Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Calabrò, V. Articles by La Mantia, G. Search for Related Content PubMed PubMed Citation Articles by Calabrò, V. Articles by La Mantia, G.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, October 2004, p. 8529-8540, Vol. 24, No. 19
0270-7306/04/$08.00+0     DOI: 10.1128/MCB.24.19.8529-8540.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Inhibition of p63 Transcriptional Activity by p14^ARF: Functional and Physical Link between Human ARF Tumor Suppressor and a Member of the p53 Family

Viola Calabrò,^1, Gelsomina Mansueto,^1, Raffaela Santoro,¹ Antonio Gentilella,¹ Alessandra Pollice,¹ Pamela Ghioni,² Luisa Guerrini,² and Girolama La Mantia^1*

Department of Genetics, General and Molecular Biology, University of Naples "Federico II," Naples,¹ Department of Biomolecular and Biotechnological Sciences, University of Milan, Milan, Italy²

Received 4 March 2004/ Returned for modification 3 April 2004/ Accepted 2 July 2004

Top Abstract Introduction Materials and Methods Results Discussion References

 
The ARF/MDM2/p53 pathway is a principal defense mechanism to protect the organism from uncontrolled effects of deregulated oncogenes. Oncogenes activate ARF, which interacts with and inhibits the ubiquitin ligase MDM2, resulting in p53 stabilization and activation. Once stabilized and activated, p53 can either induce or repress a wide array of different gene targets, which in turn can regulate cell cycle, DNA repair, and a number of apoptosis-related genes. Here we show that, unlike p53, p63, a member of the p53 family, directly interacts with p14^ARF. Through this interaction ARF inhibits p63-mediated transactivation and transrepression. In p63-transfected cells, ARF, which normally localizes into nucleoli, accumulates in the nucleoplasm. Based on these observations, we suggest that stimuli inducing p14^ARF expression can, at the same time, activate p53 and impair p63 transcriptional activity, altering the pattern of p53 target gene expression. Here we show, for the first time, a physical and functional link between the p14^ARF tumor suppressor protein and p63, a member of the p53 family.

Top Abstract Introduction Materials and Methods Results Discussion References

 
The ARF tumor suppressor protein (known as p14^ARF in humans and p19^ARF in mice) is a product of the alternative reading frame of the human INK4a locus on chromosome 9p21. The ARF tumor suppressor induces potent growth arrest or cell death in response to hyperproliferative oncogenic stimuli. ARF can activate the p53 tumor surveillance pathway by interacting with and inhibiting the p53-antagonist, MDM2 (29). ARF limits the E3 ubiquitin ligase activity of MDM2 (14), thus preventing the polyubiquitination, nuclear export, and subsequent cytoplasmic degradation of p53 (47). Once stabilized and activated, p53 can either activate or repress a wide array of different gene targets, which in turn can regulate cell cycle, DNA repair, and a number of apoptosis-related genes (28).

In addition to p53, mammalian cells contain two homologous genes, p63 and p73. These genes give rise to the expression of proteins that are highly similar to p53 in structure and function. In particular, p63 and p73 proteins can induce p53-responsive genes and elicit programmed cell death (16, 17, 25, 46).

Unlike p53, both p63 and p73 exist in multiple isoforms. In the case of p63, at least six different isotypes with widely differing transactivation potentials have been described (46). The transactivating (TA) isoforms, which resemble p53, are generated by the use of an upstream promoter; the N isoforms, produced from an intronic promoter, contain the same DNA-binding and oligomerization (OD) domains as the TA isoforms but lack the transactivation domain. The N isoforms contain a region of 26 amino acids at the very N-terminal end of the protein (TA2) in which a further activation function was recently mapped (8). Both the TA and N isoforms have three possible carboxyl termini, termed , ß, and . In the C-terminal extension of the isoforms there is a sterile alpha motif (SAM) that is found in proteins that regulate mammalian development and is thought to be involved in protein-protein interactions (36).

Despite the structural similarities, a number of functional differences were found between p53, p63, and p73 proteins that could depend on the biochemical properties of the proteins but could also derive from differences in the expression pattern.

p73 and p63 are more important during development and differentiation. In particular, p63 appears to be primarily implicated in epithelial and limbs development (37). However, it is interesting that UVB-induced DNA damage decreases levels of the dominant-negative N-p63 isoform; simultaneously, the levels of the TA-p63 isoforms increase (20). Downregulation of Np63, as well as TAp63 upregulation, may be a prerequisite for UV-induced apoptosis in skin. This notion is supported by the recent observation that the TAp63 isoform is required for p53-dependent apoptosis induced by DNA damage, implying a role for p63 in preventing stress-induced DNA damage and tumorigenesis (8, 10). Furthermore, it has recently been reported that a balance between TA and N p63 isoforms is required to allow cells to respond to signals required for maturation of embryonic epidermis (18), suggesting the existence of a complex mechanism by which relative amount of the individual p63 isoforms can be regulated.

The p53 protein is a labile protein whose levels are primarily controlled by the MDM2/ARF pathway (12, 19). However, although regulation of p53 by the p14^ARF-MDM2 circuitry is well understood, very little is known about whether and how this molecular pathway regulates the functions of the p53 homologues. Remarkably, p73 can also associate with MDM2 (2), as would be expected from its strong homology with p53 and its activity is modulated by MDM2. Moreover, we have demonstrated that MDM2 induces TAp63 protein stabilization and transcriptional activation (3). Here we show, for the first time, a physical and functional association between p14^ARF and p63. Our study suggests a mechanism by which p14^ARF might differentially regulate the expression of p53-target genes through the complex network of p53-like proteins.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Plasmids. All of the p63 cDNAs in the pcDNA3 vector were kindly provided by H. van Bokhoven (38). A pcDNA3.1/HisTAp63 plasmid was used in electrophoretic mobility shift assays (EMSAs). To obtain the construct TAp63(297-499), pcDNA3-TAp63 was cut with EcoRI and religated in order to eliminate the last C-terminal 609 bp of TAp63, whereas Np63(1-26) and Np63(1-86) were obtained by PCR with either 1-26F or 1-86F primers and the reverse primer and pcDNA3-Np63 as a template (1-26F, CCGCTCGAGGACCAGCAGATTCAG; 1-86F, CCGCTCGAGTTCCAGCAGTCAAGC; reverse primer, GTGAATTCAGTGCCAACCTGTGGT).

The mutant plasmid pcDNA-p14^ARF(1-38) was obtained as follows: a NarI-XbaI fragment was excised from pcDNA3-ARF and, after filling of the NarI site, it was cloned in EcoRV-XbaI sites of pcDNA3. The plasmid pcDNA-p14^ARF(66-132) was obtained as follows. A HindIII-XbaI fragment was excised from N-p19 plasmid (4) and, after filling of the HindIII site, it was cloned in EcoRV-XbaI sites of pcDNA3.

The HindIII 1.08-kb fragment containing the apoptosis protease-activating factor 1 (Apaf1) promoter sequence was retrieved from the pGL3b-Apaf-prom(–871/+208) plasmid provided by K. Helin (23) and ligated in the HindIII site of the pCAT0 plasmid to give the Apaf1CAT plasmid.

The other plasmids have been already described (3, 11).

Cell culture and transfection. H1299, Saos-2, COS-7, and HaCaT cells were cultured in Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum. NIH 3T3 cells were cultured in Dulbecco modified Eagle medium supplemented with 10% calf serum. H1299 and NIH 3T3 cells were transfected by using Lipofectamine and Lipofectamine supplemented with Plus (Gibco), respectively. Saos-2 and COS-7 cells were transfected with Lipofectamine 2000 (Gibco). HaCaT cells were transfected with Superfect reagent (Qiagen) according to the manufacturer's instructions. The total amount of transfected DNA was kept constant by using the "empty" expression vector when necessary.

Western blotting. At 48 h after transfection cells were lysed in 10 mM Tris-HCl (pH 7.5), 1 mM EDTA, 150 mM NaCl, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 0.5% sodium deoxycholate, and protease inhibitors. Cell lysates were incubated on ice for 30 min, and the extracts were centrifuged at 13,000 rpm for 10 min to remove cell debris. Protein concentrations were determined by the Bio-Rad protein assay. After the addition of 4x loading buffer (2% sodium dodecyl sulfate [SDS], 30% glycerol, 300 mM ß-mercaptoethanol, 100 mM Tris-HCl [pH 6.8]), the samples were incubated at 95°C for 5 min and resolved by SDS-polyacrylamide gel electrophoresis. Proteins were transferred to a polyvinylidene difluoride membrane (Millipore) and probed with the following antibodies: anti-p63 (H137 or 4A4; Santa Cruz), anti-p14^ARF (C-18; Santa Cruz), anti-MDM2 (smp14; Santa Cruz), anti-p21 (C-19; Santa Cruz), anti-myc (sc40; Santa Cruz), and anti-actin (I-19; Santa Cruz). Proteins were visualized by an enhanced chemiluminescence method (Amersham).

Coimmunoprecipitations. NIH 3T3, H1299, or HaCaT cells (5 x 10⁵/60-mm plate) were transfected with the indicated vectors. Transfected cells were harvested 48 h posttransfection, and the cell lysates were prepared as described above. Lysates containing 500 µg of proteins were precleared with 30 µl of protein A-agarose (50% slurry; Santa Cruz) and then incubated overnight at 4°C with fresh protein A-beads (30 µl) and 2 µg of anti-p63 (H137 or 4A4; Santa Cruz) or anti-p14^ARF (C-18; Santa Cruz) antibodies. The beads were washed vigorously twice with lysis buffer and once with radioimmunoprecipitation assay buffer and loaded directly onto an SDS-12% polyacrylamide gel. The immunoprecipitated proteins were detected by Western blotting. For the coimmunoprecipitations of in vitro-translated proteins, TAp63, p14^ARF, p14^ARF(1-38) and p14^ARF(66-132) proteins were in vitro translated in the presence of [³⁵S]methionine by using TnT reticulocytes from Promega with 1 µg of pcDNA3-TAp63 and 1 µg of pcDNA3 or with 1 µg of pcDNA3-TAp63 and 1 µg of either pcDNA3-p14^ARF, pcDNA3-p14^ARF(1-38), or pcDNA3-p14^ARF(66-132). Then, 40-µl portions of the individual reactions were used for immunoprecipitation with anti-His antibodies (6xHis; Clontech).

EMSA. EMSA experiments were performed as already described (26). TAp63 and p14^ARF proteins were in vitro translated by using TnT reticulocytes from Promega with 0.5 µg of pcDNA3.1/His-TAp63, 1.5 µg of pEGFP C3, 1.5 µg of pcDNA3-p14^ARF, 0.5 µg of pEGFP C3, 0.5 µg of pcDNA3.1/His-TAp63, and/or 1.5 µg of pcDNA3-p14^ARF. Next, 10 µl of the individual reactions was used either for the binding reaction or for Western blot analysis. The probe is a radiolabeled oligonucleotide duplex containing a p53-binding site present in the p21 promoter (p21.1 described in reference 44). A 100-fold molar excess of the same cold oligonucleotide or an oligonucleotide containing a consensus binding site for E2F1 was used for competition experiments. For the supershift antibodies against the His tag fused at the 5' of pcDNA3.1/His-TAp63 (6xHis), anti-p63 antibodies (H-137; Santa Cruz) or unrelated polyclonal anti-p21 antibodies (C-19; Santa Cruz) were used, adding them to the samples prior to the binding reaction (30 min in ice).

Subcellular distribution assay. NIH 3T3, COS-7, Saos-2, and H1299 cells (10⁵/35-mm plate) were grown on micro cover glasses (BDH) and transfected with the indicated vectors. At 24 h after transfection, cells were washed with cold phosphate-buffered saline (PBS) and fixed with 4% paraformaldehyde (Sigma-Aldrich) for 15 min at 4°C. After being washed with PBS, the cells were permeabilized with ice-cold 0.5% Triton X-100 (COS-7 and NIH 3T3 cells) or 0.1% Triton X-100 (Saos-2 and H1299 cells) for 10 min and then washed with PBS, incubated with DAPI (4',6'-diamidino-2-phenylindole; 10 mg/ml [Sigma-Aldrich]) for 3 min, and washed again with PBS. Finally, the glasses were mounted with Mowiol (Sigma-Aldrich). The cells were examined under a fluorescence microscope (Nikon). All images were digitally processed by using Adobe Photoshop software. To analyze ARF localization, before incubation with DAPI, cells were blocked with 5% fetal bovine serum in PBS for 30 min, washed with PBS, and then incubated with anti-His polyclonal antibodies (Invitrogen) at 37°C for 1 h. After being washed with PBS three times, cells were incubated with a secondary antibody (Cy3-conjugated anti-mouse immunoglobulin G; ImmunoResearch Laboratory) at room temperature for 30 min.

CAT assay. H1299 and Saos-2 cells (5 x 10⁵ cells/60-mm dish) were transiently cotransfected, as described above, with Apaf1CAT (0.5 µg), WAF1CAT (0.4 µg), or Hsp70CAT (0.25 µg) promoter reporter constructs and the indicated amounts of the expression plasmids encoding each p63 isoform or p53 with or without the indicated amount of pcDNA-p14^ARF. Cells were collected 48 h after transfection. Equal amounts of cell extracts (10 to 30 µg), determined by the Bradford method (Bio-Rad), were assayed for chloramphenicol acetyltransferase (CAT) activity by using 0.1 µCi of [¹⁴C]chloramphenicol and 4 mM acetyl coenzyme A. Separated products were detected and quantified by using a PhosphorImager (Molecular Dynamics) and ImageQuant software. The pCMV-ßgal plasmid (1.5 µg) was used to normalize CAT values for transfection efficiency.

Top Abstract Introduction Materials and Methods Results Discussion References

 
p14^ARF inhibits p63 transcriptional activity. Under conditions of genotoxic stress or hyperproliferative stimuli, p53 stabilization leads to transcriptional activation and repression of different sets of genes involved in the control of cell proliferation and genomic-repair processes (5, 34). Some of them, such as p21, MDM2, BAX, GADD45, and 14-3-3 (37) are also activated by p63. Depending on the specific p63 isoform and promoter sequence being tested, wild-type p63 can be either a transcriptional activator, a repressor, or a dominant-negative repressor of the transactivation function (11).

Among the known p53 target promoters, we found that the Apaf1 promoter is efficiently upregulated by all p63 isoforms, with the exception of Np63 (Fig. 1A). The apoptosis protease-activating factor 1 (Apaf1) is a proapoptotic gene that has been demonstrated to be involved in several cell death pathways (13). Figure 1A shows the transcriptional activities and dose responses of the different p63 isoforms on the Apaf1 promoter. In this experiment, we used H1299 cells, a p53-null human lung carcinoma-derived cell line expressing undetectable levels of p63 and p73 (data not shown). Expression of p63 proteins, upon transfection into H1299, was verified by Western blotting and immunodetection with anti-myc antibodies that recognize the myc epitope at the N-terminal of all transfected proteins. Figure 1B shows that the relative abundance of transfected proteins, expressed from pcDNA3 vectors, varies to some extent, with TA being the more abundant and TA and TAß being the less abundant, in agreement with published results (11).

View larger version (45K): [in this window] [in a new window]

FIG. 1. p63 transactivates the Apaf1 promoter. (A) H1299 cells were transiently cotransfected with 0.5 µg of the Apaf1CAT reporter plasmid/dish and the indicated amounts of each p63-expressing plasmid. After 48 h, cells were harvested, and the CAT activity was determined. The basal activity of the reporter was set to 1. The data are presented as the fold induction relative to the sample without effector. Each histogram bar represents the mean of three independent transfection duplicates. The standard deviations are indicated. (B) Expression of transfected proteins. H1299 cells were transiently transfected with 0.5 µg of the indicated plasmids. At 48 h after transfection cells were lysed and 50 µg of the lysates were immunoblotted with anti-myc antibodies.

To investigate the effects of ARF on p63-dependent transcription, we transiently cotransfected H1299 cells with the Apaf1CAT reporter construct, increasing the amounts of either TAp63, Np63, TAp63, TAp63ß, or Np63ß expression vectors and a fixed amount of p14^ARF. Our results clearly indicate that ARF is able to inhibit both TA and N-mediated transactivation (Fig. 2 and data not shown). In Fig. 2 are shown, as representative examples, results obtained with TA and Np63. Similar experiments were performed with a different target promoter, p21^WAF, and the TAp63 and isoforms as transactivators, and similar results were obtained (data not shown).

View larger version (33K): [in this window] [in a new window]

FIG. 2. p63 transactivation is inhibited upon p14ARF transfection. H1299 cells were transiently cotransfected with the indicated combinations of the following expression plasmids (total DNA 2 µg): Apaf1CAT reporter plasmid (500 ng/dish; bars 1 to 12), a fixed amount of p14ARF (200 ng/dish; gray hatched bars) or pcDNA (200 ng/dish, open bars) and increasing amounts (25 ng, bars 3 to 4; 50 ng, bars 5 to 6; 75 ng, bars 7 to 8; 100 ng, bars 9 to 10; 200 ng, bars 11 to 12) of TA (A)- or N p63 (B)-expressing plasmids. After 48 h, cells were harvested, and the CAT activity was determined. The basal activity of the reporter was set to 1. The data are presented as the fold induction relative to the sample without effector. Each histogram bar represents the mean of three independent transfection duplicates. The standard deviations are indicated.

Next, we decided to confirm the observed inhibitory effect of p14^ARF on p63-driven transcription on a different cellular context. We used Saos-2 cells, a human osteosarcoma-derived cell line, expressing neither p53 nor p63. We transiently cotransfected into Saos-2 cells the Apaf1 or p21^WAF CAT reporters and a fixed amount of TAp63 (0.1 µg) alone or with increasing amounts of p14^ARF-expressing plasmid (0.2, 0.4, and 0.8 µg). As shown in Fig. 3A, increasing expression of ARF resulted in a progressive reduction of TAp63-driven transcription up to the background level. Similar results were obtained when Np63 was used as transactivator (Fig. 3B). On the other hand, when p14^ARF was cotransfected with p53 by the same experimental procedure, we did not observe reduction but a slight increase of p53-driven transcription (Fig. 3C), in agreement with the known function of ARF.

View larger version (30K): [in this window] [in a new window]

FIG. 3. p14ARF inhibits TA- and Np63-dependent transactivation. (A) Saos-2 cells were transiently cotransfected with the Waf1CAT (0.4 µg/dish, open bars) or the Apaf1CAT (0.5 µg/dish, gray bars) reporter plasmids, a fixed amount of TAp63 (0.1 µg/dish, bars 5 to 12) or increasing amounts of p14ARF (0.2 µg/dish, bars 7 and 8; 0.4 µg/dish, bars 9 and 10; 0.8 µg/dish, bars 3, 4, 11, and 12) expressing plasmids. After 48 h, cells were harvested, and the CAT activity was determined. (B) Saos-2 cells were transiently cotransfected with 0.5 µg of Apaf1CAT reporter plasmid (bars 1 to 6), a fixed amount of Np63 (0.1 µg/dish, bars 3 to 6) and increasing amounts of p14ARF (0.2 µg/dish, bar 4; 0.4 µg/dish, bar 5; 0.8 µg/dish, bars 2 and 6)-expressing plasmid. After 48 h, cells were harvested, and the CAT activity was determined. The basal activity of the reporter was set to 1. The data are presented as the fold induction relative to the sample without effector. Each histogram bar represents the mean of three independent transfection duplicates. The standard deviations are indicated. (C) Saos-2 cells were transiently cotransfected with the Waf1CAT (0.4 µg/dish, open bars) or the Apaf1CAT (0.5 µg/dish, gray bars) reporter plasmid, a fixed amount of p53 (0.1 µg/dish, bars 5 to 12), and increasing amounts of p14ARF (0.2 µg/dish, bars 7 and 8; 0.4 µg/dish, bars 9 and 10; 0.8 µg/dish, bars 3, 4, 11, to 12)-expressing plasmids. After 48 h, cells were harvested, and the CAT activity was determined. The basal activity of the reporter was set to 1. The data are presented as the fold induction relative to the sample without effector. Each histogram bar represents the mean of three independent transfection duplicates. The standard deviations are indicated. (D) Saos-2 cells were transiently cotransfected with 0,5 µg of TAp63 (lanes 2 to 5) and increasing amount of p14ARF-expressing plasmid (1.0 µg/dish, lane 4; 2.0 µg/dish, lane 5; 4.0 µg/dish, lanes 1 and 5). At 48 h after transfection the cells were lysed, and 25 µg of the lysates was immunoblotted with anti-p63 and anti-p14ARF antibodies. (E) Saos-2 cells were transiently cotransfected with 0.5 µg of Np63 (bars 2 to 5) and increasing amounts of p14ARF-expressing plasmids (1.0 µg/dish, bar 3; 2.0 µg/dish, bar 4; 4.0 µg/dish, bars 1 and 5). At 48 h after transfection cells were lysed, and 10 µg of the lysates was immunoblotted and revealed with anti-p63 and anti-p14ARF antibodies.

At first, we reasoned that a decrease in the p63 protein level could account for the observed inhibition of p63 transcriptional activity by p14^ARF. On the other hand, it has been shown that ARF is able to promote polyubiquitination and degradation of proteins such as E2F1 (6) and B23 (15). Therefore, we decided to check whether or not p14^ARF affects the level of p63 exogenous protein. To this aim, we compared levels of p63 protein with or without ARF coexpression. We transfected into Saos-2 cells p63 alone or p63 with p14^ARF and examined the level of exogenous p63 protein by Western blotting. As shown in Fig. 3D and E, the abundance of transfected TAp63 and Np63 proteins remained unchanged upon p14^ARF overexpression.

To validate our data, we felt it was important to show a correlation between the decrease of p63 transactivation potential by p14^ARF and modulation of endogenous target genes. For this reason, we checked the expression of p21^WAF and MDM2 endogenous genes upon transfection of TAp63 alone or with increasing amounts of p14^ARF. For this experiment, we used the H1299 cells. In mock-transfected cells endogenous p21^WAF protein was detectable, whereas no MDM2 was observed (Fig. 4). As shown in Fig. 4, endogenous p21^WAF and MDM2 proteins were both induced by transfection of TAp63 alone (compare lanes 1 and 3); the addition of increasing amounts of p14^ARF efficiently repressed this induction in a dose-dependent way (compare lane 3 with lanes 4 to 7). Again, the level of TAp63 protein appeared to be unaffected by p14^ARF coexpression. These results are consistent with our data from CAT reporter assays.

View larger version (24K): [in this window] [in a new window]

FIG. 4. Induction of endogenous MDM2 and p21WAF upon p63 transfection is counteracted by p14ARF cotransfection. Immunoblot analysis of total protein lysates from H1299 cells cotransfected with a fixed amount of TAp63 (0.5 µg/dish, lanes 3 to 7) and increasing amounts (0.5 µg/dish, bar 4; 1 µg/dish, bar 5; 2 µg/dish, bar 6; 4 µg/dish, bars 2 and 7) of p14ARF-expressing plasmids was performed. An anti-actin antibody was used for normalization of cell lysate loading.

The p63 transcriptional activity in the presence of p14^ARF was also investigated in repression assays with the Hsp70 promoter. The Hsp70 promoter has a high level of intrinsic activity even without activation by heat shock and is efficiently repressed by p53 (1). Saos-2 cells were cotransfected with the Hsp70CAT construct, a fixed amount of each of the different p63 constructs, with or without a fixed amount of p14^ARF plasmid DNA. According to a previous report (11), all p63 isoforms, with the exception of Np63, are able to transrepress this promoter. As shown in Fig. 5, even though to a different extent, p14^ARF was able to decrease the ability of both TA and Np63 isoforms to transrepress the Hsp70 promoter. It is noteworthy that p14^ARF alone causes a decrease of the basal activity of the Hsp70 promoter. Taken together, these data suggest that p14^ARF is able to inhibit both activation and repression of p53-target promoters by p63, leaving unaltered the intracellular p63 protein level.

View larger version (19K): [in this window] [in a new window]

FIG. 5. p14ARF counteracts p63-dependent transrepression. Saos-2 cells were cotransfected with a fixed amount of Hsp70 reporter plasmid (0.25 µg/dish), 0.1 µg of the indicated p63 expression plasmids, and 0.4 µg of p14ARF-expressing plasmid (open bars) or 0.4 µg of pcDNA (gray bars). The basal activity of the reporter was set to 1. The data are presented as the fold repression relative to the sample without effector. Each histogram bar represents the mean of three independent transfection duplicates. The standard deviations are indicated.

Physical interaction of TA and Np63 with p14^ARF in mammalian cells. In searching for a mechanism for ARF inhibition of p63-driven transcription, we decided to examine whether ARF can associate with p63. Human ARF was expressed alone or together with TA or Np63 into the ARF-null NIH 3T3 cells to perform coimmunoprecipitation assays. NIH 3T3 cells did not have detectable p63 endogenous protein. Using anti-human ARF polyclonal antibodies, coimmunoprecipitation of TA and Np63 (Fig. 6A), TA and Np63ß (Fig. 6B), or TA and Np63 (Fig. 6C), occurred only when each of these proteins was coexpressed with p14^ARF; p63-p14^ARF complexes were not found when either protein alone was expressed in cells. Similar results were obtained when the cellular lysates were immunoprecipitated with anti-p63 antibodies (Fig. 6D and data not shown). The interaction between p14^ARF and TA or Np63 and isoforms was also observed in H1299 cells in a similar experimental procedure (Fig. 6E and data not shown).

View larger version (42K): [in this window] [in a new window]

FIG. 6. Coimmunoprecipitation of TA and N p63 proteins with p14ARF. NIH 3T3 cells were transfected with 1 µg of expression plasmids encoding TA or Np63 (A), TA or Np63ß (B), and TA or Np63 (C and D) alone or together with 2 µg of p14ARF-expressing plasmid. Cellular extracts were immunoprecipitated with anti-ARF antibodies (A, B, and C) or with anti-p63 antibodies (D). Immunocomplexes were analyzed with anti-p63 and anti-p14ARF antibodies. (E) H1299 cells were transfected with 1 µg of expression plasmids encoding TA or Np63 alone or together with 2 µg of p14ARF-expressing plasmid. Cellular extracts were immunoprecipitated with anti-ARF antibodies and analyzed with anti-p63 and anti-p14ARF antibodies. (F) HaCaT cells were transfected with 2 µg of p14ARF-expressing plasmid. Cellular extracts were incubated with anti-ARF antibodies or, as control, with an unrelated antibody. Immunocomplexes were analyzed with anti-p63 and anti-p14ARF antibodies.

Moreover, to confirm the observed interaction in a more physiological context, we performed an immunoprecipitation experiment into HaCaT cells, a spontaneously immortalized keratinocyte cell line expressing detectable levels of endogenous Np63. Since no endogenous p14^ARF protein was revealed, HaCaT cells were transiently transfected with a p14^ARF-expressing plasmid. Cellular extracts were incubated with anti-human ARF antibodies. Immunoprecipitates were blotted and probed with anti-p63 and anti-p14 antibodies. As shown in Fig. 6F, Np63 was coimmunoprecipitated only when p14^ARF is expressed. This experiment confirmed that a complex between p14^ARF and p63 occurs in mammalian keratinocyte cells.

To identify the region of p63 essential for the interaction with p14^ARF, three deletion mutants of p63 were constructed starting from the TAp63 or Np63 wild-type constructs. A schematic representation of these mutants is shown in Fig. 7A. First, we verified by Western blotting that the mutant proteins were correctly expressed upon transfection into NIH 3T3 cells. As shown in Fig. 7B, with the exception of the 1-86 mutant, which appears to be relatively less abundant, the expression level of the tested mutants was comparable to that of wild-type TAp63. Each mutant was assayed in NIH 3T3 cells for its interaction with p14^ARF by coimmunoprecipitation experiments. Removal of the carboxy-terminal portion (297-449 mutant) encompassing the entire TID, SAM, and OD domains of TAp63 does not impair p63-ARF interaction (Fig. 7C). On the other hand, deletion of either amino acids from 1 to 86 (1-86 mutant), including both the TA2 and the PRD domains, or the first 26 amino acids of Np63 (1-26 mutant), encompassing only the TA2 domain, completely abolished p63-p14^ARF interaction (Fig. 7D).

View larger version (32K): [in this window] [in a new window]

FIG. 7. Identification of p63 domains involved in p14ARF interaction. (A) Schematic representation of the p63 deletion constructs used in this experiment. (B and C) NIH 3T3 cells were transfected with 1 µg of expression plasmids encoding wild-type TAp63 or the indicated p63 deleted constructs alone or together with 2 µg of p14ARF-expressing plasmid. Cellular extracts were immunoprecipitated with anti-ARF antibodies. (D) Equal amounts of total protein extracts from cells transfected with the indicated plasmids were immunoblotted with anti-p63 antibodies.

To define which parts of the ARF protein are required for the physical interaction with p63, we performed coimmunoprecipitation of in vitro-cotranslated proteins. We assayed two deletion mutants: the first lacking amino acids from 66 to132 (p14^ARF66-132) and the second lacking the N-terminal 1 to 38 amino acids (p14^ARF1-38) (Fig. 8A). We were able to show that deletion of amino acids 1 to 38 (Fig. 8B, compare lanes 2 and 3) impairs the interaction with p63, whereas the C-terminal portion of the protein appears to be dispensable for the interaction (Fig. 8B, lane 4).

View larger version (21K): [in this window] [in a new window]

FIG. 8. Immunoprecipitations of in vitro-translated proteins and mapping of the p14ARF domain involved in p63 interaction. (A) Schematic representation of the p14ARF deletion constructs used in this experiment. (B) A total of 40 µl of in vitro-translated 35S-labeled TAp63 alone (lane 1) or cotranslated with either p14ARF (lane 2), p14ARF(1-38) (lane 3), or p14ARF(66-132) (lane 4) was immunoprecipitated with anti-His antibodies (recognizing the poly-His tag fused to the 5' of the coding region of wild-type and mutant p14ARF). The immunocomplexes were analyzed on an SDS-15% polyacrylamide gel and detected by autoradiography. (C) A total of 5 µl of in vitro-translated proteins used in the above-described immunoprecipitations was analyzed on an SDS-15% polyacrylamide gel and then detected by autoradiography.

ARF decreases the binding of p63 to a p53 DNA-binding site in the p21^WAF promoter. Since we have found that ARF binds to p63 and inhibits p63-driven transcription, we decided to examine whether p14^ARF impairs the binding of p63 to a canonical p53 consensus sequence. We thus compared the binding of p63 in presence or absence of ARF. We performed an in vitro DNA-binding assay using, as a target DNA, a radiolabeled duplex oligonucleotide representing a p53-binding site previously identified in the p21^WAF promoter (44). Incubation of the radiolabeled oligonucleotide with in vitro-translated TAp63 led to the formation of a specific protein-DNA complex (Fig. 9A, lane 1). The specificity of the TAp63-DNA complex was tested by a competition experiment: a 100x cold molar excess of the same oligonucleotide used as a probe completely abolished the binding, whereas a nonrelevant control oligonucleotide had no effect (Fig. 9A, lanes 1, 2, and 3). The identity of the TAp63-DNA complex was confirmed by a supershift experiment (Fig. 9A, lanes 4, 5, 6, and 7) in which the in vitro-translated TAp63 protein was incubated prior to the binding reaction with an antibody recognizing the poly-His tag fused upstream of the coding region of TAp63, with a nonrelevant anti-p21 antibody as a control and with an antibody recognizing the p63 DNA-binding domain. Interestingly, when TAp63 was cotranslated with p14^ARF, the binding was significantly reduced (Fig. 9A, lanes 11 and 12). A Western blot analysis of the in vitro-translated proteins showed no significant differences in the relative abundance of the TAp63 protein translated alone or in presence of p14^ARF (Fig. 9B). These observations indicate that TAp63 specifically binds to a p53 consensus in the p21^WAF promoter and that p14^ARF impairs this binding.

View larger version (64K): [in this window] [in a new window]

FIG. 9. Protein DNA-binding assay. (A) A 40-bp radiolabeled oligonucleotide containing a p53-binding site was incubated with in vitro-translated TAp63. The specificity of the binding was assessed by competition with either a 100x cold molar excess of the same oligonucleotide used as a probe or of an unrelated oligonucleotide (compare lane 1 to lanes 2 and 3). Supershift (lanes 4 to 7) was carried out with anti-His antibodies (recognizing the poly-His tag fused to the 5' of the coding region of TAp63) (lane 5), anti-p63 antibody (recognizing the DNA-binding domain of p63) (lane 7) or, as a control, anti-p21 antibody (lane 6). The binding reaction was also carried out, as a control, with the rabbit reticulocytes (lane 9) and with in vitro-translated p14ARF (lane 8). Binding reactions with TAp63 translated alone (lane 11) or cotranslated with p14ARF (lane 12) are shown. (B) The same aliquots of in vitro-translated TAp63 or TAp63/ARF used in the above-described binding reactions were analyzed by Western blotting with anti-His and anti-ARF antibodies.

p63 relocalizes ARF in the nucleoplasm. The p14^ARF protein is mainly located into nucleoli. The nucleolar localization of ARF is even more predominant when it is transiently overexpressed or expressed in a subset of p53-deficient tumor cell lines (21). Moreover, ARF is able to sequester its binding partners, in particular MDM2 and E2F1, to this location (6, 42). We reasoned that a possible mechanism through which the p14^ARF protein could inhibit the transcriptional activity of p63 is by sequestering it into the nucleolus where it cannot perform its transcriptional functions. To investigate this hypothesis, we first monitored the subcellular localization of ectopically transfected p63 isoforms.

Therefore, TA and Np63 isoforms were produced as green fluorescent protein (GFP) fusion proteins and expressed in H1299, COS-7, Saos-2, and NIH 3T3 cell lines. The and ß isoforms of both TA and Np63 exhibited a very similar localization pattern in the various cell lines, i.e., they were uniformly distributed in the nucleus with nucleolar sparing. A different pattern was observed for the TAp63 and Np63 proteins that appeared to be distributed both in the nucleus and cytoplasm. Again, we did not observe TAp63 or Np63 proteins in the nucleoli. Moreover, most TAp63 and Np63 expressing cells showed nuclear and cytoplasmic dots that were often located on the surface of the nuclear membrane (data not shown). Similar results were obtained when cells expressing TA and Np63 isoforms lacking the GFP domain were revealed with anti-p63 antibodies (data not shown).

In agreement with previous observations, we found that transfected p14^ARF accumulates predominantly into the nucleoli of NIH 3T3, COS-7, Saos-2, and H1299 (39, 42). In the remaining cells it shows a diffuse nuclear distribution or a nuclear distribution with nucleolar sparing (Fig. 10A and Table 1). B23 anti-nucleolin antibody was used in these experiments as a control for nucleolar localization (data not shown). When p63 and ARF were cotransfected in a 1-to-1 ratio, the above-described subcellular distribution of p63 proteins remained unaltered (data not shown). Unexpectedly, a large percentage of cells expressing both TAp63 isoforms and ARF proteins exhibited a complete exclusion of p14^ARF from nucleoli. The results obtained with TAp63ß are shown as a representative example (Fig. 10B). Conversely, no significant change of the typical subcellular distribution of p14^ARF was seen when p14^ARF was cotransfected either with Np63 isoforms (see Table 1) or p53 (data not shown). According to the above results, the C-terminal deleted (297-449) TAp63 protein efficiently induced p14^ARF nucleolar exclusion, whereas the 1-26 and the 1-86 proteins were ineffective, underlining the importance of the p63 amino-terminal region in this phenomenon (Table 1).

View larger version (15K): [in this window] [in a new window]

FIG. 10. TAp63 impairs p14ARF nucleolar localization. COS-7 cells were seeded on glass coverslips and transfected with 0.5 µg of expression vector encoding p14ARF (A) or cotransfected with 0.5 µg of p14ARF and 0.5 µg of GFP::TAp63ß fusion protein (B). The cells were examined under a fluorescence microscope (Nikon). All images were digitally processed by using Adobe Photoshop. The subcellular localization of GFP::TAp63ß and p14ARF are shown. Numerical data indicate the percentage of cells showing different ARF localizations.

View this table: [in this window] [in a new window]

TABLE 1. Percentage of cells showing nucleolar localization of p14ARF upon cotransfection of p14ARF (0.5 µg) with the indicated p63 isoforms (0.5 µg) in Saos-2, H1299, and NIH 3T3 cells and the percentage of cells showing nucleolar localization of p14ARF upon cotransfection of p14ARF (0.5 µg) with the indicated wild-type or mutant p63 isoforms (0.5 µg) in COS-7 cellsa

Remarkably, the TAp63 isoform appears to be significantly less efficient than the other TA isoforms in mediating the exclusion of ARF from the nucleolus. However, when increasing amounts of TAp63 plasmid were cotransfected in COS-7 cells, with a fixed amount of ARF-expressing plasmid, the proportion of cells showing ARF nucleolar localization decreased in a dose-dependent manner up to 40% (Fig. 11).

View larger version (18K): [in this window] [in a new window]

FIG. 11. TAp63 and Np63 affect p14ARF nucleolar localization. COS-7 cells were transfected with 0.5 µg of the expression vector encoding p14ARF alone or in presence of increasing amounts (0.5, 1, and 1.5 µg) of either TAp63- or Np63-expressing plasmids. The percentage of cells showing p14ARF nucleolar localization is reported. The results are expressed as a mean value of three independent experiments.

Top Abstract Introduction Materials and Methods Results Discussion References

 
We present here evidence indicating a physical and functional relationship between p63 and p14^ARF. To our knowledge, this is the first report that supports an intimate association between p14^ARF and a member of the p53 family. Our data indicate that p63 is able to associate with p14^ARF, both in the TA and N versions, in different mammalian cell lines. Coimmunoprecipitation experiments of in vitro-translated proteins support the conclusion that a direct physical association between p14^ARF and p63 occurs. By deletion analysis, we have shown that this interaction is mediated by the N-terminal region from amino acids 1 to 26 of Np63. Remarkably, only 12 amino acids of this region (encompassing amino acids 15 to 26 of Np63 and amino acids 109 to 120 of TAp63) are in common between TA and N isoforms. Since interaction between p63 and p14^ARF occurs with both TA and N isoforms, we infer that this stretch of 12 amino acids contains residues that might be crucial for p63-p14^ARF association. On the other hand, the p63 C-terminal region seems to be dispensable for p14^ARF-p63 binding. Two distinct observations support this hypothesis; first, p63 proteins with either the , ß, or alternative type of carboxy-terminal equally associate with p14^ARF and, second, the (297-449)TAp63 mutant, in which the entire TID, SAM and OD domains were removed, is still able to interact with p14^ARF.

Our results suggest that the ARF carboxy-terminal portion is dispensable for the ARF-p63 interaction, whereas the N-terminal region seems to be involved. It has been reported (22) that the first N-terminal 22 amino acids of p14^ARF retain the ability to bind MDM2, but a second, less-efficient, MDM2-binding site is present in the ARF carboxy-terminal region. However, a more accurate definition of the region of ARF interacting with p63 is necessary to verify whether the MDM2-ARF binding overlaps with the p63-ARF binding.

Normally, the ARF protein localizes in the nucleolus. However, we found that p63 proteins are all prevalently localized in the nucleoplasm and excluded from nucleolus. Interestingly, we have noticed a remarkable decrease of the nucleolar fraction and a corresponding increase in the nucleoplasmic fraction of p14^ARF upon TAp63 overexpression, findings that support a physical association between the two proteins. The importance of the amino-terminal TA domain in promoting p14^ARF nucleolar exclusion is emphasized by the observation that N isoforms leave unaltered ARF nucleolar localization, whereas the TAp63(297-449) mutant shows the same behavior of the ß and TAp63. The question remaining is why TAp63 appears to be less efficient than the other TAp63 isoforms in promoting ARF nucleolar exclusion. Concerning this point we recall that the extreme C-terminal domain (TID), unique to the isoforms, binds to the N-terminal TA domain through an intramolecular interaction. This binding is both necessary and sufficient for protein stabilization and transcriptional inhibition of TAp63 (32). Thus, we suggest that such intramolecular association could, in a similar way, mask sequences located in the TA domain that are responsible for p14^ARF nucleolar exclusion. The mechanism by which coexpression of TAp63 isoforms and p14^ARF alters the subcellular localization of p14^ARF is under investigation; however, we think that residues located in the TA domain of p63 might increase the binding affinity between p63 and p14^ARF so that, once established, the complex keeps p14^ARF in the nucleoplasmic compartment. However, we cannot exclude that interaction of p14^ARF with the TA domain of p63 might hamper association with additional molecular partners that regulate p14^ARF nucleolar import.

The ARF tumor suppressor acts as a sensor of hyperproliferative signals emanating from oncoproteins and inducers of S-phase entry, such as Myc, E1A, Ras, and E2F-1 (reviewed in reference 33). ARF, in turn, triggers p53-dependent growth arrest in the G₁ and G₂ phases of the cell cycle or, in the presence of appropriate collateral signals, sensitizes cells to apoptosis. ARF binds directly to MDM2, enabling transcriptionally active p53 to accumulate in the nucleoplasm (43); (42). Emerging evidence suggests that ARF can, though less efficiently, suppress the proliferation of cells that express mutant p53 or lack both MDM2 and p53, implying the existence of p53/MDM2-independent functions of ARF working through interactions with other regulators (41).

Very recently, it has been reported that ARF may function in coordinating cell growth with proliferation through its interaction with B23, a nucleolar protein involved in ribosome biogenesis. Inducing B23 degradation, p14^ARF inhibits rRNA processing (15, 35). Thus, it is possible that the phenomenon of ARF nucleolar exclusion may interfere with the specific role of ARF in controlling ribosome biogenesis. Further investigations are necessary to clarify this point.

Other p53-independent functions of ARF include repression of E2F (9) and NF-B (31) activity. Various proteins that associate with ARF have been identified, including Spinophilin (39), MdmX, Pex19, CARF, a novel serine-rich protein (30), and Tat binding protein 1 (27). However, the extent to which these ARF complexes modulate the cell cycle inhibitory action of ARF is not well established.

Interestingly, our data show that p14^ARF inhibits the ability of p63 to enhance the expression of various endogenous genes. Moreover, since we have shown the inhibitory function of ARF on both p63 transactivation and transrepression assays, it appears that p14^ARF antagonizes p63 whatever is the activity of p63 on that particular promoter. Actually, we could test this phenomenon only on p53 target promoters such as p21^WAF, Apaf1, and Hsp70 because no specific p63 targets have been identified thus far. If this phenomenon is also observed on p63-specific target promoters, it would indicate a more general role, one not necessarily involving p53.

We have previously reported that overexpression of MDM2 induces TAp63 protein stabilization and transcriptional activation and that both effects are counteracted by ARF coexpression (3). In principle, one could reasonably suggest that the observed inhibitory effect of p14^ARF on p63-dependent transcription might be due, at least in MDM2-expressing cells, to the well-described antagonistic effect that p14^ARF exerts on MDM2. Actually, two different considerations argue against this hypothesis. First, we observed that p14^ARF inhibition of p63-dependent transcription does not correlate with any decrease in p63 protein intracellular levels. Second, our data demonstrate a direct interaction between p14^ARF and p63, whereas the relationship between ARF and p53 is mediated by MDM2.

The discovery of the p53 homologs has sparked speculation on how surveillance of cellular integrity might be achieved through the network of p53-like proteins characterized by similar structural and biochemical properties. Actually, both p63 and p73 share several p53 transcriptional gene targets and can induce apoptosis and cell growth arrest. Increasing evidence points to highly tissue specific mechanisms and differential regulation as the principal factors accounting for the majority of the differences in biological function (3, 40).

Recent studies demonstrated that among the p63 proteins TAp63 isoforms are the first to be expressed during embryogenesis and are required for commitment to an epithelial stratification program. Np63 is the predominant isoform expressed in mature epidermis (20). Since TAp63 isoforms seem to inhibit terminal differentiation, they must be counterbalanced by Np63 to allow cells to respond to signals required for the maturation of embryonic epidermis (18). On the other hand, UVB-induced DNA damage decreases levels of Np63, whereas the levels of the TAp63 isoforms increase. This mechanism is a prerequisite for UV-induced apoptosis in the skin (20, 45).

Interestingly, it has been shown that, in epidermis, p53 is expressed in the basal layer, where it plays a surveillance role in progenitor and/or stem cell renewal (24). The p53 protein acts not only to keep stem cells quiescent but also to ensure the correct control of cell cycle and cell division as keratinocytes proliferate. In fact, p53-deficient epidermal keratinocytes differentiate normally, but they are affected in their growth control and underwent malignant transformation (7). On the other hand, it is still unclear whether ARF is regulated under physiological conditions, and little is understood concering its role in adult tissue homeostasis. Our observation that p14^ARF associates with p63-inhibiting p63 transcriptional activity suggests, that under p14^ARF overexpression, the pool of p63 proteins might be kept inactive in a p63-p14^ARF complex.

Hence, we speculate that under mitogenic stimuli, p14^ARF physically associate with TA and perhaps dominant-negative p63 isoforms, removing them from p53/p63-responsive promoters. This process might turn on p53 transcriptional functions, activating the p53-dependent checkpoint control. Actually, our EMSA experiments show that p14^ARF is able to affect the binding of TAp63 to a canonical p53 consensus sequence, lending support to this hypothesis. More specific experimental in vivo approaches, such as chromium immunoprecipitation assays, will elucidate the real contribution of ARF in the regulation of transcription of p53 target genes in their natural setting, given the important role of chromatin structure in the regulation of gene expression. Studies to address this question are under way.

 
We thank R. Terracciano for skillful technical help. We are grateful to Hans van Bokhoven and K. Helin for generously providing some of the plasmids used in this study.

This study was supported by grants from Telethon (grant GGP030326) to G.L.M, MIUR to V.C., and Fondazione Cariplo to L.G.

 
* Corresponding author. Mailing address: Department of Genetics, General and Molecular Biology, University of Naples "Federico II," Via Mezzocannone, 8, 80134 Naples, Italy. Phone: 39-081-2535189. Fax: 39-081-2535000. E-mail: lamantia{at}unina.it.

V.C. and G.M. contributed equally to this study.

Top Abstract Introduction Materials and Methods Results Discussion References

 

1
1. Agoff, S. N., J. Hou, D. I. Linzer, and B. Wu. 1993. Regulation of the human hsp70 promoter by p53. Science 259:84-87.[Abstract/Free Full Text]
2
2. Balint, E., S. Bates, and K. H. Vousden. 1999. Mdm2 binds p73 alpha without targeting degradation. Oncogene 18:3923-3929.[CrossRef][Medline]
3
3. Calabro, V., G. Mansueto, T. Parisi, M. Vivo, R. A. Calogero, and G. La Mantia. 2002. The human MDM2 oncoprotein increases the transcriptional activity and the protein level of the p53 homolog p63. J. Biol. Chem. 277:2674-2681.[Abstract/Free Full Text]
4
4. Calabro, V., T. Parisi, A. Di Cristofano, and G. La Mantia. 1999. Suppression of Ras-mediated NIH 3T3 transformation by p19ARF does not involve alterations of cell growth properties. Oncogene 18:2157-2162.[CrossRef][Medline]
5
5. Caspari, T. 2000. How to activate p53. Curr. Biol. 10:R315-R317.[CrossRef][Medline]
6
6. Datta, A., A. Nag, and P. Raychaudhuri. 2002. Differential regulation of E2F1, DP1, and the E2F1/DP1 complex by ARF. Mol. Cell. Biol. 22:8398-8408.[Abstract/Free Full Text]
7
7. Dazard, J. E., J. Piette, N. Basset-Seguin, J. M. Blanchard, and A. Gandarillas. 2000. Switch from p53 to MDM2 as differentiating human keratinocytes lose their proliferative potential and increase in cellular size. Oncogene 19:3693-3705.[CrossRef][Medline]
8
8. Dohn, M., S. Zhang, and X. Chen. 2001. p63 and Np63 can induce cell cycle arrest and apoptosis and differentially regulate p53 target genes. Oncogene 20:3193-3205.[CrossRef][Medline]
9
9. Eymin, B., L. Karayan, P. Seite, C. Brambilla, E. Brambilla, C. J. Larsen, and S. Gazzeri. 2001. Human ARF binds E2F1 and inhibits its transcriptional activity. Oncogene 20:1033-1041.[CrossRef][Medline]
10
10. Flores, E. R., K. Y. Tsai, D. Crowley, S. Sengupta, A. Yang, F. McKeon, and T. Jacks. 2002. p63 and p73 are required for p53-dependent apoptosis in response to DNA damage. Nature 416:560-564.[CrossRef][Medline]
11
11. Ghioni, P., F. Bolognese, P. H. Duijf, H. van Bokhoven, R. Mantovani, and L. Guerrini. 2002. Complex transcriptional effects of p63 isoforms: identification of novel activation and repression domains. Mol. Cell. Biol. 22:8659-8668.[Abstract/Free Full Text]
12
12. Haupt, Y., R. Maya, A. Kazaz, and M. Oren. 1997. Mdm2 promotes the rapid degradation of p53. Nature 387:296-299.[CrossRef][Medline]
13
13. Hickman, E. S., and K. Helin. 2002. The regulation of APAF1 expression during development and tumorigenesis. Apoptosis 7:167-171.[CrossRef][Medline]
14
14. Honda, R., and H. Yasuda. 1999. Association of p19^ARF with Mdm2 inhibits ubiquitin ligase activity of Mdm2 for tumor suppressor p53. EMBO J. 18:22-27.[CrossRef][Medline]
15
15. Itahana, K., K. P. Bhat, A. Jin, Y. Itahana, D. Hawke, R. Kobayashi, and Y. Zhang. 2003. Tumor suppressor ARF degrades B23, a nucleolar protein involved in ribosome biogenesis and cell proliferation. Mol. Cell 12:1151-1164.[CrossRef][Medline]
16
16. Jost, C. A., M. C. Marin, and W. G. Kaelin, Jr. 1997. p73 is a simian [correction of human] p53-related protein that can induce apoptosis. Nature 389:191-194.[CrossRef][Medline]
17
17. Kaghad, M., H. Bonnet, A. Yang, L. Creancier, J. C. Biscan, A. Valent, A. Minty, P. Chalon, J. M. Lelias, X. Dumont, P. Ferrara, F. McKeon, and D. Caput. 1997. Monoallelically expressed gene related to p53 at 1p36, a region frequently deleted in neuroblastoma and other human cancers. Cell 90:809-819.[CrossRef][Medline]
18
18. Koster, M. I., S. Kim, A. A. Mills, F. J. DeMayo, and D. R. Roop. 2004. p63 is the molecular switch for initiation of an epithelial stratification program. Genes Dev. 18:126-131.[Abstract/Free Full Text]
19
19. Kubbutat, M. H., S. N. Jones, and K. H. Vousden. 1997. Regulation of p53 stability by Mdm2. Nature 387:299-303.[CrossRef][Medline]
20
20. Liefer, K. M., M. I. Koster, X. J. Wang, A. Yang, F. McKeon, and D. R. Roop. 2000. Downregulation of p63 is required for epidermal UV-B-induced apoptosis. Cancer Res. 60:4016-4020.[Abstract/Free Full Text]
21
21. Lindstrom, M. S., U. Klangby, R. Inoue, P. Pisa, K. G. Wiman, and C. E. Asker. 2000. Immunolocalization of human p14^ARF to the granular component of the interphase nucleolus. Exp. Cell Res. 256:400-410.[CrossRef][Medline]
22
22. Lohrum, M. A., M. Ashcroft, M. H. Kubbutat, and K. H. Vousden. 2000. Contribution of two independent MDM2-binding domains in p14^ARF to p53 stabilization. Curr. Biol. 10:539-542.[CrossRef][Medline]
23
23. Moroni, M. C., E. S. Hickman, E. L. Denchi, G. Caprara, E. Colli, F. Cecconi, H. Muller, and K. Helin. 2001. Apaf-1 is a transcriptional target for E2F and p53. Nat. Cell Biol. 3:552-558.[CrossRef][Medline]
24
24. Oren, M. 1999. Regulation of the p53 tumor suppressor protein. J. Biol. Chem. 274:36031-36034.[Free Full Text]
25
25. Osada, M., M. Ohba, C. Kawahara, C. Ishioka, R. Kanamaru, I. Katoh, Y. Ikawa, Y. Nimura, A. Nakagawara, M. Obinata, and S. Ikawa. 1998. Cloning and functional analysis of human p51, which structurally and functionally resembles p53. Nat. Med. 4:839-843.[CrossRef][Medline]
26
26. Parisi, T., A. Pollice, A. Di Cristofano, V. Calabro, and G. La Mantia. 2002. Transcriptional regulation of the human tumor suppressor p14^ARF by E2F1, E2F2, E2F3, and Sp1-like factors. Biochem. Biophys. Res. Commun. 291:1138-1145.[CrossRef][Medline]
27
27. Pollice, A., V. Nasti, R. Ronca, M. Vivo, M. L. Iacono, R. Calogero, V. V. Calabro, and G. La Mantia. 2004. Functional and physical interaction of the human ARF tumor suppressor with Tat-binding protein-1. J. Biol. Chem. 279:6345-6353.[Abstract/Free Full Text]
28
28. Polyak, K., Y. Xia, J. L. Zweier, K. W. Kinzler, and B. Vogelstein. 1997. A model for p53-induced apoptosis. Nature 389:300-305.[CrossRef][Medline]
29
29. Pomerantz, J., N. Schreiber-Agus, N. J. Liegeois, A. Silverman, L. Alland, L. Chin, J. Potes, K. Chen, I. Orlow, H. W. Lee, C. Cordon-Cardo, and R. A. DePinho. 1998. The Ink4a tumor suppressor gene product, p19^Arf, interacts with MDM2 and neutralizes MDM2's inhibition of p53. Cell 92:713-723.[CrossRef][Medline]
30
30. Rizos, H., E. Diefenbach, P. Badhwar, S. Woodruff, T. M. Becker, R. J. Rooney, and R. F. Kefford. 2003. Association of p14^ARF with the p120^E4F transcriptional repressor enhances cell cycle inhibition. J. Biol. Chem. 278:4981-4989.[Abstract/Free Full Text]
31
31. Rocha, S., K. J. Campbell, and N. D. Perkins. 2003. p53- and Mdm2-independent repression of NF-B transactivation by the ARF tumor suppressor. Mol. Cell 12:15-25.[CrossRef][Medline]
32
32. Serber, Z., H. C. Lai, A. Yang, H. D. Ou, M. S. Sigal, A. E. Kelly, B. D. Darimont, P. H. Duijf, H. Van Bokhoven, F. McKeon, and V. Dotsch. 2002. A C-terminal inhibitory domain controls the activity of p63 by an intramolecular mechanism. Mol. Cell. Biol. 22:8601-8611.[Abstract/Free Full Text]
33
33. Sherr, C. J. 2004. Principles of tumor suppression. Cell 116:235-246.[CrossRef][Medline]
34
34. Sherr, C. J. 1998. Tumor surveillance via the ARF-p53 pathway. Genes Dev. 12:2984-2991.[Free Full Text]
35
35. Sugimoto, M., M. L. Kuo, M. F. Roussel, and C. J. Sherr. 2003. Nucleolar Arf tumor suppressor inhibits rRNA processing. Mol. Cell 11:415-424.[CrossRef][Medline]
36
36. Thanos, C. D., and J. U. Bowie. 1999. p53 Family members p63 and p73 are SAM domain-containing proteins. Protein Sci. 8:1708-1710.[Medline]
37
37. van Bokhoven, H., and H. G. Brunner. 2002. Splitting p63. Am. J. Hum. Genet. 71:1-13.[CrossRef][Medline]
38
38. van Bokhoven, H., and F. McKeon. 2002. Mutations in the p53 homolog p63: allele-specific developmental syndromes in humans. Trends Mol. Med. 8:133-139.[CrossRef][Medline]
39
39. Vivo, M., R. A. Calogero, F. Sansone, V. Calabro, T. Parisi, L. Borrelli, S. Saviozzi, and G. La Mantia. 2001. The human tumor suppressor arf interacts with spinophilin/neurabin II, a type 1 protein-phosphatase-binding protein. J. Biol. Chem. 276:14161-14169.[Abstract/Free Full Text]
40
40. Waltermann, A., N. N. Kartasheva, and M. Dobbelstein. 2003. Differential regulation of p63 and p73 expression. Oncogene 22:5686-5693.[CrossRef][Medline]
41
41. Weber, J. D., J. R. Jeffers, J. E. Rehg, D. H. Randle, G. Lozano, M. F. Roussel, C. J. Sherr, and G. P. Zambetti. 2000. p53-independent functions of the p19^ARF tumor suppressor. Genes Dev. 14:2358-2365.[Abstract/Free Full Text]
42
42. Weber, J. D., M. L. Kuo, B. Bothner, E. L. DiGiammarino, R. W. Kriwacki, M. F. Roussel, and C. J. Sherr. 2000. Cooperative signals governing ARF-mdm2 interaction and nucleolar localization of the complex. Mol. Cell. Biol. 20:2517-2528.[Abstract/Free Full Text]
43
43. Weber, J. D., L. J. Taylor, M. F. Roussel, C. J. Sherr, and D. Bar-Sagi. 1999. Nucleolar Arf sequesters Mdm2 and activates p53. Nat. Cell Biol. 1:20-26.[CrossRef][Medline]
44
44. Westfall, M. D., D. J. Mays, J. C. Sniezek, and J. A. Pietenpol. 2003. The Delta Np63 alpha phosphoprotein binds the p21 and 14-3-3 sigma promoters in vivo and has transcriptional repressor activity that is reduced by Hay-Wells syndrome-derived mutations. Mol. Cell. Biol. 23:2264-2276.[Abstract/Free Full Text]
45
45. Yang, A., M. Kaghad, D. Caput, and F. McKeon. 2002. On the shoulders of giants: p63, p73 and the rise of p53. Trends Genet. 18:90-95.[CrossRef][Medline]
46
46. Yang, A., M. Kaghad, Y. Wang, E. Gillett, M. D. Fleming, V. Dotsch, N. C. Andrews, D. Caput, and F. McKeon. 1998. p63, a p53 homolog at 3q27-29, encodes multiple products with transactivating, death-inducing, and dominant-negative activities. Mol. Cell 2:305-316.[CrossRef][Medline]
47
47. Zhang, Y., and Y. Xiong. 1999. Mutations in human ARF exon 2 disrupt its nucleolar localization and impair its ability to block nuclear export of MDM2 and p53. Mol. Cell 3:579-591.[CrossRef][Medline]

---

Molecular and Cellular Biology, October 2004, p. 8529-8540, Vol. 24, No. 19
0270-7306/04/$08.00+0     DOI: 10.1128/MCB.24.19.8529-8540.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Caserta, T. M., Kommagani, R., Yuan, Z., Robbins, D. J., Mercer, C. A., Kadakia, M. P. (2006). p63 Overexpression Induces the Expression of Sonic Hedgehog. Mol Cancer Res 4: 759-768 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Calabrò, V. Articles by La Mantia, G. Search for Related Content PubMed PubMed Citation Articles by Calabrò, V. Articles by La Mantia, G.