![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Molecular and Cellular Biology, September 2004, p. 7483-7490, Vol. 24, No. 17
0270-7306/04/$08.00+0 DOI: 10.1128/MCB.24.17.7483-7490.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Sean O'Connor,,
Carrie Loushin Newman, and Philip Anderson*
Department of Genetics, University of Wisconsin, Madison, Wisconsin
Received 1 March 2004/ Returned for modification 9 April 2004/ Accepted 1 June 2004
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Gene products required for NMD have been identified in fungi, nematodes, insects, and mammals (13, 16, 24, 49), and putative orthologs of these genes are evident in many sequenced eukaryotic genomes. A core group of three genes first identified in the yeast Saccharomyces cerevisiae (UPF1, NMD2/UPF2, and UPF3) (reviewed in reference 69) are required for NMD in all tested eukaryotes (3, 40, 45, 50, 57, 61). The conservation of both the sequence and function of such genes indicates that NMD is an evolutionarily ancient process and suggests that elements of the mechanism of NMD will be similar in most, or perhaps all, eukaryotes.
PTCs are distinguished from normal termination codons in both yeast and mammalian cells by the context of translation termination. Specific cis-acting elements mark the open reading frame of mRNAs and activate NMD when translation terminates upstream of the marks. The Upf proteins appear to be involved both in sensing the presence of downstream signals and in activating the degradation machinery. In yeast cells, the cis-acting elements are termed downstream sequence elements, which are thought to be present throughout coding sequences but not in 3' untranslated regions (54). Hrp1p binds both downstream sequence elements and Upf1p and, in addition to other roles, is involved in NMD (26). In mammalian cells, cis-acting elements that mark open reading frames are exon junction complexes (EJCs), which are deposited near splice junctions in mature mRNAs (37). The EJC communicates with Upf proteins via interactions between Upf3 and the EJC components RNPS1 and Y14 (25, 36, 41). Upf3 interacts with Upf2, which interacts with Upf1 (40, 57). Although the marking of open reading frames is different in yeast cells and mammals, other aspects of NMD (for example, the roles of UPF proteins) are quite similar.
Upf1 is a key regulator of NMD (reviewed in reference 27) and is an ATPase/helicase whose catalytic activity is required for NMD (66). Upf1 interacts with downstream activators of NMD (26), with other Upf proteins (31), with translation release factors (17), and with components of either the 5' or 3' decay pathways (23, 42, 62). Upon premature termination, Upf1 activity is required to commence either 5' or 3' (or both) exonucleolytic degradation of substrate mRNAs (12, 38, 47, 62). Thus, Upf1 is uniquely positioned to regulate decay by communicating the presence of downstream information and activating subsequent steps of degradation. Important unanswered questions concerning Upf1 include how downstream activators of NMD influence its activity and how Upf1 in turn activates the 5' or 3' decay pathway.
Functions of at least seven genes are required for NMD in Caenorhabditis elegans. smg-2, smg-3, and smg-4 are orthologs of yeast UPF1, UPF2, and UPF3 (3, 50; S. L. Kuchma and P. Anderson, unpublished data). Four additional genes (smg-1, smg-5, smg-6, and smg-7), which are not evident in yeast cells, are required for NMD in C. elegans, Drosophila melanogaster, and mammalian cells (13, 19, 24, 49, 70). SMG-2 undergoes cycles of phosphorylation that appear to be required for NMD. Indeed, all known smg genes other than smg-2 affect the state of SMG-2 phosphorylation (50). SMG-1, SMG-3, and SMG-4 are needed to phosphorylate SMG-2 while SMG-5, SMG-6, and SMG-7 are needed to dephosphorylate SMG-2. SMG-5 is a component of a protein phosphatase 2A complex (PP2A) that interacts with SMG-2 in both C. elegans and mammalian cells (2, 13, 49). This SMG-5-PP2A complex is thought to be the SMG-2/human UPF1 (hUPF1)-specific phosphatase. Human SMG-1 phosphorylates hUPF1 both in vitro and in vivo (19, 70). Taken together, these observations suggest that regulation of SMG-2 via cycles of phosphorylation is central to NMD. We report here the molecular analysis of smg-1, its interactions with components of C. elegans NMD, and its role in SMG-2 phosphorylation.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Transformation rescue assay. smg-1(r861) unc-54(r293) hermaphrodites were coinjected with DNA to be tested and marker plasmid pRF4[rol-6(su1006)] by using established methods (44). unc-54(r293); smg(+) animals are paralyzed, whereas unc-54(r293); smg(–) animals have normal motility (32). Heritable transformed lines were established and scored for motility.
Sequence and phylogenetic analysis. Sequence and phylogenetic analysis was performed by using internet resources providing the following algorithms: CLUSTALW, Neighbor-Joining, and Puzzle (55, 60, 64). Amino acid sequences were aligned with CLUSTALW. Gapped positions and regions of uncertain alignment were omitted from further analysis. Trees were constructed by Neighbor-Joining and Puzzle, and confidence values were based on 1,000 bootstrap trees or puzzling steps.
Analysis of SMG-1 kinase-inactive mutants. Constructs used in analysis of smg-1 kinase mutants included a copy of unc-119(+) and a wild-type (clone TR #430) or mutant (TR#431) genomic copy of smg-1 (NcoI-SalI fragment, nucleotides [nt] 13852 to 27566 of U97189); TR#431 was made by mutating nt 16626 (T to G) within a KpnI-BglII fragment (nt 16353 to 17293) by using QuikChange (Stratagene) and the appropriate primers and was then used to replace the corresponding piece of TR no. 430. Transgenic animals were generated by microparticle bombardment of smg-1(r861); unc-119(ed3) with either TR #430 or TR#431, and heritable lines were established as described previously (52). RNA isolation and rpl-12 reverse transcription-PCR were performed as described previously (48) with primers GTTGCGTCGGAGGAGAAGTCG (forward) and GATGATGTCGTGTGGGTGTTGTC (reverse).
Antibodies. SMG-1 antisera were generated by immunizing two rabbits with recombinant, hexahistidine-tagged, partial-length SMG-1 (amino acids 477 to 903) purified from inclusion bodies (68) after expression in Escherichia coli (pET28a system; Novagen). Anti-SMG-1 antibodies were affinity purified as described previously (4) with a glutathione S-transferase-tagged partial-length SMG-1 encoding aa 507 to 817 (pGEX4T system; Amersham Pharmacia). Anti-SMG-1 antibodies were eluted with ActiSep (Sterogene), desalted, and concentrated.
Coimmunoprecipitation assays. Mixed-stage animals were suspended in 20 mM morpholinepropanesulfonic acid (MOPS) (pH 7.2) buffer containing protease and phosphatase inhibitors. Worms were homogenized by using a French pressure cell (12,000 lb/in2) and centrifuged at 21,000 x g for 25 min, retaining only the soluble supernatant fraction. Protein concentrations were measured and equalized with 20 mM MOPS (pH 7.2) before immunoprecipitation. Extracts were adjusted to 100 mM NaCl and incubated with antibody, followed by the addition of protein A-Sepharose (Amersham Pharmacia). Precipitated proteins were collected by centrifugation and washed six times with 20 mM MOPS (pH 7.2) and 100 mM NaCl. RNase-treated extracts were prepared by incubating extracts described above with 1 mg of RNase A/ml for 1 h on ice prior to immunoprecipitation.
Immunoprecipitation kinase assays.
SMG-2 was immunoprecipitated from total soluble protein extracts as described above. Washed immunoprecipitate pellets were further washed twice with kinase buffer (50 mM Tris-HCl [pH 7.5], 10 mM MgCl2) with protease inhibitors and resuspended in a total volume of 100 µl of kinase buffer. [
-32P]ATP (40 µCi) was added, and the reaction mixtures were incubated at room temperature for 60 min with gentle agitation. Samples containing wortmannin were incubated for 1 h at room temperature in 1 µM wortmannin (or mock control) prior to the addition of [-32P]ATP. Reactions were stopped by the addition of an equal volume of boiling sodium dodecyl sulfate-polyacrylamide gel electrophoresis sample buffer, and products were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Gels were dried and visualized with a PhosphorImager (Molecular Dynamics).
Immunofluorescence microscopy. Immunolocalization was performed by using standard procedures (15). Extruded gonads were fixed with methanol-acetone and washed in phosphate-buffered saline-Tween 20 buffer. Affinity-purified anti-SMG-2 antibody was precleared by treating the samples with an acetone powder generated from smg-2(r908) (a null allele). Mab414 antibody was added to cleared anti-SMG-2 antibody prior to staining. Images were obtained on an MRC1024 confocal microscope.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We identified and sequenced a series of overlapping cDNA clones from oligo(dT)-primed or random-primed cDNA libraries that define a 7.6-kb full-length smg-1 mRNA. Multiple 3' clones contained a poly(A) tract at their 3' ends, and multiple 5' clones contained SL1 at their 5' ends. SL1 is a trans-spliced leader sequence present at the 5' ends of many C. elegans transcripts (5). Thus, the assembled sequence (GenBank accession no. AF149821) represents full-length smg-1 mRNA. We examined all available smg-1 expressed sequence tag sequences and determined that each of them is colinear with our assembled cDNA sequence. smg-1 contains 42 exons, spans 12.6 kb of genomic DNA, and encodes a 2,322-aa protein. The intron and exon structure of smg-1 is described at http://www.wormbase.org.
We sequenced three independent smg-1 alleles. smg-1(r913) and smg-1(r910) are mutator-induced alleles that contain Tc1 insertions at TA dinucleotides 17105-17106 and 24620-24621 of cosmid C48B6, respectively. smg-1(r884) is an ethyl methanesulfonate-induced mutation changing codon 1941 (UGG; C48B6 nt 16697) to a UGA premature stop. An additional unsequenced allele, smg-1(r904), contains a Tc3 insertion in the vicinity of C48B6 nt 19600 based on Southern blot and PCR analyses.
We prepared an affinity-purified anti-SMG-1 antibody directed against SMG-1 aa 477 to 903 (see Materials and Methods). This antibody recognizes a protein on Western blots whose mass is consistent with the cDNA prediction of 265 kDa. We examined a series of smg-1 mutants for expression of SMG-1-related proteins. Five tested alleles (r861, r879, r887, r904, and r910::Tc1) expressed no detectable SMG-1 (Fig. 1A, lanes 2 and 3 and data not shown). We conclude that smg-1 corresponds to transcript C48B6.6 and that the canonical allele smg-1(r861) is a null protein.
|
smg-1 encodes a PIK-related protein kinase. smg-1 cDNA encodes a protein of 2,322 aa (265 kDa). Four domains of SMG-1, diagrammed in Fig. 1B, are notable: (i) a putative bipartite nuclear localization signal (aa 238 to 255); (ii) a FAT (FRAP, ATM, and TRRAP) domain (aa 494 to 1535); (iii) a phosphatidylinositol kinase (PIK) domain (aa 1779 to 2058); and (iv) a FATC (FAT carboxyl terminus) domain (aa 2290 to 2322). The founding members of the PIK superfamily are lipid kinases, but the subfamily of PIK-related kinases are protein kinases (reviewed in reference 34). Phylogenetic analysis (see below) identifies SMG-1 as a probable protein kinase rather than a lipid kinase. Biochemical functions of the FAT and FATC domains are unknown, although they are found together in certain protein kinases of the PIK superfamily (6). The presence of SMG-1 FAT and FATC domains supports our conclusion that SMG-1 is a protein kinase rather than a lipid kinase.
We constructed a phylogenetic tree consisting of all PIK superfamily members from C. elegans, human, yeast (Saccharomyces cerevisiae), and Arabidopsis thaliana. These species were selected as a proxy for higher eukaryotes. The most significant portions of the PIK superfamily tree are shown in Fig. 2A. Four families of protein kinases are identified. Kinases of the ATM/Tel1p, ATR/Mec1p, and FRAP/Tor1,2p families function predominantly in growth control, cell cycle regulation, and response to DNA damage (reviewed in reference 33). The four species we examined contain members of each of these subfamilies. In contrast, of the species we examined, only C. elegans and humans contain members of the SMG-1 family. SMG-1 family members are not found in either S. cerevisiae or Arabidopsis. Interestingly, the SMG-1 kinase family appears to be most closely related to the FRAP family of kinases (discussed below).
|
SMG-1 kinase activity is required for NMD. We tested whether the putative kinase activity of SMG-1 is required for NMD by constructing a kinase-inactive variant and determining whether it supplies smg-1(+) function when expressed as the sole source of SMG-1 in vivo. We mutated a highly conserved aspartate (SMG-1 position 1966) to alanine in an smg-1 genomic clone [smg-1(D1966A)], a substitution known to inactivate the catalytic activity of many different protein kinases, including PIK-type kinases (8, 56, 63, 70). We established transgenic lines expressing either smg-1(+) or smg-1(D1966A) in an smg-1(r861) host and verified with Western blots that stable SMG-1 protein was expressed in each line (Fig. 3A, lanes 1, 3, and 4).
|
In vitro phosphorylation of SMG-2 requires SMG-1 and is negatively regulated by SMG-5.
SMG-1 is required to phosphorylate SMG-2 in vivo (50). Human SMG-1, furthermore, phosphorylates hUPF1 (the ortholog of SMG-2) in vitro and likely also in vivo (19, 70). We investigated whether SMG-2 phosphorylation could be reconstituted in partially purified preparations by immunoprecipitating SMG-2 and testing whether copurifying kinase(s) phosphorylate SMG-2 in vitro. SMG-2 phosphorylation was assayed by resuspending immunoprecipitation pellets in buffers favorable for PIK-related kinases, incubating them with [-32P]ATP, and monitoring the transfer of the radiolabel to SMG-2. We additionally tested roles of other smg genes in this assay.
A protein of approximately 120 kDa, which we conclude is SMG-2, is efficiently radiolabeled in such immunoprecipitation kinase assays. Three lines of evidence indicate that this labeled protein is SMG-2: (i) the phosphorylated protein migrates at the known size of SMG-2 (Fig. 4A, lane 1); (ii) phosphorylation of the 120-kDa protein is not observed in assays of smg-2(r908), a smg-2-null allele (lane 3); and (iii) phosphorylation of the 120-kDa protein requires smg-1 function (lanes 2 and 5). We conclude that SMG-2 coimmunoprecipitates with an active kinase and that in vitro SMG-2 phosphorylation requires SMG-1.
|
-32P]ATP in immunoprecipitation kinase assays. SMG-2-specific kinase activity was absent in wortmannin-treated samples. We conclude that the SMG-2 kinase observed in vitro is a PIK-type kinase. SMG-5 is a component of a PP2A complex that is required for SMG-2 dephosphorylation in vivo (2, 49). The SMG-2 kinase activity that we detect in vitro is regulated by smg-5. In vitro phosphorylation of SMG-2 is increased in immunoprecipitation pellets of smg-5(r860) (Fig. 4A, lane 4) and is eliminated in smg-5(–) smg-1(–) double mutants (lane 5). Thus, in vitro phosphorylation of SMG-2 recapitulates the important aspects of SMG-2 phosphorylation observed in vivo. Previous studies demonstrate that SMG-5 interacts with and is coimmunoprecipitable with SMG-2 in crude extracts (2). Thus, the elevated SMG-2 kinase activity in smg-5(–) mutants is likely a direct effect of the absence of SMG-5 in the SMG-2 immunoprecipitation pellets.
SMG-1 interacts with SMG-2. If SMG-1 is the SMG-2 kinase, as suggested above, then the two proteins may interact as part of a stable complex. Such interactions have been described for hSMG-1 and hUPF1 (70). We therefore investigated whether SMG-1 interacts physically with SMG-2 in crude extracts by using coimmunoprecipitation assays. Our strategy was to immunoprecipitate SMG-2 (or SMG-1) from crude extracts and to examine the pellets for the presence of SMG-1 (or SMG-2) by using antibodies described above and previously (50). We additionally tested smg-3, smg-4, and smg-5 mutants for effects on SMG-1-SMG-2 interactions. smg-3 and smg-4 are required in vivo for SMG-2 phosphorylation, whereas smg-5 is required for SMG-2 dephosphorylation (50).
SMG-1, which migrates as a 265-kDa protein, copurifies with immunoprecipitated SMG-2 from wild-type extracts (Fig. 5A, lane 1), including those that have been treated with RNase A (lane 7). SMG-1 is absent from the immunoprecipitation pellets of control strain smg-2(r908) (lane 3; r908 is a protein-null allele), even though its expression is normal in smg-2(r908) (Fig. 5B, lane 3). SMG-1 additionally copurifies with immunoprecipitated SMG-2 from extracts of smg-3(r930) and smg-4(r1169) (Fig. 5A, lanes 5 and 6). We conclude that SMG-1 interacts with SMG-2 either directly or indirectly, that the SMG-1-SMG-2 interaction is not bridged by RNA, and that phosphorylation of SMG-2 is not required for its interaction with SMG-1.
|
We investigated whether mutations that inactivate or truncate the SMG-1 kinase domain affect the SMG-1-SMG-2 interaction (Fig. 5D). SMG-1(D1966A) (discussed above) is a substitution known to inactivate the kinase activity of PIK-type kinases. SMG-1(W1941X) is a truncated form of SMG-1 expressed by the nonsense allele smg-1(r884), which removes the carboxyl terminus of SMG-1, including about half of the SMG-1 kinase domain (Fig. 1A). Both SMG-1(D1966A) and SMG-1(W1941X) copurify with immunoprecipitated SMG-2 (Fig. 5D, lanes 5 and 6). We conclude that an active or intact SMG-1 kinase domain is not required for interactions between SMG-1 and SMG-2, despite being required for NMD.
SMG-2 is localized to the cytoplasm. An important unanswered question concerning NMD is when during gene expression the surveillance complex (Upf1p, Upf2p, Upf3p, and their associated proteins) is assembled on mRNAs. Yeast UPF3 and hUPF3 and possibly hUPF1 and hUPF2 shuttle between the nucleus and the cytoplasm (40, 45, 46, 57, 59). The significance of this shuttling and the functions of surveillance proteins in different compartments of the cell are presently unknown. More generally, concentrated foci of proteins involved in mRNA degradation have been described for both yeast and mammalian cells (58; reviewed in reference 67). The dynamics of these foci and their roles in mRNA turnover are poorly understood. In principle, phosphorylation of UPF1/SMG-2, which is required for NMD, may regulate its trafficking, either in the nucleus or the cytoplasm. We therefore investigated the intracellular location of SMG-2 in the wild type and in mutants that disrupt cycles of SMG-2 phosphorylation.
We stained fixed specimens with anti-SMG-2 antibody (50) and with anti-Mab414. Mab414 identifies the nuclear envelope (18), although it is unknown whether Mab414 marks the inner or outer layer (or both). Representative immunofluorescent images are shown in Fig. 6, with SMG-2 labeled with Texas Red and Mab414 labeled with fluorescein (green). SMG-2 is located diffusely throughout the cytoplasm in the wild type (Fig. 6A) and is eliminated in smg-2(r908) (Fig. 6B; r908 is a null allele). The staining of the wild type is somewhat granular in appearance, but the foci of the concentrated signal are not apparent. We detect no changes in the SMG-2 distribution in smg-1(r904), smg-3(r930), and smg-4(r1169) (Fig. 6C to E), all of which are required for SMG-2 phosphorylation and are null alleles of the affected gene (3; Kuchma and Anderson, unpublished). Similarly, SMG-2 is diffusely cytoplasmic in smg-5(r860) (Fig. 6F) and in smg-2(r866) (Fig. 6G). Phosphorylated SMG-2 accumulates to abnormally high levels in both of these mutants, due either to loss of the SMG-5-associated phosphatase (2) or to a missense mutation of SMG-2 itself (50). We conclude that neither SMG-1, SMG-3, SMG-4, nor SMG-5 is required for the gross localization of SMG-2 within cells.
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cycles of SMG-2 phosphorylation are necessary for NMD in C. elegans, and SMG-1 appears to be the SMG-2 kinase. Phosphorylated SMG-2 is detected in vivo (19, 50, 70), and all other smg genes influence the state of its phosphorylation. SMG-5 is a component of a PP2A complex that interacts with SMG-2 and is required for NMD (2, 13, 49). Multiple lines of evidence indicate that C. elegans SMG-1 is the likely SMG-2 kinase: (i) smg-1 function is required to phosphorylate SMG-2 both in vivo and in vitro, (ii) smg-1 encodes a predicted protein kinase, (iii) an intact SMG-1 kinase domain is essential for NMD, (iv) wortmannin, an inhibitor of PIK-related kinases, inhibits smg-1-dependent phosphorylation of SMG-2 in vitro, and (v) SMG-1 and SMG-2 physically interact. Taken together, these observations suggest strongly that SMG-1 directly phosphorylates SMG-2. Our results indicate that the biochemical functions of C. elegans SMG-1 are similar to those of human SMG-1 (19, 70).
Core components of NMD (UPF1, UPF2, and UPF3) are found in animals, plants, and fungi, but to date, components involved in the phosphorylation of UPF1/SMG-2 have only been described for animals (13, 19, 24, 49, 70). Human and Drosophila orthologs of smg-1, smg-5, smg-6, and smg-7 are known to be involved in NMD and in UPF1/SMG-2 phosphorylation, but yeast orthologs have not been described. Nevertheless, the phosphorylation of Upf1p in yeast cells was recently described (20). Yeast cells do not have an apparent smg-1 ortholog, but they do contain other members of the PIK-related family of kinases. Perhaps one of these kinases is the undiscovered Upf1p kinase. The subfamily of PIK-related kinases most closely related to SMG-1 is the FRAP/Tor1,2 subfamily (Fig. 2). A possibly similar example of regulation via phosphorylation has been described for the yeast FRAP/Tor1,2 subfamily. Yeast Tap42p is reversibly phosphorylated by the competing activities of a Tor1,2p kinase and a PP2A phosphatase (21, 35). Our phylogenetic analysis indicates that the SMG-1 and FRAP/Tor1,2 subfamilies are distinct. C. elegans and hSMG-1 are monophyletic, and C. elegans and humans contain other PIK-related kinases of the FRAP/Tor1,2 subfamily. If an undiscovered Upf1p kinase exists, an undiscovered Upf1p phosphatase must exist also. Unambiguous orthologs of SMG-5, SMG-6, or SMG-7 are not evident in yeast cells, but Nmd4p contains a PINc domain (14), as do C. elegans SMG-5 and SMG-6 (2; H. Shang and P. Anderson, unpublished data). A function for Nmd4p has not been established, but remarkably, it interacts with Upf1p in a yeast two-hybrid assay (30). Perhaps required cycles of UPF1/SMG-2 phosphorylation and dephosphorylation are more widespread than presently described.
An important unanswered question concerning NMD is the function of UPF1/SMG-2 phosphorylation and dephosphorylation. hUPF1 may shuttle between the nucleus and cytoplasm (46), and in principle, phosphorylation of UPF1/SMG-2 may regulate this or other trafficking events. We examined the intracellular location of SMG-2 in mutants that disrupt cycles of SMG-2 phosphorylation, but we observed no alterations in the mutants (Fig. 6). Our analysis included mutants defective for either SMG-2 phosphorylation [smg-1(–), smg-3(–), and smg-4(–)] or SMG-2 dephosphorylation [smg-5(–) and smg-2(r866)]. SMG-2 phosphorylation, therefore, appears to not be involved in overall localization of SMG-2 within the cell. Targeting of SMG-2 on a submicroscopic scale, for example, association with polysomes (51) or differential association with isoforms of UPF3/SMG-4 (49), would not have been detected by our methods.
What then does phosphorylation of SMG-2 regulate? UPF1/SMG-2 is the key regulator of NMD. It interacts with the translation termination machinery and with downstream signals of open reading frames. It functions to integrate signals from multiple sources and to activate either 5' or 3' decay pathways. Both phosphorylation and dephosphorylation of SMG-2 are required for NMD, but the steady-state level of phosphorylated SMG-2 is quite low (50). Assuming that a significant fraction of SMG-2 is actively engaged in NMD at steady state, its phosphorylation must be a transient event. Perhaps phosphorylation of SMG-2 regulates its ATPase/helicase activity, with either phosphorylation or dephosphorylation being the trigger that activates 5' decapping or 3' decay. Perhaps SMG-2 phosphorylation regulates assembly or dynamics of the numerous protein-protein interactions of the surveillance complex (49), or perhaps phosphorylation regulates disassembly of the surveillance complex and recycling of components for subsequent rounds of NMD. Overexpression of hSMG-1 increases the level of hUPF1 phosphorylation and increases the efficiency of NMD (51, 70), which is consistent with each of these models.
|
ACKNOWLEDGMENTS |
|---|
We thank Bob Barstead for the cDNA libraries, Sarah Crittenden for help with immunofluorescent microscopy, and Chris Malone for help with microparticle bombardment.
|
FOOTNOTES |
|---|
A.G. and S.O. contributed equally to this work.
Present address: Department of Blood and Marrow Transplantation, University of Texas, Houston, TX 77030.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Anders, K. R., A. Grimson, and P. Anderson. 2003. SMG-5, required for C. elegans nonsense-mediated mRNA decay, associates with SMG-2 and protein phosphatase 2A. EMBO J. 22:641-650.[CrossRef][Medline]
3. Aronoff, R., R. Baran, and J. Hodgkin. 2001. Molecular identification of smg-4, required for mRNA surveillance in C. elegans. Gene 268:153-164.[CrossRef][Medline]
4. Bar-Peled, M., and N. V. Raikhel. 1996. A method for isolation and purification of specific antibodies to a protein fused to the GST. Anal. Biochem. 241:140-142.[CrossRef][Medline]
5. Blumenthal, T. 1995. Trans-splicing and polycistronic transcription in Caenorhabditis elegans. Trends Genet. 11:132-136.[CrossRef][Medline]
6. Bosotti, R., A. Isacchi, and E. L. L. Sonnhammer. 2000. FAT: a novel domain in PIK-related kinases. Trends Biochem. Sci. 25:225-227.[CrossRef][Medline]
7. Brenner, S. 1974. The genetics of Caenorhabditis elegans. Genetics 77:71-94.
8. Brown, E. J., P. A. Beal, C. T. Keith, J. Chen, T. B. Shin, and S. L. Schreiber. 1995. Control of p70 S6 kinase by kinase activity of FRAP in vivo. Nature 377:441-446.[CrossRef][Medline]
9. Cali, B. M., and P. Anderson. 1998. mRNA surveillance mitigates genetic dominance in Caenorhabditis elegans. Mol. Gen. Genet. 260:176-184.[CrossRef][Medline]
10. Cali, B. M., S. L. Kuchma, J. Latham, and P. Anderson. 1999. smg-7 is required for mRNA surveillance in Caenorhabditis elegans. Genetics 151:605-616.
11. Carter, M. S., J. Doskow, P. Morris, S. Li, R. P. Nhim, S. Sandstedt, and M. F. Wilkinson. 1995. A regulatory mechanism that detects premature nonsense codons in T-cell receptor transcripts in vivo is reversed by protein synthesis inhibitors in vitro. J. Biol. Chem. 270:28995-29003.
12. Chen, C. Y., and A. B. Shyu. 2003. Rapid deadenylation triggered by a nonsense codon precedes decay of the RNA body in a mammalian cytoplasmic nonsense-mediated decay pathway. Mol. Cell. Biol. 23:4805-4813.
13. Chiu, S. Y., G. Serin, O. Ohara, and L. E. Maquat. 2003. Characterization of human Smg5/7a: a protein with similarities to Caenorhabditis elegans SMG-5 and SMG-7 that functions in the dephosphorylation of Upf1. RNA 9:77-87.
14. Clissold, P. M., and C. P. Ponting. 2000. PIN domains in nonsense-mediated mRNA decay and RNAi. Curr. Biol. 10:R888-R890.[CrossRef][Medline]
15. Crittenden, S. L., and J. Kimble. 1999. Confocal methods for Caenorhabditis elegans. Methods Mol. Biol. 122:141-151.[Medline]
16. Culbertson, M. R., and P. F. Leeds. 2003. Looking at mRNA decay pathways through the window of molecular evolution. Curr. Opin. Genet. Dev. 13:207-214.[CrossRef][Medline]
17. Czaplinski, K., M. J. Ruiz-Echevarria, S. V. Paushkin, X. Han, Y. Weng, H. A. Perlick, M. D. Ter-Avanesyan, and S. W. Peltz. 1998. The surveillance complex interacts with the translation release factors to enhance termination and degrade aberrant mRNAs. Genes Dev. 12:1665-1677.
18. Davis, L. I., and G. Blobel. 1986. Identification and characterization of a nuclear pore complex protein. Cell 45:699-709.[CrossRef][Medline]
19. Denning, G., L. Jamieson, L. E. Maquat, E. A. Thompson, and A. P. Fields. 2001. Cloning of a novel phosphatidylinositol kinase-related kinase: characterization of the human SMG-1 RNA surveillance protein. J. Biol. Chem. 276:22709-22714.
20. De Pinto, B., R. Lippolis, R. Castaldo, and N. Altamura. 2004. Overexpression of Upf1p compensates for mitochondrial splicing deficiency independently of its role in mRNA surveillance. Mol. Microbiol. 51:1129-1142.[CrossRef][Medline]
21. Di Como, C. J., and K. T. Arndt. 1996. Nutrients, via the Tor proteins, stimulate the association of Tap42 with type 2A phosphatases. Genes Dev. 10:1904-1916.
22. Dolferus, R., D. Van Den Bossche, and M. Jacobs. 1990. Sequence analysis of two null-mutant alleles of the single Arabidopsis Adh locus. Mol. Gen. Genet. 224:297-302.[CrossRef][Medline]
23. Dunckley, T., and R. Parker. 1999. The DCP2 protein is required for mRNA decapping in Saccharomyces cerevisiae and contains a functional MutT motif. EMBO J. 18:5411-5422.[CrossRef][Medline]
24. Gatfield, D., L. Unterholzner, F. D. Ciccarelli, P. Bork, and E. Izaurralde. 2003. Nonsense-mediated mRNA decay in Drosophila: at the intersection of the yeast and mammalian pathways. EMBO J. 22:3960-3970.[CrossRef][Medline]
25. Gehring, N. H., G. Neu-Yilik, T. Schell, M. W. Hentze, and A. E. Kulozik. 2003. Y14 and hUpf3b form an NMD-activating complex. Mol. Cell 11:939-949.[CrossRef][Medline]
26. Gonzalez, C. I., M. J. Ruiz-Echevarria, S. Vasudevan, M. F. Henry, and S. W. Peltz. 2000. The yeast hnRNP-like protein Hrp1/Nab4 marks a transcript for nonsense-mediated mRNA decay. Mol. Cell 5:489-499.[CrossRef][Medline]
27. Gonzalez, C. I., A. Bhattacharya, W. Wang, and S. W. Peltz. 2001. Nonsense-mediated mRNA decay in Saccharomyces cerevisiae. Gene 274:15-25.[CrossRef][Medline]
28. Hall, G. W., and S. Thein. 1994. Nonsense codon mutations in the terminal exon of the beta-globin gene are not associated with a reduction in beta-mRNA accumulation: a mechanism for the phenotype of dominant beta-thalassemia. Blood 83:2031-2037.
29. He, F., S. W. Peltz, J. L. Donahue, M. Rosbash, and A. Jacobson. 1993. Stabilization and ribosome association of unspliced pre-mRNAs in a yeast upf1- mutant. Proc. Natl. Acad. Sci. USA 90:7034-7038.
30. He, F., and A. Jacobson. 1995. Identification of a novel component of the nonsense-mediated mRNA decay pathway by use of an interacting protein screen. Genes Dev. 9:437-454.
31. He, F., A. H. Brown, and A. Jacobson. 1997. Upf1p, Nmd2p, and Upf3p are interacting components of the yeast nonsense-mediated mRNA decay pathway. Mol. Cell. Biol. 17:1580-1594.[Abstract]
32. Hodgkin, J., A. Papp, R. Pulak, V. Ambros, and P. Anderson. 1989. A new kind of informational suppression in the nematode Caenorhabditis elegans. Genetics 123:301-313.
33. Hoekstra, M. F. 1997. Responses to DNA damage and regulation of cell cycle checkpoints by the ATM protein kinase family. Curr. Opin. Genet. Dev. 7:170-175.[CrossRef][Medline]
34. Hunter, T. 1995. When is a lipid kinase not a lipid kinase? When it is a protein kinase. Cell 83:1-4.[CrossRef][Medline]
35. Jiang, Y., and J. R. Broach. 1999. Tor proteins and protein phosphatase 2A reciprocally regulate Tap42 in controlling cell growth in yeast. EMBO J. 18:2782-2792.[CrossRef][Medline]
36. Kim, V. N., N. Kataoka, and G. Dreyfuss. 2001. Role of the nonsense-mediated decay factor hUpf3 in the splicing-dependent exon-exon junction complex. Science 293:1832-1836.
37. Le Hir, H., E. Izaurralde, L. E. Maquat, and M. J. Moore. 2000. The spliceosome deposits multiple proteins 20-24 nucleotides upstream of mRNA exon-exon junctions. EMBO J. 19:6860-6869.[CrossRef][Medline]
38. Lejeune, F., X. Li, and L. E. Maquat. 2003. Nonsense-mediated mRNA decay in mammalian cells involves decapping, deadenylating, and exonucleolytic activities. Mol. Cell 12:675-687.[CrossRef][Medline]
39. Lewis, B. P., R. E. Green, and S. E. Brenner. 2003. Evidence for the widespread coupling of alternative splicing and nonsense-mediated mRNA decay in humans. Proc. Natl. Acad. Sci. USA 100:189-192.
40. Lykke-Andersen, J., M. D. Shu, and J. A. Steitz. 2000. Human Upf proteins target an mRNA for nonsense-mediated decay when bound downstream of a termination codon. Cell 103:1121-1131.[CrossRef][Medline]
41. Lykke-Andersen, J., M. D. Shu, and J. A. Steitz. 2001. Communication of the position of exon-exon junctions to the mRNA surveillance machinery by the protein RNPS1. Science 293:1836-1839.
42. Lykke-Andersen, J. 2002. Identification of a human decapping complex associated with hUpf proteins in nonsense-mediated decay. Mol. Cell. Biol. 22:8114-8121.
43. Maquat, L. E. 2004. Nonsense-mediated mRNA decay: splicing, translation and mRNP dynamics. Nat. Rev. Mol. Cell. Biol. 5:89-99.[CrossRef][Medline]
44. Mello, C., and A. Fire. 1995. DNA transformation. Methods Cell Biol. 48:451-482.
45. Mendell, J. T., S. M. Medghalchi, R. G. Lake, E. N. Noensie, and H. C. Dietz. 2000. Novel Upf2p orthologues suggest a functional link between translation initiation and nonsense surveillance complexes. Mol. Cell. Biol. 20:8944-8957.
46. Mendell, J. T., C. M. J. ap Rhys, and H. C. Dietz. 2002. Separable roles for rent1/hUpf1 in altered splicing and decay of nonsense transcripts. Science 298:419-422.
47. Mitchell, P., and D. Tollervey. 2003. An NMD pathway in yeast involving accelerated deadenylation and exosome-mediated 3'-5' degradation. Mol. Cell 11:1405-1413.[CrossRef][Medline]
48. Mitrovich, Q. M., and P. Anderson. 2000. Unproductively spliced ribosomal protein mRNAs are natural targets of mRNA surveillance in C. elegans. Genes Dev. 14:2173-2184.
49. Ohnishi, T., A. Yamashita, I. Kashima, T. Schell, K. R. Anders, A. Grimson, T. Hachiya, M. W. Hentze, P. Anderson, and S. Ohno. 2003. Phosphorylation of hUPF1 induces formation of mRNA surveillance complexes containing hSMG-5 and hSMG-7. Mol. Cell 12:1187-1200.[CrossRef][Medline]
50. Page, M. F., B. Carr, K. R. Anders, A. Grimson, P. Anderson. 1999. SMG-2 is a phosphorylated protein required for mRNA surveillance in Caenorhabditis elegans and related to Upf1p of yeast. Mol. Cell. Biol. 19:5943-5951.
51. Pal, M., Y. Ishigaki, E. Nagy, and L. E. Maquat. 2001. Evidence that phosphorylation of human Upf1 protein varies with intracellular location and is mediated by a wortmannin-sensitive and rapamycin-sensitive PI 3-kinase-related kinase signaling pathway. RNA 7:5-15.[Abstract]
52. Praitis, V., E. Casey, D. Collar, and J. Austin. 2001. Creation of low-copy integrated transgenic lines in Caenorhabditis elegans. Genetics 157:1217-1226.
53. Pulak, R., and P. Anderson. 1993. mRNA surveillance by the Caenorhabditis elegans smg genes. Genes Dev. 7:1885-1897.
54. Ruiz-Echevarria, M. J., C. I. Gonzalez, and S. W. Peltz. 1998. Identifying the right stop: determining how the surveillance complex recognizes and degrades an aberrant mRNA. EMBO J. 17:575-589.[CrossRef][Medline]
55. Saitou, N., and M. Nei. 1987. The neighbour-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406-425.[Abstract]
56. Schu, P. V., K. Takegawa, M. J. Fry, J. H. Stack, M. D. Waterfield, and S. D. Emr. 1993. Phosphatidylinositol 3-kinase encoded by yeast VPS34 gene essential for protein sorting. Science 260:88-91.
57. Serin, G., A. Gersappe, J. D. Black, R. Aronoff, and L. E. Maquat. 2001. Identification and characterization of human orthologues to Saccharomyces cerevisiae Upf2 protein and Upf3 protein (Caenorhabditis elegans SMG-4). Mol. Cell. Biol. 21:209-223.
58. Sheth, U., and R. Parker. 2003. Decapping and decay of messenger RNA occur in cytoplasmic processing bodies. Science 300:805-808.
59. Shirley, R. L., M. J. Lelivelt, L. R. Schenkman, J. N. Dahlseid, and M. R. Culbertson. 1998. A factor required for nonsense-mediated mRNA decay in yeast is exported from the nucleus to the cytoplasm by a nuclear export signal sequence. J. Cell Sci. 111:3129-3143.[Abstract]
60. Strimmer, K., and A. Von Haeseler. 1996. Quartet puzzling: a quartet maximum likelihood method for reconstructing tree topologies. Mol. Biol. Evol. 13:964-969.
61. Sun, X., H. A. Perlick, H. C. Dietz, and L. E. Maquat. 1998. A mutated human homologue to yeast Upf1 protein has a dominant-negative effect on the decay of nonsense-containing mRNAs in mammalian cells. Proc. Natl. Acad. Sci. USA 95:10009-10014.
62. Takahashi, S., Y. Araki, T. Sakuno, and T. Katada. 2003. Interaction between Ski7p and Upf1p is required for nonsense-mediated 3'-to-5' mRNA decay in yeast. EMBO J. 22:3951-3959.[CrossRef][Medline]
63. Taylor, S. S., D. R. Knighton, J. Zheng, J. M. Sowadski, C. S. Gibbs, and M. J. Zoller. 1993. A template for the protein kinase family. Trends Biochem. Sci. 18:84-89.[CrossRef][Medline]
64. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.
65. Wagner, E., and J. Lykke-Andersen. 2002. mRNA surveillance: the perfect persist. J. Cell Sci. 115:3033-3038.
66. Weng, Y., K. Czaplinski, and S. W. Peltz. 1996. Genetic and biochemical characterization of mutations in the ATPase and helicase regions of the Upf1 protein. Mol. Cell. Biol. 16:5477-5490.[Abstract]
67. Wickens, M., and A. Goldstrohm. 2003. Molecular biology: a place to die, a place to sleep. Science 300:753-755.
68. Williams, J. A., J. A. Langeland, B. S. Thalley, J. B. Skeath, and S. B. Carroll. 1995. Expression of foreign proteins in E. coli using plasmid vectors and purification of specific polyclonal antibodies, p. 15-58. In D. M. Glover and B. D. Hames (ed.), DNA cloning 2: expression systems. A practical approach. Oxford University Press, Oxford, England.
69. Wilusz, C. J., W. Wang, and S. W. Peltz. 2001. Curbing the nonsense: the activation and regulation of mRNA surveillance. Genes Dev. 15:2781-2785.
70. Yamashita, A., T. Ohnishi, I. Kashima, Y. Taya, and S. Ohno. 2001. Human SMG-1, a novel phosphatidylinositol 3-kinase related protein kinase, associates with components of the mRNA surveillance complex and is involved in the regulation of nonsense-mediated mRNA decay. Genes Dev. 15:2215-2228.
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMG-1) antibody (top) and anti-PR65 (
