Molecular and Cellular Biology, October 2004, p. 8323-8331, Vol. 24, No. 19
0270-7306/04/$08.00+0 DOI: 10.1128/MCB.24.19.8323-8331.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Eun Jig Lee, and J. Larry Jameson*
Division of Endocrinology, Metabolism, and Molecular Medicine, Northwestern University Feinberg School of Medicine, Chicago, Illinois
Received 14 March 2004/ Returned for modification 20 April 2004/ Accepted 2 July 2004
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
In cotransfection experiments, however, there is reason to doubt the assumption that transfected molecules always remain separate from one another. For example, it is known that stable transfectants often carry multiple, concatenated linearized plasmids (8, 16), suggestive of ligation between transfected circular plasmids before integration. The ability of a selectable marker to cointegrate with another gene is used to select stably transfected cells, probably because there is frequent cointegration of the two plasmids into the same site in the genome (2). These findings imply that a substantial portion of transfected DNA molecules can be ligated to one another before integration.
One possible mechanism of ligation is homologous recombination, which could occur through a homologous sequence, such as ori. However, in view of frequent integration of concatenated plasmids, homologous recombination is unlikely to account for this phenomenon. An alternative mechanism is nonhomologous end joining (NHEJ). DNA molecules introduced into cells are prone to double-strand breaks (DSBs), which allow cells to ligate them regardless of whether the two DNA ends are compatible, blunt, or mismatched (19). NHEJ involves many cellular factors, including DNA-dependent protein kinase, XRCC4, DNA ligase IV, and other components (18). NHEJ is relatively efficient and has been shown to recircularize transfected linearized plasmids (11, 17).
We observed that cotransfected reporter genes exhibit enhancer responses that were initially present on only one of the two reporter plasmids. We hypothesized that heteroligation of cointroduced DNA molecules might account for this effect by transferring an enhancer from one molecule to the other.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Vectors. The pGL3 promoter vector SV-FL carries the firefly luciferase (FL) gene driven by the simian virus 40 (SV40) promoter. The phRL-TK vector TK-RL expresses the synthetic Renilla luciferase (RL) gene under the control of the herpes simplex virus thymidine kinase (HSV-TK) promoter. The phRL-CMV vector CMV-RL contains the RL gene driven by the cytomegalovirus (CMV) enhancer and promoter. These three plasmids were purchased from Promega (Madison, Wis.). The bovine growth hormone poly(A) sequence was obtained from pVAX1 (Invitrogen, Carlsbad, Calif.).
E-SV-FL, 3E-SV-FL (10), 3mE-SV-FL, CMVE-SV-FL, and NONE-SV-FL were constructed by inserting one estrogen response element (ERE) (GTCAGGTCACAGTGACCTGA), three EREs, three mutated EREs (GTCgtcgCACAGTGAtCaGA x 3), CMV enhancer (CMVE) (bases 3 to 657 of pCI-neo [Promega]), and its same-length negative control sequence NONE (bases 2517 to 3171 of pCI-neo) immediately before the SV40 promoter of SV-FL. SV-RL and 3E-SV-RL were constructed by switching the FL sequence of SV-FL and 3E-SV-FL with the RL gene. L-TK-RL and L-TATA-RL are linear reporters expressing RL under the control of the HSV-TK promoter and the minimal TATA box of the HSV-TK promoter starting from CATATTAAGG, respectively. They were excised from amplified plasmids and gel purified before transfection.
TK-RL-3(m)E-SV-FL-CMVE and TK-RL-3(m)E-SV-FL-NONE contain both the FL-expressing segment and the RL-expressing segment, which were inserted counterclockwise into the NotI site and bear (m)ERE x 3 and the CMVE or NONE, which was inserted into the BamHI site located immediately before the SalI site.
AdSV-FL is an adenoviral FL reporter constructed by using the sequence from SV-FL. AdCMV carries the CMVE and the CMV promoter, and AdAAT contains the human
1-antitrypsin gene promoter (721 to + 44), which is active only in hepatocytes (4). In all adenoviral vectors, the E1a region (bases 393 to 1339) of the wild-type adenovirus type 5 309/356 was deleted. Recombinant adenoviruses were amplified and titrated as previously described (12).
Reporter gene introduction and luciferase assays. For experiments using (m)ERE-bearing reporters, MCF-7 cells were seeded into 6-cm dishes (6 x 105 cells in 2.5 ml of DMEM-F12w/dcsFBS per dish) the day before transfection. Unless mentioned otherwise, 750 fmol of each reporter was transfected into one dish by incubating cells with either liposome-DNA complexes for 4 h (1) or calcium phosphate (CaP)-DNA precipitates for 6 h. Immediately after transfection, cells were trypsinized, mixed, and split into 24-well plates at a density of 1 x 105 cells per well, such that transfection efficiency would be equal among the wells. Twenty-four hours posttransfection, the medium was replaced with fresh medium containing either vehicle (0.1% [vol/vol] ethanol) or 1 nM E2 in triplicate. Cells were further cultured for 24 h, harvested in 1x Passive Lysis Buffer (Promega) and measured for FL activity as previously described (5). RL activity was measured using the Renilla luciferase assay kit (Promega), and protein concentration was determined by using the protein assay solution (Bio-Rad, Hercules, Calif.). FL and RL activities were normalized based on protein concentration. UV irradiation of plasmids was performed by placing plasmid droplets on a UV transilluminator (Foto/UV300; FOTODYNE, Hartland, Wis.) for 10 min.
In experiments using CMVE-SV-FL, DMEM-F12-containing regular FBS was used. MCF-7 cells (6 x 105) were transfected with the indicated amounts of plasmids in triplicate. Transfected cells were equally split into two dishes and cultured for 48 h. One dish was harvested for FL and RL assays, and the other was used for extraction of DNA, from which a genomic DNA segment (
1-antitrypsin gene promoter) (primers: 5'-GCATGCTTGGGAATGAAACT-3' and 5'-ATTCACTGTCCCAGGTCA-3' ) and a segment of TK-RL (primers: 5'-GTCCCAGGTCCACTTCGCATATTAAGG-3' and 5'-GCTTAAGTTCGAGACTGTTGTGTCAGAA-3') were simultaneously PCR amplified and electrophoresed in order to estimate the amount of transfected TK-RL relative to genomic DNA.
Adenoviral infection was performed with DMEM-F12 supplemented with regular FBS. Forty-eight hours after the first gene introduction (transfection or infection), FL activity was measured and normalized based on protein concentration.
When luciferase activities in vehicle- and E2-treated cells were compared, Student's t test was performed. In the FL assays after adenoviral infection, multivariate analyses were performed by analysis of variance followed by Fisher's protected least significant difference. In each graph, bars show means and standard deviations.
Analysis of NHEJ products in transfected cells. DNA was extracted from transfected cells by using the DNeasy Tissue kit (QIAGEN, Valencia, Calif.). Isolated DNA was used as a template for PCR, and the NHEJ-mediated ligation was detected with primers KpnF and NheH. PCR products were electrophoresed, and DNA corresponding to approximately 150 to1,000 bp was purified, digested with NheI and KpnI, and ligated into the polylinker region of SV-FL. NHEJ products from 10 independent clones were sequenced, using RVprimer3 (Promega). KOD polymerase (Novagen, Hartland, Wis.) was used for all PCRs.
| RESULTS |
|---|
|
|
|---|
|
|
|
The enhancer transfer effect is dependent on the amount of ERE-containing plasmid in the liposome-mediated transfection mixture. When the amounts of 3E-SV-FL and TK-RL were reduced from 750 to 75 fmol, the E2-induced effect on RL activity decreased whereas the fold induction of FL by E2 was unchanged (data not shown). In contrast to liposome transfection, when CaP was used to cotransfect 3E-SV-FL and TK-RL, the transfer of ERE activity was negligible (Fig. 3B). This difference was not attributable to lower transfection efficiency, as there was minimal ERE transfer even when the amount of 3E-SV-RL plasmid was increased to a level that resulted in greater FL activity than in liposome-transfected cells (data not shown). These results suggest that the enhancer transfer phenomenon depends on the method of transfection as well as the amount of DNA.
Impact of plasmid structure on enhancer transfer. When CaP was used to transfect linearized plasmids, the enhancer transfer effect was readily seen. As shown in Fig. 3B, SalI-digested 3E-SV-FL and BglII-digested TK-RL generated a stronger enhancer transfer effect than circular plasmids. Pretreatment of plasmids with UV light, which is known to generate DSBs, also enhanced the ERE transfer. After CaP transfection of UV-treated 3E-SV-FL and TK-RL, E2 increased RL activity about threefold (Fig. 3B), although the absolute levels of FL and RL were lower because of partial plasmid degradation. These results indicate that the presence of DSBs is associated with a greater enhancer transfer effect.
Evidence of nonhomologous end joining ligation between cotransfected plasmids. PCR using primers specific for each of two separate plasmids was used to assay directly for NHEJ (Fig. 4A). Using KpnF and NheH primers, PCR was performed on DNA extracted from cells after liposome transfection with circular 3E-SV-FL and TK-RL. This PCR resulted in DNA smears of variable length (Fig. 4A, lane 3). In contrast, PCR of DNA from cells liposome transfected with linearized SalI-digested 3E-SV-FL and BglII-digested TK-RL generated a more uniform product (Fig. 4A, lane 1), consistent with NHEJ between the SalI end of 3E-SV-FL and the BglII end of TK-RL. NHEJ products between two SalI ends of 3E-SV-FL or two BglII ends of TK-RL were not PCR amplified, perhaps because of predicted hairpin secondary structures of their sense and antisense strands. PCR of DNA isolated from cells CaP transfected with circular or linearized 3E-SV-FL and TK-RL produced similar, but less abundant, smears (data not shown). The DNA smears were not seen when cells were separately transfected with either 3E-SV-FL or TK-RL alone and DNA from these cells was combined and used as the PCR template (Fig. 4A, lanes 2 and 4).
|
Evidence for transfer of CMVE activity between plasmids. The enhancer transfer effect also occurred with the CMVE, which is commonly used in expression vectors. Both FL and RL activities were higher in MCF-7 cells liposome transfected with CMVE-SV-FL and TK-RL than in cells transfected with an equimolar amount of a non-CMVE-containing control (NONE-SV-FL) and TK-RL. PCR amplification of a genomic DNA sequence and a segment from TK-RL confirmed comparable transfection efficiency (Fig. 5). Similar results were obtained with CHO-K1, HeLa, BHK-21, and HEK293 cells, although the degree of the enhancer transfer effect varied among cell lines and by transfection technique (liposome > CaP) (data not shown). Thus, the enhancer transfer effect is seen with either an ERE or with the CMVE, indicating that this phenomenon occurs with different types of enhancers.
|
|
Evidence for functional interactions between transferred enhancers. In the absence of E2, MCF-7 cells liposome transfected with 3E-SV-FL and CMV-RL exhibited higher FL and RL activities than cells transfected with 3E-SV-FL and TK-RL, compatible with the transfer of the CMVE to 3E-SV-FL by CMV-RL (Fig. 7A). However, the fold induction of FL activity by E2 was consistently lower (4.9-fold) in cells transfected with a plasmid combination containing the CMVE (3E-SV-FL and CMV-RL) compared to cells (10.3-fold) transfected with a plasmid combination lacking the CMVE (3E-SV-FL and TK-RL). These results suggest that an ERE-containing reporter might be less responsive to E2 after being ligated to the CMVE by the NHEJ mechanism. Therefore, we tested E2 responsiveness of reporter plasmids constructed to carry both the ERE (or mutant ERE) and the CMVE (or NONE) (Fig. 1C). After CaP transfection of TK-RL-3E-SV-FL-CMVE into MCF-7 cells, E2 induced neither FL nor RL activity despite the presence of the canonical EREs (Fig. 7B), indicating that when the CMVE and the ERE are present on the same DNA molecule, the strong enhancer properties of the CMVE blunts E2-ER-ERE-mediated activation of either the SV40 or the HSV-TK promoter. Because of this masking phenomenon, the presence of the CMVE on any of the cotransfected plasmids has the potential to dampen ERE responsiveness.
|
| DISCUSSION |
|---|
|
|
|---|
Our findings that enhancer activity can be transferred from one plasmid to another have important implications for the design and interpretation of transfection experiments that contain more than one plasmid. Since NHEJ has been documented in many cell lines, enhancer transfer effects are likely to occur, depending on the frequency of ligation and the strength of the enhancer (Fig. 8). Even if NHEJ does not complete covalent ligation, the formation of protein bridges between DNA molecules may be sufficient for an enhancer to act on another molecule (14).
|
Another common situation in which enhancer transfer may be problematic is when separate plasmids are used to express various transcription factors in combination with reporter genes. In this circumstance, a strong enhancer such as the CMVE may perturb the activity of the promoter driving the reporter gene. Importantly, an enhancer such as the CMVE can either stimulate or mask other DNA regulatory elements, depending on the context of the promoter it joins. When the CMVE is introduced in combination with a relatively weak minimal promoter (e.g., TK or SV40), it increases basal expression. On the other hand, the CMVE dampens E2 stimulation of the ERE. Thus, it is difficult to predict the consequences of enhancer transfer between plasmids, particularly when complex native promoter sequences are used. To some extent, the effects of cotransfecting plasmids with strong enhancers are recognized and have led to the common practice of using equivalent amounts of an empty expression vector or a vector expressing an irrelevant protein. In addition to the measures described above to minimize NHEJ, it is preferable to use a control plasmid with the same backbone, ideally expressing a mutant form of the transcription factor.
Apart from transfection experiments, our observations demonstrate that DNA introduced by adenoviruses can also undergo ligation by NHEJ. Thus, native adenoviral enhancers, or enhancers present in exogenous genes carried by the virus, can be transferred to other reporters. In addition, NHEJ might affect the structure of adenoviral DNA during viral propagation as well as after infection.
In summary, we have demonstrated that cointroduced DNA molecules can be ligated to one another by NHEJ, thereby allowing an enhancer on one molecule to act on another. These findings have important implications for the interpretation of cotransfection experiments, as enhancers on expression vectors or within viral DNA can alter the expression of reporter genes or other expression vectors.
| ACKNOWLEDGMENTS |
|---|
This work was supported in part by NIH grants P50 CA 89018 and PO1 HD 21921.
| FOOTNOTES |
|---|
Present address: Third Department of Internal Medicine, Teikyo University Ichihara Hospital, Ichihara, Chiba 299-0111, Japan. ![]()
| REFERENCES |
|---|
|
|
|---|
2. Chen, C., and L. A. Chasin. 1998. Cointegration of DNA molecules introduced into mammalian cells by electroporation. Somat. Cell Mol. Genet. 24:249-256.[CrossRef][Medline]
3. Chen, J. L., K. L. Huisinga, M. M. Viering, S. A. Ou, C. T. Wu, and P. K. Geyer. 2002. Enhancer action in trans is permitted throughout the Drosophila genome. Proc. Natl. Acad. Sci. USA 99:3723-3728.
4. Ciliberto, G., L. Dente, and R. Cortese. 1985. Cell-specific expression of a transfected human
1-antitrypsin gene. Cell 41:531-540.[CrossRef][Medline]
5. Duan, W. R., J. L. Shin, and J. L. Jameson. 1999. Estradiol suppresses phosphorylation of cyclic adenosine 3',5'-monophosphate response element binding protein (CREB) in the pituitary: evidence for indirect action via gonadotropin-releasing hormone. Mol. Endocrinol. 13:1338-1352.
6. Dunaway, M., and P. Dröge. 1989. Transactivation of the Xenopus rRNA gene promoter by its enhancer. Nature 341:657-659.[CrossRef][Medline]
7. Hearing, P., and T. Shenk. 1983. The adenovirus type 5 E1A transcriptional control region contains a duplicated enhancer element. Cell 33:695-703.[CrossRef][Medline]
8. Hoglund, M., T. Siden, and D. Rohme. 1992. Different pathways for chromosomal integration of transfected circular pSVneo plasmids in normal and established rodent cells. Gene 116:215-222.[CrossRef][Medline]
9. Imperiale, M. J., R. P. Hart, and J. R. Nevins. 1985. An enhancer-like element in the adenovirus E2 promoter contains sequences essential for uninduced and E1A-induced transcription. Proc. Natl. Acad. Sci. USA 82:381-385.
10. Ishikawa, T., K. Takano, J. Yasufuku-Takano, T. Fujita, T. Igarashi, M. Miura, and K. Hata. 2001. Estrogenic impurities in labware. Nat. Biotechnol. 19:812.[CrossRef][Medline]
11. Kabotyanski, E. B., L. Gomelsky, J.-O. Han, T. D. Stamato, and D. B. Roth. 1998. Double-strand break repair in Ku86- and XRCC4-deficient cells. Nucleic Acids Res. 26:5333-5342.
12. Lee, E. J., L. M. Anderson, B. Thimmapaya, and J. L. Jameson. 1999. Targeted expression of toxic genes directed by pituitary hormone promoters: a potential strategy for adenovirus-mediated gene therapy of pituitary tumors. Endocrinology 84:786-794.
13. Mahmoudi, T., K. R. Katsani, and C. P. Verrijzer. 2002. GAGA can mediate enhancer function in trans by linking two separate DNA molecules. EMBO J. 21:1775-1781.[CrossRef][Medline]
14. Müller, H. P., J. M. Sogo, and W. Schaffner. 1989. An enhancer stimulates transcription in trans when attached to the promoter via a protein bridge. Cell 58:767-777.[CrossRef][Medline]
15. Natesan, S., V. M. Rivera, E. Molinari, and M. Gilman. 1997. Transcriptional squelching re-examined. Nature 390:349-350.[Medline]
16. Simone, P. D., A. D. Leonardo, G. Costanzo, R. Melfi, and G. Spinelli. 2001. The sea urchin sns insulator blocks CMV enhancer following integration in human cells. Biochem. Biophys. Res. Commun. 284:987-992.[CrossRef][Medline]
17. Smith, J., E. Riballo, B. Kysela, C. Baldeyron, K. Manolis, C. Masson, M. R. Lieber, D. Papadopoulo, and P. Jeggo. 2003. Impact of DNA ligase IV on the fidelty of end joining in human cells. Nucleic Acids Res. 31:2157-2167.
18. Valerie, K., and L. F. Povirk. 2003. Regulation and mechanism of mammalian double-strand break repair. Oncogene 22:5792-5812.[CrossRef][Medline]
19. Wake, C. T., T. Gudewicz, T. Porter, A. White, and J. H. Wilson. 1984. How damaged is the biologically active subpopulation of transfected DNA? Mol. Cell. Biol. 4:387-398.
20. Wedel, A., D. S. Weiss, D. Popham, P. Dröge, and S. Kustu. 1990. A bacterial enhancer functions to tether a transcriptional activator near a promoter. Science 248:486-490.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|