electric organ induces patches containing acetylcholine receptors, acetylcholinesterase, and butyrylcholinesterase on cultured myotubes. J. Cell Biol. 102:783-794.
43. Weinmann, A. S., and P. J. Farnham. 2002. Identification of unknown target genes of human transcription factors using chromatin immunoprecipitation. Methods 26:37-47.[CrossRef][Medline]
44. Weintraub, H., V. J. Dwarki, I. Verma, R. Davis, S. Hollenberg, L. Snider, A. Lassar, and S. J. Tapscott. 1991. Muscle-specific transcriptional activation by MyoD. Genes Dev. 5:1377-1386.
45. Yoon, H. G., D. W. Chan, A. B. Reynolds, J. Qin, and J. Wong. 2003. N-CoR mediates DNA methylation-dependent repression through a methyl CpG binding protein Kaiso. Mol. Cell 12:723-734.[CrossRef][Medline]
46. Zhou, J., U. Liyanage, M. Medina, C. Ho, A. D. Simmons, M. Lovett, and K. S. Kosik. 1997. Presenilin 1 interaction in the brain with a novel member of the Armadillo family. Neuroreport 8:2085-2090.[Medline]
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||