This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Thakur, N. Articles by Kanduri, C. Search for Related Content PubMed PubMed Citation Articles by Thakur, N. Articles by Kanduri, C.

An Antisense RNA Regulates the Bidirectional Silencing Property of the Kcnq1 Imprinting Control Region

Noopur Thakur,^1, Vijay Kumar Tiwari,^1, Helene Thomassin,² Radha Raman Pandey,¹ Meena Kanduri,¹ Anita Göndör,¹ Thierry Grange,² Rolf Ohlsson,¹ and Chandrasekhar Kanduri^1*

Department of Development and Genetics, Evolution Biology Centre, Uppsala University, Uppsala, Sweden,¹ Institut Jacques Monod, CNRS, Universites Paris 6-7, Paris, France²

Received 10 May 2004/ Returned for modification 17 June 2004/ Accepted 28 June 2004

	ABSTRACT

Top Abstract Introduction Materials and Methods Results Discussion References

 
The Kcnq1 imprinting control region (ICR) located in intron 10 of the Kcnq1 gene is unmethylated on the paternal chromosome and methylated on the maternal chromosome and has been implicated in the manifestation of parent-of-origin-specific expression of six neighboring genes. The unmethylated Kcnq1 ICR harbors bidirectional silencer activity and drives expression of an antisense RNA, Kcnq1ot1, which overlaps the Kcnq1 coding region. To elucidate whether the Kcnq1ot1 RNA plays a role in the bidirectional silencing activity of the Kcnq1 ICR, we have characterized factor binding sites by genomic footprinting and tested the functional consequence of various deletions of these binding sites in an episome-based system. Deletion of the elements necessary for Kcnq1ot1 promoter function resulted in the loss of silencing activity. Furthermore, interruption of Kcnq1ot1 RNA production by the insertion of a polyadenylation sequence downstream of the promoter also caused a loss of both silencing activity and methylation spreading. Thus, the antisense RNA plays a key role in the silencing function of the ICR. Double-stranded RNA (dsRNA)-mediated RNA interference is unlikely to be involved, as the ICR is active irrespective of the simultaneous production of dsRNA from the genes it silences.

	INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

 
Most of the 70 mammalian imprinted genes identified so far are organized into clusters. It has been suggested that the clustering of genes enables sharing of cis-acting elements located distances several kilobase pairs away. This notion is corroborated by the fact that the differentially methylated regions associated with the imprinted clusters play a crucial role in the maintenance of parent-of-origin-specific gene expression patterns which are hence called imprinting control regions (ICRs). The imprinted cluster at the distal end of mouse chromosome 7 and the orthologous human chromosome 11 has been extensively studied. It harbors six maternally expressed genes, Impt1, Ipl, Cdkn1c, Kcnq1, Ascl2, and H19, and the paternally expressed Kcnq1ot1, Ins2, and Igf2 genes (18, 20). Several lines of evidence obtained from mouse targeted deletion experiments suggest that this cluster is organized into two expression subdomains by two ICRs, those of H19 and Kcnq1 (3, 25). The mode of action of the H19 ICR has been well characterized, in contrast to that of the Kcnq1 ICR. The H19 ICR, located 2 kb upstream of the H19 promoter, controls the monoallelic expression of the H19 and Igf2 genes by insulating communication between the downstream H19 enhancers and the Igf2 promoter (10). The chromatin insulator property of the H19/Igf2 ICR is regulated by a chromatin insulator protein, CTCF (6, 11, 23).

The Kcnq1 ICR located in intron 10 of the Kcnq1 gene is methylated on the maternal chromosome, but on the paternal chromosome, it is unmethylated and associated with an antisense RNA, Kcnq1ot1 (13, 22). The significance of the Kcnq1 ICR in the imprinting of neighboring genes came from studies demonstrating that the KCNQ1 ICR is hypomethylated in 40% of sporadic Beckwith-Wiedemann syndrome (BWS) patients (13, 22). Recently, it has been documented that BWS patients with hypomethylation at the KCNQ1 ICR revealed a marked decrease in the expression of the nearby CDKN1C gene (1). Targeted deletion experiments of the 3.6-kb Kcnq1 ICR on a paternally inherited mouse chromosome 7 and a similar deletion on the human chromosome 11 propagated in human chicken hybrid cells revealed derepression of the normally silent paternal alleles of the Ipl, Slc22a1l, Cdkn1c, Kcnq1, Tssc4, and Ascl2 genes (3, 8). Taken together, these results strongly suggest that the Kcnq1 ICR plays a critical role in controlling the imprinting of neighboring genes

We and others have documented that the Kcnq1 ICR behaves as a bidirectional silencer (2, 15, 24). The bidirectional silencing function of the Kcnq1 ICR could be due to the presence of cis-acting elements, which inactivate neighboring reporter and endogenous genes by associating with transcriptional repressor molecules. Alternatively, the silencing could result from antisense RNA transcription. Although the Kcnq1 ICR associates with an antisense RNA on the paternal chromosome in a manner reminiscent of Igf2r, it is unclear whether the Kcnq1 ICR employs similar or distinct mechanisms in bidirectional silencing of neighboring genes (21, 29). Earlier studies have mapped the Kcnq1ot1 promoter to the three DNaseI-hypersensitive sites located 40 bp upstream of the Kcnq1ot1 start site (15). Here, we used genomic footprinting to fine map the transcription factor binding sites occupied when the Kcnq1 ICR is active. Using selective deletions of these binding sites as well as polyadenylation site insertion, we could show that the production of the Kcnq1ot1 RNA is essential for silencing activity in a manner that does not appear to involve double-stranded RNA (dsRNA)-mediated silencing of the flanking reporter genes. DNA methylation spreading over the flanking sequences, which occurs as a consequence of silencing (24), is lost in these mutants, suggesting that the production of Kcnq1ot1 RNA plays a critical role in the bidirectional spreading of inactive chromatin structures.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

 
In vivo footprinting. DNaseI and dimethyl sulfate (DMS) footprinting were performed as described previously (4). In brief, approximately five million Hep-3B cells, containing episomal plasmids with the Kcnq1 ICR, were permeabilized with 0.4% NP-40 and treated with 10 to 20 µg of DNase I at 4°C for 3 min. In a similar way, DNase I treatment was carried out on mouse fetal liver cells which had been made into single-cell suspensions by treatment of fetal liver tissue with trypsin at a 1-mg/ml final concentration for 30 min at 37°C. DNase I-treated DNA was extracted with phenol-chloroform. For DMS footprinting, about five million Hep-3B cells were treated with 0.1% DMS, and the DNA from the treated cells was prepared by using a genomic DNA preparation kit (Promega). Chemical sequencing reactions and piperidine cleavage were performed as described previously (4).

Ligation-mediated PCRs were carried out by using a procedure described previously (4). The primers used for footprinting were as follows: for the footprint 1 lower strand, GCAGGCTAGGTCGTACAA (primer 1), TGTTTCCTCTTGGCCAATAAAAATA (primer 2), and TGGCCAATAAAAATAGTCAGCACAGAGC (primer 3) were used; for the footprint 1 upper strand, TAGACCGTAACCACG (primer 1), AATCCAAAATGAGGCCGACCACACC (primer 2), and AAAATGAGGCCGACCACACCGGGCCT (primer 3) were used. The ligation-mediated PCRs were separated on a urea-5% acrylamide gel, dried, and autoradiographed.

Plasmid cloning strategies. Fp and CTCF deletions in the Kcnq1 ICR were made by creating AgeI restriction enzyme sites flanking the respective deletion by Stratagene quick-change site-directed mutagenesis followed by restriction digestion and religation. For the deletion of the whole DNase I footprint (Fp), AgeI sites were created 199 bp upstream of the Kcnq1ot1 start site (by changing TCCTGT to ACCGGT) by using forward primer 5'-GCT AGG TCG TAC AAA CCG GTA CAA GCT CAC CC-3' and reverse primer 5'-GGG TGA GCT TGT ACC GGT TTG TAC GAC CTA GC-3' and 150 bp downstream of the Kcnq1ot1 start site (by changing TACGGT to ACCGGT) by using forward primer 5'-TCT CCT CGG CGT GGT ACC GGT CTA GTA CACCT-3' and reverse primer 5'-AGG TGT ACT AGA CCG GTA CCA CGC CGA GGA GA-3'. For the CTCF deletion, AgeI sites were created 10 bp upstream of the Kcnq1ot1 start site (by changing ACCCGT to ACCGGT) by using primers GGTAGGTGGCCTACCGGTTGTCGCTAGGAGG and CCTCCTAGCGACAACCGGTAGGCCACCTACC and 150 bp downstream of the Kcnq1ot1 start site (this site was created by using primers as described above). The Kcnq1 ICR fragment carrying these deletions was cloned into the PH19 vector at a unique NotI site. The 510-bp simian virus 40 (SV40) polyadenylation sequence was amplified from the pREP4 vector (Invitrogen) by using primer sequences flanked with AgeI restriction sites 5'-TATAACCGGTCCGTAGTCAGGTTTAGTTCG-3' and 5'-TATAACCGGTCGCCATTTGACCATTCACCA-3'. The SV40 polyadenylation fragment was cloned into the Kcnq1 ICR fragment in the PS4 episomal plasmid at AgeI sites 150 bp downstream of the Kcnq1ot1 start site, created by site-directed mutagenesis with primers described above, and 750 bp downstream of the Kcnq1ot1 start site with primers 5'-TCTGAGTCAGCACGGCACCGGTCGCAAGTCCGCGT-3' and 5'-ACGCGGACTTGCGACCGGTGCCGTGCTGACTCAGA-3'. The episomal plasmid H19-PS4 was generated by digesting the PS4 episomal plasmid with BstZ17I, which removes the promoter and most of the coding region of the H19 gene, followed by religation.

Strand-specific RT-PCR. Reverse transcription-PCR (RT-PCR) analysis of gene expression was performed on strand-specific cDNA templates. Two micrograms of RNA was used as a template for cDNA synthesis with a mixture of strand-specific primers for the H19 gene (sense primer, 5'-GAATGTTGAAGGACTGAGGG-3'; antisense primer, 5'-CACGTCCTGTAACCAAAAGT-3') and for the hygromycin resistance gene (sense primer, 5'-TCCAGAAGAAGATGTTGGCG-3'; antisense primer, 5'-CGGTCAATACACTACATGGCG-3') as described previously (17). For GAPDH (glyceraldehyde-3-phosphate dehydrogenase) amplification, forward primer CCTTCATTGACCTCAAC and reverse primer AGTTGTCATGGATGACC were used. cDNAs were PCR amplified for 25 cycles (94°C for 45 s, 57°C for 30 s, and 72°C for 1 min). The PCR products were quantified with a Fuji FLA-3000 Phosphorimager.

The episome silencer-insulator assay. The pREP4-based episomal vectors were transfected into JEG-3 cells as described previously (10), and total RNA was extracted 4 days after transfection. The RNase protection assay (RPA) was performed as previously described with a 365-bp H19 antisense probe, a 150-bp GAPDH antisense probe as the control (10), and a 270-bp Kcnq1ot1 probe. Ten micrograms of RNA was hybridized with [-³⁵S]CTP-labeled antisense probes (600,000 cpm/reaction for H19 and Kcnq1ot1 and 40,000 cpm/reaction for GAPDH) overnight at 45°C. All procedures were performed according to the manufacturer's protocol for the RPAIII kit (Ambion). Quantification of individual protected fragments was done by using a Fuji FLA-3000 Phosphorimager. The H19 and Kcnq1ot1 expression was corrected with respect to both internal control (GAPDH) and episome copy number as determined by Southern blot analysis of BglII-restricted DNA hybridized with H19 and PDGFB probes (10).

To assess the effect of Kcnq1 ICR-mediated bidirectional silencing on a hygromycin resistance gene, equimolar concentrations of episome-based plasmids were transfected into JEG-3 cells. Following transfection, the cells were selected with 150 µg of hygromycin until all the cells died on the control plate, which contained the cells incubated with transfection reagent without any episomal plasmid DNA. Following selection, the drug-resistant colonies were stained with hematoxylin and counted.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

 
Genomic footprinting analysis of the Kcnq1ot1 promoter. Previously, three DNase I-hypersensitive sites around the Kcnq1ot1 promoter were fine mapped (9). An independent study revealed that the Kcnq1ot1 transcription start site maps to 40 bp downstream of the third DNase I-hypersensitive site (15). We were therefore interested in identifying the crucial cis-acting elements responsible for the Kcnq1ot1 promoter activity and relating this to the bidirectional silencing property of the Kcnq1 ICR. To this end, we used a genomic footprinting approach on episomal plasmid stably propagated in cultured cells containing the Kcnq1 ICR in the PS4 orientation (in which the Kcnq1ot1 transcript faces towards the H19 reporter gene) (see Fig. 2). As can be seen in Fig. 1A, one DNase I footprint spanning 300 to 350 bp was uncovered within the ICR. This footprint region appeared covered, almost continuously, with transcription factors. Bioinformatic analysis of this region suggested potential binding sites for the following factors: OCT-1, CCAAT, YY1, GATA, CTCF, and CREB (highlighted in boldface type in Fig. 1B). We could confirm CTCF and YY1 interaction within this region by chromatin immunoprecipitation analysis (data not shown). Changes of reactivity toward DMS were also observed within the DNase I footprinted regions (Fig. 1A). The most notable changes of reactivity were obtained at the putative YY1, GATA-1, CREB, and CTCF binding sites. We verified that the DNase I footprint obtained with our episome-based system was comparable to those found in vivo by carrying out genomic DNase I footprinting analysis of mouse fetal liver cells obtained from day 14.5 embryos. The footprints obtained from the episomal system and fetal liver cells are highly similar (data not shown), indicating that factor occupancy can be recapitulated in the episome-based system in a manner reminiscent of the in vivo situation.

View larger version (22K): [in this window] [in a new window]   FIG. 2. Targeted deletion of the promoter of Kcnq1ot1 results in the loss of bidirectional silencing. Left panel, arrangement of the wild-type and mutant Kcnq1 ICRs and the reporter H19 and hygromycin resistance genes within the episomal plasmids. The circles indicate the location of the SV40 enhancer present in all tested constructs. PH19 is the parent plasmid without ICR. In PS4, NS11, and PC3, the intact 3.6-kb ICR has been inserted into PH19 in various orientations and positions as shown. In AgeI-PS4, the Kcnq1 ICR mutated to introduce the AgeI sites flanking the footprinted region has been inserted in the PS4 orientation. Right panel, activity of the three genes analyzed for each construct shown as bar graphs. The activity of the reporter genes is represented as percent expression levels. For convenience, the activity of the control vectors (PH19 for H19 and hygromycin resistance genes and PS4 for the Kcnq1ot1 gene) was assigned a value of 100%, and the values obtained with mutant episomal plasmids were related to this value. The expression levels of the H19 (open bars) and Kcnq1ot1 (hatched bars) genes were quantified by RPA 4 days after transient transfection of the various episomes into JEG-3 cells. The percentages of expression levels were calculated after normalization against total input RNA by using GAPDH mRNA as an internal standard after correction for episomal copy numbers (quantified by Southern hybridization of DNA from transfected cells probed with both an episome-specific probe and, as an internal control probe, the PDGF gene). The hygromycin resistance gene activity (filled bars) was analyzed by counting the number of hygromycin-resistant clones. The mean of at least three independent experiments is indicated for each construct, with error bars showing deviation.

View larger version (43K): [in this window] [in a new window]   FIG. 1. Genomic footprinting analysis of the Kcnq1ot1 promoter. (A) DNase I and DMS genomic footprinting analyses of the lower and upper strands of the Kcnq1 ICR. The analyses were performed by using cultured cells transfected with the PS4 episomal plasmid containing the Kcnq1 ICR (Fig. 2). The genomic footprints were deduced by comparison with the pattern obtained following in vitro treatment with either DNase I or DMS of naked DNA (Naked). The DNase I footprint visible using cells transfected with the ICR is shown on the left-hand side. Guanine residues that were protected from DMS in cells are marked with stars, and those that showed hyperreactivity are marked with arrowheads. The numbering within the ICR is indicated in the middle. The transcription start site of Kcnq1ot1 gene is marked by a curved arrow. (B) Sequence of the upper strand of the Kcnq1ot1 promoter showing predicted cis-acting elements (boldface type), DNase I footprinted region on the upper strand (underlined type), and changes of reactivity toward DMS on the upper strand (represented by stars and arrowheads). The mutations that allowed creation of the AgeI sites used to target deletions of key binding sites are represented above the sequence.

Next, we set out to address the functional role of the transcription factor binding sites detected by genomic footprinting in the bidirectional silencing property of the Kcnq1 ICR. To this end, using site-directed mutagenesis, we introduced AgeI restriction sites into the Kcnq1ot1 promoter region within the Kcnq1 ICR in order to allow selective deletion of the footprinted region (Fig. 2). These mutations did not affect the activity of the ICR (compare AgeI-PS4 with PS4 in Fig. 2). Deletion of the whole DNase I footprint (Fp) resulted in a loss of Kcnq1ot1 transcription and a parallel loss of silencing of both the H19 and hygromycin resistance reporter genes (compare Fp-PS4 with PS4 and PH19 in Fig. 2). These results indicate that the corresponding fragment is essential for both Kcnq1ot1 transcription and silencing activity.

To explore the potential role of the CTCF target site in the Kcnq1 ICR function, we selectively deleted the DNase I footprint spanning the CTCF target site. The deletion encompassing the CTCF target site affected neither the Kcnq1ot1 transcription nor the bidirectional silencing activity of the Kcnq1 ICR (compare CTCF-PS4 with PH19 in Fig. 2). Even though the footprinted region is essential for Kcnq1 ICR activity, it is not sufficient, as the insertion of this fragment alone into PH19 provided neither Kcnq1ot1 promoter activity nor hygromycin resistance gene silencing activity (data not shown), suggesting that there are additional cis-acting elements playing a critical role in Kcnq1ot1 transcription. Taken together, mutagenic analysis of the Kcnq1ot1 promoter allowed better characterization of the elements essential for antisense transcription and revealed that there was an absolute correlation between Kcnq1ot1 transcription and bidirectional silencing activity for all constructs, thus pointing towards a key role for Kcnq1ot1 transcription in silencing.

Truncation of the Kcnq1ot1 RNA results in the loss of bidirectional silencing. Deletion of promoter elements could independently affect antisense transcription and bidirectional silencing. To check whether the antisense RNA has a direct role in the silencing property of the Kcnq1 ICR, we interfered with Kcnq1ot1 RNA production by inserting the SV40 polyadenylation sequence 0.15, 0.75, or 1.7 kb downstream from the transcription start site (Fig. 3A) and tested the effect of these insertions as described above. Kcnq1ot1 RNA was analyzed by RPA using a probe spanning the position 0.43 to 0.7 kb downstream from the start site. The insertion of the polyadenylation sequence indeed truncated the Kcnq1ot1 RNA, as no RNA was detected with the probe hybridizing downstream of the inserted sequence in the PS4-polyA0.15 construct (Fig. 3B). When the polyadenylation sequence was inserted 0.75 and 1.5 kb downstream, the detection of high levels of Kcnq1ot1 RNA revealed that the inserted sequence did not affect promoter activity (Fig. 3B). However, even though the antisense promoter is fully functional, the bidirectional silencing property of the Kcnq1 ICR is lost upon the polyadenylation sequence insertions, as revealed by the analysis of H19 and hygromycin resistance reporter gene expression (Fig. 3B). Thus, it is not the promoter activity per se but the production of the Kcnq1ot1 RNA that is important for silencing.

View larger version (20K): [in this window] [in a new window]   FIG. 3. Truncation of Kcnq1ot1 RNA by the SV40 polyadenylation sequence results in the loss of bidirectional silencing. (A) Diagram depicting the insertions of the SV40 polyadenylation sequence [poly(A) site] at 0.15, 0.75, and 1.7 kb downstream from the Kcnq1ot1 transcription start site within the PS4 construct. (B) Left panel, arrangement of the ICR and reporter genes in the constructs tested with the various polyadenylation sequence insertions shown in Fig. 3A; right panel, bar graph showing the corresponding relative expression levels of the H19, Kcnq1ot1, and hygromycin resistance genes normalized as described in the legend of Fig. 2.

View larger version (54K): [in this window] [in a new window]   FIG. 4. Overlapping transcription of Kcnq1ot1 and H19 occurs sometimes but is not essential for silencing. (A) Left panel, maps of the episomal plasmids analyzed; right panel, autoradiogram of an RPA showing that antisense transcription in the H19 coding region occurs only with the PS4 construct and is thus not correlated to H19 activity. (B) RT-PCR analyses of the sense (S) and antisense (AS) transcription occurring within the H19 and hygromycin resistance (HmR) genes within the PS4 and PC3 constructs. –RT is a no-reverse-transcriptase control. GAPDH is an internal control corresponding to RT-PCR detection of the GAPDH mRNA. (C) Left panel, maps of the PS4 episomal plasmid with the H19 gene deletion and of the control plasmid analyzed; right panel, bar graph showing the relative levels of corresponding hygromycin resistance gene activities.

Absence of methylation spreading in the truncated Kcnq1ot1 RNA and Kcnq1ot1 promoter mutants. It was previously documented that the Kcnq1 ICR has a capacity to spread DNA methylation over the flanking H19 reporter gene and that this feature occurred as a consequence of silencing (24). In this investigation, we have shown that the production of antisense RNA is crucial for bidirectional silencing. Therefore, we were interested in determining whether the production of the Kcnq1ot1 RNA could be linked to the spreading of DNA methylation over the flanking H19 reporter gene. To this end, we carried out Southern blot hybridization analysis using the methylation-sensitive restriction enzyme HhaI (Fig. 5A) on the episomes carrying the Kcnq1 ICR with Kcnq1ot1 promoter deletions and SV40 polyadenylation sequence insertions at various positions. In this analysis, in the absence of DNA methylation, BamHI/HhaI cleavages generate three bands at 0.67, 0.8, and 0.95 kb. Methylation of the three HhaI sites results in the appearance of a 2.5-kb band. The DNA methylation analysis was performed 9 days after transfection and at that time revealed partial methylation of the H19 gene. It was previously documented that DNA methylation occurs as a consequence of silencing, as the silencing of the H19 gene precedes DNA methylation. In addition, it has been shown that methylation intensity over the H19 gene progressively increases with time in culture (24). This level of CpG methylation was lost when the length of the Kcnq1ot1 RNA was reduced by the insertion of the polyadenylation sequence and by the deletions of the Kcnq1ot1 promoter that resulted in the loss of Kcnq1ot1 transcription, namely, Fp but not CTCF (Fig. 5B). Despite the overloading of the PS4-poly(A) episomal DNA, no methylation of either HhaI site was detected. Taken together, these observations suggest that the Kcnq1ot1 RNA is directly or indirectly involved in the spreading of DNA methylation over the flanking H19 reporter gene.

View larger version (56K): [in this window] [in a new window]   FIG. 5. CpG methylation spreading promoted by the Kcnq1 ICR is lost upon Kcnq1ot1 promoter deletions or polyadenylation site insertions. (A) Diagram showing the region of the PS4 plasmid that was analyzed for methylation. Below the H19 coding and promoter regions, the HhaI sites used to assess the methylation status are represented alongside the BamHI sites used. The indicated 2.5-kb BamHI fragment was used as a probe. (B) Southern blot showing that the methylation of the H19 promoter, which is seen with the wild-type Kcnq1 ICR, is lost upon Kcnq1ot1 promoter deletions and polyadenylation site insertions.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Previous work has documented that the Kncq1 ICR is responsible for long-range silencing (3, 24). Our observations documented here suggest that this feature involves the transcript of the Kcnq1ot1 gene. The evidence for this conclusion is based primarily on the effects of the introduction of transcriptional termination signals 0.15, 0.75, and 1.7 kb away from the transcriptional start site. In each instance, including that of the mutant that left the entire coding potential of the Kcnq1 ICR fragment [poly(A), 1.7 kb] intact, the bidirectional silencing property was significantly reduced. While it was a formal possibility that the antisense RNA silencing depended on a dsRNA effect by annealing to the sense transcripts in the PS4 orientation (towards the H19 gene), the removal of the H19 promoter and a major part of the H19 gene neutralized H19 expression without reducing the silencing effect. In addition, silencing was not affected by the modification of the position and orientation of the Kcnq1 ICR fragment relative to the H19 gene, as exemplified in the NS11 and PC3 episomal constructs, and gene silencing occurred irrespective of dsRNA production within the repressed genes, as exemplified for the H19 gene in the PC3 construct or the hygromycin resistance gene in the PS4 construct. The transcripts generated from the Kcnq1ot1 promoter in the PS4, PC3, and PS4-polyA1.7 constructs all have the 1.7-kb-long Kcnq1ot1 5' end in common, but they end at different positions. When silencing is not induced (PS4-polyA1.7), the transcript ends shortly after the ICR fragment. When silencing is induced, the transcripts are much longer. With the PS4 construct, it is at least 5 kb long and its 3' part consists of the antisense H19 sequence. With the PC3 construct, it is presumably 6.0 kb long and its 3' part consists of the sense hygromycin resistance gene sequence, as it is likely to be terminated at the polyadenylation sequence of the hygromycin resistance gene since no antisense H19 RNA was detected. This finding suggests that the silencing by the Kcnq1 ICR requires the Kcnq1ot1 transcription beyond the Kcnq1 ICR fragment irrespective of the identity of the region transcribed. We therefore propose that the silencing property of the Kcnq1ot1 transcript is intimately related to the duration of its association with the site of transcription. The prolongation of the transcriptional process might simply increase its chances of recruiting silencing factors. These considerations could also apply to the Air transcript of the Igf2r locus which, like the Kcnq1ot1 transcript, is a bidirectional silencer and extends more than 100 kb from its transcriptional start site (14). While this fact has prompted suggestions that the Air transcript inactivates Igf2r by promoter occlusion, this can hardly apply to the Kcnq1ot1 transcript which does not extend to the Kcnq1 sense promoter (16).

Based on earlier literature, it is clear that RNA can trigger silencing in at least two distinct ways. In one way, dsRNA formed as a result of overlapping transcripts triggers RNAi, resulting in targeted recruitment of heterochromatic complexes to specific chromosomal loci (19, 26). Alternatively, the newly transcribed RNA may directly recruit repressor complexes, thereby silencing neighboring genes, as exemplified in the case of Xist (28). We reason that the antisense RNA-mediated silencing of genes located on both sides of the Kcnq1 ICR might be similar to the latter alternative, as silencing is restricted not only to overlapping genes but also to nonoverlapping genes. An earlier study has compared the process of X inactivation and genomic imprinting with RNAi-mediated heterochromatinization in Schizosaccharomyces pombe (27). We believe that such a process may not be applicable in the Kcnq1 ICR-mediated silencing. However, it cannot be ruled out that a dsRNA specifically involving the Kcnq1ot1 RNA triggers repeat-associated small-interfering RNA-mediated heterochromatinization that subsequently spreads to the neighboring region (5).

It was previously documented that there is a temporal delay between silencing and DNA methylation spreading, suggesting that there is an intermediate step in the silencing process (24). This situation is reminiscent of what is seen in the Xist-mediated X inactivation. The loss of methylation spreading in the truncated versions of Kcnq1ot1 RNA due to a poly(A) site insertion at various positions in the Kcnq1 ICR points to the possibility that the Kcnq1ot1 RNA may be involved in the heterochromatinization of flanking sequences. We presume that Kcnq1ot1 transcription results in the recruitment of silencing factors associated with histone deacetylases and histone methyltransferases, thus modifying the chromatin into an inactive state, which later forms a target for DNA methylation.

Our observation that the transcription product of the Kcnq1ot1 gene has silencing properties brings up a paradox which it has in common with other antisense transcripts such as Tsix and Air (12, 21). How does the antisense gene escape the silencing effects of its own transcript? The DNaseI footprints provide a potential key to this enigma since they cover a range of potential transcription factor binding sites such as CTCF, OCT-1, and GATA-1, all of which have been implicated in the maintenance of transcriptionally active chromatin. It is therefore possible that these sites have dual properties by being responsible not only for basal transcription but also for maintaining transcriptionally active chromatin that protects or prevents bidirectional silencing on the paternal allele from spreading into this region. Consistent with this view, it has been demonstrated in a recent report that the promoter of the Kcnq1ot1 on the paternal chromosome is acetylated on the tails of histones H3 and H4 and methylated at lysine 4 of H3, which is a signature for active chromatin, while on the maternal allele, lysine 9 methylation, which is a signature for inactive chromatin, is observed (7).

	ACKNOWLEDGMENTS

 
We thank Joanne Whitehead for critical review of the manuscript.

This work was supported by grants from Göran Gustafssons Stiftelse, the Swedish Research Council (VR), and the Swedish Cancer Research foundation to C.K. R.O. was supported by grants from the Swedish Research Council (VR), the Swedish Cancer Foundation, the Lundberg Foundation, and the Wallenberg Foundation. T.G. and H.T. were supported by a grant from the Association de Recherche sur le Cancer.

	FOOTNOTES

 
* Corresponding author. Mailing address: Department of Development and Genetics, Evolution Biology Centre, Uppsala University, Norbyvägen 18A, S-752 36 Uppsala, Sweden. Phone: 0046 70 9600450. Fax: 0046 18 4712678. E-mail: kanduri.chandrasekhar{at}ebc.uu.se.

N.T. and V.K.T. contributed equally to this work.

	REFERENCES

Top Abstract Introduction Materials and Methods Results Discussion References

 
1. Diaz-Meyer, N., C. D. Day, K. Khatod, E. R. Maher, W. Cooper, W. Reik, C. Junien, G. Graham, E. Algar, V. M. Der Kaloustian, and M. J. Higgins. 2003. Silencing of CDKN1C (p57^KIP2) is associated with hypomethylation at KvDMR1 in Beckwith-Wiedemann syndrome. J. Med. Genet. 40:797-801.[Abstract/Free Full Text]

2. Du, M., L. G. Beatty, W. Zhou, J. Lew, C. Schoenherr, R. Weksberg, and P. D. Sadowski. 2003. Insulator and silencer sequences in the imprinted region of human chromosome 11p15.5. Hum. Mol. Genet. 12:1927-1939.[Abstract/Free Full Text]

3. Fitzpatrick, G. V., P. D. Soloway, and M. J. Higgins. 2002. Regional loss of imprinting and growth deficiency in mice with targeted deletion of KvDMR1. Nat. Genet. 32:426-431.[CrossRef][Medline]

4. Grange, T., E. Bertrand, M. L. Espinas, M. Fromont-Racine, G. Rigaud, J. Roux, and R. Pictet. 1997. In vivo footprinting of the interaction of proteins with DNA and RNA. Methods 11:151-163.[CrossRef][Medline]

5. Hamilton, A., O. Voinnet, L. Chappell, and D. Baulcombe. 2002. Two classes of short interfering RNA in RNA silencing. EMBO J. 21:4671-4679.[CrossRef][Medline]

6. Hark, A. T., C. J. Schoenherr, D. J. Katz, R. S. Ingram, J. M. Levorse, and S. M. Tilghman. 2000. CTCF mediates methylation-sensitive enhancer-blocking activity at the H19/Igf2 locus. Nature 405:486-489.[CrossRef][Medline]

7. Higashimoto, K., T. Urano, K. Sugiura, H. Yatsuki, K. Joh, W. Zhao, M. Iwakawa, H. Ohashi, M. Oshimura, N. Niikawa, T. Mukai, and H. Soejima. 2003. Loss of CpG methylation is strongly correlated with loss of histone H3 lysine 9 methylation at DMR-LIT1 in patients with Beckwith-Wiedemann syndrome. Am. J. Hum. Genet. 73:948-956.[CrossRef][Medline]

8. Horike, S., K. Mitsuya, M. Meguro, N. Kotobuki, A. Kashiwagi, T. Notsu, T. Schulz, Y. Shirayoshi, and M. Oshimura. 2000. Targeted disruption of the human LIT1 locus defines a putative imprinting control element playing an essential role in Beckwith-Wiedemann syndrome. Hum. Mol. Genet. 9:2075-2083.[Abstract/Free Full Text]

9. Kanduri, C., G. Fitzpatrick, R. Mukhopadfhyay, M. Kanduri, V. Lobanenkov, M. Higgins, and R. Ohlsson. 2002. A differentially methylated imprinting control region within the Kcnq1 locus harbours a methylation-sensitive chromatin insulator. J. Biol. Chem. 277:18106-18110.[Abstract/Free Full Text]

10. Kanduri, C., C. Holmgren, G. Franklin, M. Pilartz, E. Ullerås, M. Kanduri, L. Liu, V. Ginjala, E. Ullerås, R. Mattsson, and R. Ohlsson. 2000. The 5' flank of the murine H19 gene in an unusual chromatin conformation unidirectionally blocks enhancer-promoter communication. Curr. Biol. 10:449-457.[CrossRef][Medline]

11. Kanduri, C., V. Pant, D. Loukinov, E. Pugacheva, C.-F. Qi, A. Wolffe, R. Ohlsson, and A. Lobanenkov. 2000. Functional interaction of CTCF with the insulator upstream of the H19 gene is parent of origin-specific and methylation-sensitive. Curr. Biol. 10:853-856.[CrossRef][Medline]

12. Lee, J. T., L. S. Davidow, and D. Warshawsky. 1999. Tsix, a gene antisense to Xist at the X-inactivation centre. Nat. Genet. 21:400-404.[CrossRef][Medline]

13. Lee, M., M. DeBaun, K. Mitsuya, H. Galonek, S. Brandenburg, M. Oshimura, and A. Feinberg. 1999. Loss of imprinting of a paternally expressed transcript, with antisense orientation to KVLQT1, occurs frequently in Beckwith-Wiedemann syndrome and is independent of insulin-like growth factor II imprinting. Proc. Natl. Acad. Sci. USA 96:5203-5208.[Abstract/Free Full Text]

14. Lyle, R., D. Watanabe, D. te Vruchte, W. Lerchner, O. W. Smrzka, A. Wutz, J. Schageman, L. Hahner, C. Davies, and D. P. Barlow. 2000. The imprinted antisense RNA at the Igf2r locus overlaps but does not imprint Mas1. Nat. Genet. 25:19-21.[CrossRef][Medline]

15. Mancini-DiNardo, D., S. J. Steele, R. S. Ingram, and S. M. Tilghman. 2003. A differentially methylated region within the gene Kcnq1 functions as an imprinted promoter and silencer. Hum. Mol. Genet. 12:283-294.[Abstract/Free Full Text]

16. Mitsuya, K., M. Meguro, M. P. Lee, M. Katoh, T. C. Schulz, H. Kugoh, M. A. Yoshida, N. Niikawa, A. P. Feinberg, and M. Oshimura. 1999. LIT1, an imprinted antisense RNA in the human KvLQT1 locus identified by screening for differentially expressed transcripts using monochromosomal hybrids. Hum. Mol. Genet. 8:1209-1217.[Abstract/Free Full Text]

17. Newall, A. E., S. Duthie, E. Formstone, T. Nesterova, M. Alexiou, C. Johnston, M. L. Caparros, and N. Brockdorff. 2001. Primary non-random X inactivation associated with disruption of Xist promoter regulation. Hum. Mol. Genet. 10:581-589.[Abstract/Free Full Text]

18. Onyango, P., W. Miller, J. Lehoczky, C. T. Leung, B. Birren, S. Wheelan, K. Dewar, and A. P. Feinberg. 2000. Sequence and comparative analysis of the mouse 1-megabase region orthologous to the human 11p15 imprinted domain. Genome Res. 10:1697-1710.[Abstract/Free Full Text]

19. Pal-Bhadra, M., B. A. Leibovitch, S. G. Gandhi, M. Rao, U. Bhadra, J. A. Birchler, and S. C. Elgin. 2004. Heterochromatic silencing and HP1 localization in Drosophila are dependent on the RNAi machinery. Science 303:669-672.[Abstract/Free Full Text]

20. Paulsen, M., O. El-Maarri, S. Engemann, M. Strodicke, O. Franck, K. Davies, R. Reinhardt, W. Reik, and J. Walter. 2000. Sequence conservation and variability of imprinting in the Beckwith-Wiedemann syndrome gene cluster in human and mouse. Hum. Mol. Genet. 9:1829-1841.[Abstract/Free Full Text]

21. Sleutels, F., R. Zwart, and D. P. Barlow. 2002. The non-coding Air RNA is required for silencing autosomal imprinted genes. Nature 415:810-813.[Medline]

22. Smilinich, N., C. Day, G. Fitzpatrick, G. Caldwell, A. Lossie, P. Cooper, A. Smallwood, J. Joyce, P. Schofield, W. Reik, R. Nicholls, R. Weksberg, D. Driscoll, E. Maher, T. Shows, and M. Higgins. 1999. A maternally methylated CpG island in KvLQT1 is associated with an antisense paternal transcript and loss of imprinting in Beckwith-Wiedemann syndrome. Proc. Natl. Acad. Sci. USA 96:8064-8069.[Abstract/Free Full Text]

23. Szabó, P., S.-H. Tang, A. Rentsendorj, G. Pfeifer, and J. Mann. 2000. Maternal-specific footprints at putative CTCF sites in the H19 imprinting control region give evidence for insulator function. Curr. Biol. 10:607-610.[CrossRef][Medline]

24. Thakur, N., M. Kanduri, C. Holmgren, R. Mukhopadhyay, and C. Kanduri. 2003. Bidirectional silencing and DNA methylation-sensitive methylation-spreading properties of the Kcnq1 imprinting control region map to the same regions. J. Biol. Chem. 278:9514-9519.[Abstract/Free Full Text]

25. Thorvaldsen, J. L., K. L. Duran, and M. S. Bartolomei. 1998. Deletion of the H19 differentially methylated domain results in loss of imprinted expression of H19 and Igf2. Genes Dev. 12:3693-3702.[Abstract/Free Full Text]

26. Verdel, A., S. Jia, S. Gerber, T. Sugiyama, S. Gygi, S. I. Grewal, and D. Moazed. 2004. RNAi-mediated targeting of heterochromatin by the RITS complex. Science 303:672-676.[Abstract/Free Full Text]

27. Volpe, T. A., C. Kidner, I. M. Hall, G. Teng, S. I. Grewal, and R. A. Martienssen. 2002. Regulation of heterochromatic silencing and histone H3 lysine-9 methylation by RNAi. Science 297:1833-1837.[Abstract/Free Full Text]

28. Wutz, A., T. P. Rasmussen, and R. Jaenisch. 2002. Chromosomal silencing and localization are mediated by different domains of Xist RNA. Nat. Genet. 30:167-174.[CrossRef][Medline]

29. Zwart, R., F. Sleutels, A. Wutz, A. H. Schinkel, and D. P. Barlow. 2001. Bidirectional action of the Igf2r imprint control element on upstream and downstream imprinted genes. Genes Dev. 15:2361-2366.[Abstract/Free Full Text]

This article has been cited by other articles:

• Carlile, M., Nalbant, P., Preston-Fayers, K., McHaffie, G. S., Werner, A. (2008). Processing of naturally occurring sense/antisense transcripts of the vertebrate Slc34a gene into short RNAs. Physiol. Genomics 34: 95-100 [Abstract] [Full Text]  
• Mohammad, F., Pandey, R. R., Nagano, T., Chakalova, L., Mondal, T., Fraser, P., Kanduri, C. (2008). Kcnq1ot1/Lit1 Noncoding RNA Mediates Transcriptional Silencing by Targeting to the Perinucleolar Region. Mol. Cell. Biol. 28: 3713-3728 [Abstract] [Full Text]  
• Mercer, T. R., Dinger, M. E., Sunkin, S. M., Mehler, M. F., Mattick, J. S. (2008). Specific expression of long noncoding RNAs in the mouse brain. Proc. Natl. Acad. Sci. USA 105: 716-721 [Abstract] [Full Text]  
• Dallosso, A. R., Hancock, A. L., Malik, S., Salpekar, A., King-Underwood, L., Pritchard-Jones, K., Peters, J., Moorwood, K., Ward, A., Malik, K. T.A., Brown, K. W. (2007). Alternately spliced WT1 antisense transcripts interact with WT1 sense RNA and show epigenetic and splicing defects in cancer. RNA 13: 2287-2299 [Abstract] [Full Text]  
• Royo, H., Basyuk, E., Marty, V., Marques, M., Bertrand, E., Cavaille, J. (2007). Bsr, a Nuclear-retained RNA with Monoallelic Expression. Mol. Biol. Cell 18: 2817-2827 [Abstract] [Full Text]  
• Fitzpatrick, G. V., Pugacheva, E. M., Shin, J.-Y., Abdullaev, Z., Yang, Y., Khatod, K., Lobanenkov, V. V., Higgins, M. J. (2007). Allele-Specific Binding of CTCF to the Multipartite Imprinting Control Region KvDMR1. Mol. Cell. Biol. 27: 2636-2647 [Abstract] [Full Text]  
• Prasanth, K. V., Spector, D. L. (2007). Eukaryotic regulatory RNAs: an answer to the 'genome complexity' conundrum. Genes Dev. 21: 11-42 [Abstract] [Full Text]  
• Haddad, F., Qin, A. X., Bodell, P. W., Zhang, L. Y., Guo, H., Giger, J. M., Baldwin, K. M. (2006). Regulation of antisense RNA expression during cardiac MHC gene switching in response to pressure overload. Am. J. Physiol. Heart Circ. Physiol. 290: H2351-H2361 [Abstract] [Full Text]  
• Mancini-DiNardo, D., Steele, S. J.S., Levorse, J. M., Ingram, R. S., Tilghman, S. M. (2006). Elongation of the Kcnq1ot1 transcript is required for genomic imprinting of neighboring genes.. Genes Dev. 20: 1268-1282 [Abstract] [Full Text]  
• Monk, D., Arnaud, P., Apostolidou, S., Hills, F. A., Kelsey, G., Stanier, P., Feil, R., Moore, G. E. (2006). From the Cover: Limited evolutionary conservation of imprinting in the human placenta. Proc. Natl. Acad. Sci. USA 103: 6623-6628 [Abstract] [Full Text]  
• Werner, A., Berdal, A. (2005). Natural antisense transcripts: sound or silence?. Physiol. Genomics 23: 125-131 [Abstract] [Full Text]  
• Diaz-Meyer, N, Yang, Y, Sait, S N, Maher, E R, Higgins, M J (2005). Alternative mechanisms associated with silencing of CDKN1C in Beckwith-Wiedemann syndrome. J. Med. Genet. 42: 648-655 [Abstract] [Full Text]  
• O'Neill, M. J. (2005). The influence of non-coding RNAs on allele-specific gene expression in mammals. Hum Mol Genet 14: R113-R120 [Abstract] [Full Text]  
• Cerrato, F., Sparago, A., Matteo, I. D., Zou, X., Dean, W., Sasaki, H., Smith, P., Genesio, R., Bruggemann, M., Reik, W., Riccio, A. (2005). The two-domain hypothesis in Beckwith-Wiedemann syndrome: autonomous imprinting of the telomeric domain of the distal chromosome 7 cluster. Hum Mol Genet 14: 503-511 [Abstract] [Full Text]  
• Pandey, R. R., Ceribelli, M., Singh, P. B., Ericsson, J., Mantovani, R., Kanduri, C. (2004). NF-Y Regulates the Antisense Promoter, Bidirectional Silencing, and Differential Epigenetic Marks of the Kcnq1 Imprinting Control Region. J. Biol. Chem. 279: 52685-52693 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Thakur, N. Articles by Kanduri, C. Search for Related Content PubMed PubMed Citation Articles by Thakur, N. Articles by Kanduri, C.