![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Molecular and Cellular Biology, January 2004, p. 617-628, Vol. 24, No. 2
0270-7306/04/$08.00+0 DOI: 10.1128/MCB.24.2.617-628.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Department of Genetics, University Erlangen, 91058 Erlangen,1 Department of Hematology & Oncology, Childrens Hospital, 35392 Giessen, Germany,3 Department of Pathology and Laboratory Medicine, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104,2 Genomics Institute of the Novartis Research Foundation, San Diego, California 921214
Received 2 July 2003/ Returned for modification 30 September 2003/ Accepted 27 October 2003
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
MLL is the mammalian homologue of Drosophila Trithorax (TRX) (10, 16, 43, 52). MLL and Trithorax are important constituents of transcriptional maintenance, a form of "cellular memory" that maintains preestablished transcription patterns through the introduction of epigenetic chromatin modifications. Full-length MLL protein (3,968 amino acids) is cleaved into two parts (MLLN and MLLC) that remain noncovalently bound in a binary complex (19, 46). The 300-kDa MLLN contains several motifs that are likely to be involved in targeting the protein to specific chromosomal sites. Two domains in particular, the AT hooks and MT or methyltransferase homology region, possess DNA binding activity (4, 51). These are followed by a region with several specialized zinc fingers (PhD fingers for plant homeodomain) that include a bromodomain. MLLC is responsible for the epigenetic effector functions through a conserved SET domain with histone H3 (K4) methylation activity (27) and by providing binding sites for the histone acetyltransferase CREB-binding protein (11) as well as for the SWI-SNF chromatin remodeling complex (33). The MLLN/C couple is embedded into a megadalton complex that serves the overall purpose of transcriptional activation of specific genes (30).
Translocations involving MLL delete sequences encoding the C-terminal portion of the protein, ultimately leading to the production of an in-frame fusion protein with transforming activity. 11q23 translocations are especially prevalent in infant cases of acute lymphoblastic leukemia, and they are associated with a very aggressive course of disease that is correlated with a dismal prognosis (3, 9, 12).
In knockout experiments the clustered homeobox (Hox) genes have been identified as targets of mammalian MLL (47, 48). Hox genes are not only major determinants of segment identity during embryonic development but also are crucial regulators of hematopoiesis. Mll knockout mice displayed a perturbed hematopoietic development in the yolk sack and fetal liver (18, 44). Importantly, Hox genes have been recognized as activated oncogenes in leukemia. In particular, Hoxa9 and Hoxa7 are frequently affected by retroviral insertion mutagenesis and the HOXA9 protein is a fusion partner of the nucleoporin protein NUP98 in a subset of AML with the translocation t(7;11) (28, 29, 31, 41, 42).
Although knock-in and retroviral transduction studies unequivocally established that the combination of MLL and the respective partner protein leads to oncogenic activation of the chimeric molecule, the underlying transforming mechanism of the MLL fusion derivatives is still unknown. Structure-function studies suggest transcriptional transactivation is the essential activity acquired through the fusion (8, 22, 25, 37, 39). This was supported by experiments from our laboratory and others showing that fusion of MLL to the strong transcriptional transactivator domain VP16 of the Herpes simplex virus was transforming (38, 49). In addition, the frequent translocation partners are nuclear proteins that are probable transcription factors that seem to work by converting the N terminus of MLL into an aberrant transcription factor, resulting in ectopic gene expression that ultimately disturbs growth control or differentiation and cooperates with further mutations to establish a leukemic state.
To gain insight into the mode of action of an exemplary MLL fusion protein, we constructed a conditional derivative of MLL-ENL that can be transduced with a single retrovirus. By this strategy it was possible to analyze the consequences of MLL-ENL expression in primary hematopoietic cells, to determine if MLL fusion protein-induced leukemogenesis is reversible, and to identify a set of MLL-ENL target genes that are potentially important for leukemogenesis. Here we demonstrate that MLL-ENL immortalizes cells mainly through inducing a reversible block on myeloid differentiation that is dependent on upregulation of Hoxa9 and Meis1 and that enforced expression of these two genes is sufficient to substitute for MLL-ENL function.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
EN2 (37), resulting in pMSCVneo-MLL-ENL-ERtm. The cDNAs for Hoxa7, Hoxa9, and Meis1a were cloned into the pMSCV puro, pMSCV hygro, or pMSCV green fluorescent protein (GFP) vector by standard techniques. Tissue culture, transfection procedures, and growth assays. Human embryonic kidney cells (293T) were cultured in high-glucose Dulbecco's modified Eagle medium (Life Technologies); human pre-B REH cells and mouse myeloid M1 cells were kept in RPMI 1640 (Life Technologies). For protein expression the cells were transfected by a standard Ca-phosphate method. The ecotropic packaging cell line Phoenix was obtained from Gary Nolan (Stanford, Calif.). The maintenance of Phoenix cells is outlined at http://www.stanford.edu/group/nolan/.
Transduced bone marrow cells were kept either in MethoCult (M3234) methylcellulose medium (Stem Cell Technologies, Vancouver, Canada) or in RPMI 1640. Recombinant mouse cytokines (Strathmann Biotech, Hannover, Germany) were added in the following concentrations: interleukin 3 (IL-3), IL-6, and granulocyte-macrophage colony-stimulating factor (GM-CSF), 10 ng/ml; SCF, 100 ng/ml. All liquid media were supplemented with 10% bovine fetal calf serum (FCS Gold; PAA Laboratories, Pasching, Austria) and penicillin-streptomycin. 4-Hydroxy-tamoxifen (4-OHT) was added at a 100 nM final concentration as a 1 mM stock solution in ethanol.
For luciferase reporter studies REH cells or M1 cells were electroporated in RPMI 1640 containing 5 µg of DEAE-dextran/ml at 300 V and 925 µF in 4-mm cuvettes without a pulse controller in a Bio-Rad electroporator. In total, 1 µg of DNA was transfected in a ratio of expression plasmid to reporter of 9 to 1. Luciferase activity was determined with the luciferase assay system (Promega, Madison, Wis.) according to the instructions of the manufacturer.
Western blotting, enzyme-linked immunosorbent assay, and antibodies. For the detection of MLL-ENL and MLL-ENL-ERtm fusion proteins nuclear extracts were prepared from transfected 293T cells in a high-salt elution buffer (500 mM NaCl, 20 mM HEPES [pH 7.5], 0.5 mM EDTA, 0.1% Triton X-100, 0.5 mM sodium vanadate, 2 mM NaF, 2 mM dithiothreitol, 0.2 mM phenylmethylsulfonyl fluoride, 20 µg of leupeptin/ml, 40 µg of pepstatin A/ml). After separation on standard sodium dodecyl sulfate (SDS)-polyacrylamide gels the proteins were blotted onto nitrocellulose in 10 mM 3-(cyclohexylamino)-1-propanesulfonic acid-0.01% SDS-1% methanol. The detection was done with monoclonal antibodies against MLL (5).
Antibodies for fluorescence-activated cell sorter (FACS) analysis (isotype control, c-kit, Gr-1, Mac-1/CD11b) were purchased from BD Biosciences and used according to the recommendations of the manufacturer.
Retroviral transduction of mouse primary hematopoietic cells. High-titer retrovirus supernatants were produced by transient transfection of the packaging cell line Phoenix-E by a standard Ca-phosphate precipitation method. Viral titers usually reached approximately 5 x 106 CFU/ml. The retroviral transduction of primary hematopoietic cells was done according to a method described previously (34).
RT-PCR, quantitative RT-PCR, Southern blotting, and cDNA array analysis. Total RNA was isolated by ion-exchange chromatography with kits from Qiagen (Hilden, Germany) according to the recommended protocols. MLL fusion-specific RNA and Bmi-1 RNA were detected by reverse transcription-PCR (RT-PCR) after reverse transcription of total RNA with a random hexamer primer. Southern blotting was done on DNA isolated by phenol-chloroform extraction and blotted under alkaline conditions according to standard procedures.
Real-time PCR was performed at least in triplicate using Taqman probes and the ABI prism 7700 sequence detection system. Samples were quantified relative to a cDNA dilution series and normalized to ß-actin as outlined in ABI user bulletin no. 2. Probes used were as follows: Hoxa9, Taqman probe, CCCCATCGATCCCAATAACCCAGC, forward primer, GAATGAGAGCGGCGGAGAC, reverse primer, GAGCGAGCATGTAGCCAGTTG; Meis1, Taqman probe, ACCGGTCCACCACCTGAACCACG, forward primer, GCATGCAGCCAGGTCCAT, reverse primer, TAAAGCGTCATTGACCGAGGA; Hoxa7, Taqman probe, CGCAGTTCAGGACCCGACAGGAA, forward primer, CGGCCGAAGCCAGTTTC, reverse primer, GCGCCGCGTCAGGTAG; Pbx1, Taqman probe, CAGTGACGGACTCGCAGCCAGTCA, forward primer, TGTTATCAGCCAGACAGGAGGAT, reverse primer, TGCCCTGCGGACTGTACA; Pbx3, Taqman probe, CCATGCAGGCTCTCATCATCGTTCTCA, forward primer, TAAGCTGAACCCTTGCGGATT, reverse primer, TCCAAGCCCATCCGTGAT.
Target preparation and hybridization of microarrays was conducted as described in the Affymetrix GeneChip Expression Analysis Technical Manual. Briefly, total RNA was converted to first-strand cDNA, using Superscript II reverse transcriptase primed by a poly(T) oligomer that incorporated the T7 promoter. Second-strand cDNA synthesis was followed by in vitro transcription for linear amplification of each transcript and incorporation of biotinylated CTP and UTP. The cRNA products were fragmented to 200 nucleotides or less, heated at 99°C for 5 min, and hybridized for 16 h at 45°C to the microarrays. The microarrays were then washed at low (6x SSPE [1x SSPE is 0.18 M NaCl, 10 mM NaH2PO4, and 1 mM EDTA {pH 7.7}]) and high (100 mM morpholineethanesulfonic acid, 0.1 M NaCl) stringency and stained with streptavidin-phycoerythrin. Fluorescence was amplified by adding biotinylated anti-streptavidin and an additional aliquot of streptavidin-phycoerythrin stain. A confocal scanner was used to collect fluorescence signal at 3-µm resolution after excitation at 570 nm. The average signal from two sequential scans was calculated for each microarray feature.
Affymetrix Microarray Suite 5.0 was used to quantitate expression levels for targeted genes; default values provided by Affymetrix were applied to all analysis parameters. Border pixels were removed, and the average intensity of pixels within the 75th percentile was computed for each probe. The average of the lowest 2% of probe intensities occurring in each of 16 microarray sectors was set as background and subtracted from all features in that sector. Probe pairs were scored positive or negative for detection of the targeted sequence by comparing signals from the perfect match and mismatch probe features. The number of probe pairs meeting the default discrimination threshold (tau = 0.015) was used to assign a call of absent, present, or marginal for each assayed gene, and a P value was calculated to reflect confidence in the detection call. A weighted mean of probe fluorescence (corrected for nonspecific signal by subtracting the mismatch probe value) was calculated using the one-step Tukey's biweight estimate. This signal value, a relative measure of the expression level, was computed for each assayed gene. Global scaling was applied to allow comparison of gene signals across multiple microarrays: after exclusion of the highest and lowest 2%, the average total chip signal was calculated and used to determine what scaling factor was required to adjust the chip average to an arbitrary target of 150. All signal values from one microarray were then multiplied by the appropriate scaling factor.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Due to the length restraints for retrovirally packaged DNA, a shorter deletion variant of MLL-ENL was chosen for this experiment. In this molecule only the last 128 amino acids of ENL are fused to the MLL N terminus. This ENL portion was shown previously to encompass the minimal essential transactivation domain that is necessary to convey transforming properties to MLL (37). The ERtm domain (amino acids 281 to 599 of the estrogen receptor) (24) was fused to the C terminus of MLL-ENL separated by an eight-amino-acid glycine-rich linker. The assembled cDNA was inserted into the retroviral backbone pMSCVneo, yielding pMSCV-MLL-ENL-ERtm. A schematic representation of the construct is depicted in Fig. 1A.
|
4-OHT dependent functions of MLL-ENL-ERtm. The transformation capability of native MLL-ENL correlates closely with its function as a transcriptional transactivator (35, 49). Therefore the transactivation properties of MLL-ENL and MLL-ENL-ERtm were measured in the presence or absence of 4-OHT to confirm that the inducible construct retained this key activity. To this end, 0.9 µg of the respective pMSCV constructs were coelectroporated into the pre-B-cell line REH together with 0.1 µg of a luciferase reporter driven by the murine Hoxa7 promoter (pGL3-Hoxa7). This reporter-cell line combination has been previously demonstrated to give a reliable transcriptional readout that is proportional to the transformation potency of MLL fusion proteins (35, 49). After electroporation the cells were either cultivated for 24 h in the presence of 100 nM 4-OHT or they were mock treated with solvent only. As expected the addition of 4-OHT did not significantly affect the transactivation capability of MLL-ENL. Regardless of the presence of inductor, MLL-ENL achieved an approximately 30- to 40-fold increase of luciferase activity over basal levels (Fig. 2A). In contrast, the MLL-ENL-ERtm molecule was completely inactive in the absence of 4-OHT but acquired a transactivation potential after 4-OHT addition that was capable of increasing luciferase levels about 10-fold.
|
The transforming capacity of MLL-ENL-ERtm was assessed in retroviral transduction/replating assays, which test the ability of MLL fusion proteins to increase the self-renewing potential and block differentiation of hematopoietic cells. Untransduced bone marrow cells rapidly differentiate and die. In contrast progenitor cells that express oncogenic MLL fusions will continuously form colonies in semisolid cytokine-supplemented media even after repeated replating. A schematic depiction of the experimental outline is shown in Fig. 2C. The viral constructs coding for MLL-ENL-ERtm, native MLL-ENL, and an empty pMSCV vector were packaged in Phoenix-E cells and used to transduce bone marrow cells from BALB/c mice primed 5 days earlier with an injection of 150 mg of 5-fluorouracil/kg. Ten thousand cells were plated in duplicate per assay with neomycin selection in 1 ml of methocel medium supplemented with cytokines (IL-3, IL-6, SCF, and GM-CSF) and various concentrations of 4-OHT. After 5 days the cells were reisolated and then replated every 5 to 6 days under equal conditions in methocel without neomycin. In total five independent transduction series were performed. Figure 2C shows one representative example. As expected, neor-transduced cells did not form colonies in the third replating whereas MLL-ENL-expressing cells formed numerous colonies similar in appearance to those formed by MLL-ENL-ERtm-expressing cells in the presence of 100 nM 4-OHT. MLL-ENL-ERtm- transduced colonies formed only if the cells were kept in the continuous presence of 100 nM 4-OHT. Lower concentrations or the withdrawal of 4-OHT after two plating rounds precluded colony formation, indicating a loss of transformation potential.
Characterization of MLL-ENL-ERtm-transformed cells. To gain material for more detailed investigations, third-round colonies of two independent transduction experiments were explanted from methylcellulose and cultivated in liquid medium either with or without 4-OHT. In contrast to cells transduced with native MLL-ENL (23), MLL-ENL-ERtm cells underwent rapid apoptosis when cultured in IL-3 alone (data not shown). Therefore for all further experiments the media for the MLL-ENL-ERtm cells were supplemented with the complete set of cytokines that was originally present in the methocel medium (IL-3, IL-6, SCF, and GM-CSF). Cells seeded without 4-OHT underwent complete growth arrest within approximately 2 weeks, whereas cells cultivated in 4-OHT-supplemented medium proliferated rapidly and established cell lines (Fig. 3A). The presence of intact provirus and the expression of MLL-ENL-ERtm RNA were confirmed in these lines by Southern blotting and RT-PCR, respectively (Fig. 3B and 3C). Additionally, the proviral integration pattern is different for line 1 and line 2 (Fig. 3B, right panel), thus confirming their independent origin.
|
|
|
|
Thirty-six genes were upregulated after MLL-ENL-ERtm inactivation. Many of these were proteins involved in myeloid differentiation and/or myeloid cell function. For example, the gene encoding the mature myeloid marker Gr-1 was strongly upregulated on the arrays after 4-OHT withdrawal, closely correlating with the onset of Gr-1 protein expression as detected by FACS analysis (Fig. 4). In addition, secondary granule proteins and enzymes involved in immune defense (e.g., the lysozyme family) were also upregulated. The Glut3 glucose transporter and glyceraldehyde-3-phosphate dehydrogenase genes were upregulated, consistent with a shift toward anaerobic metabolism. Interestingly, the RNA of the retinoblastoma tumor suppressor gene also increased after inductor withdrawal, preceding the proliferation arrest occurring during more advanced differentiation. The changes in gene expression levels for targets that were activated by MLL-ENL-ERtm appeared to be closely coordinated across the individual cell populations, as indicated by small standard deviations. In contrast, the genetic program accompanying differentiation that commenced after MLL-ENL-ERtm inactivation was less synchronized between cultures, in particular for genes with the highest changes in expression levels, resulting in large standard deviations.
Hox and TALE genes are the crucial downstream targets of MLL-ENL for immortalization. One of the most striking results of the microarray analysis was that Hox genes, including Hoxa9, as well as the Hox cofactors Meis1 and Pbx3, are coordinately upregulated. These results were confirmed by quantitative RT-PCR, which yielded results in close agreement with the microarray data. In addition we determined that Hoxa7 was also upregulated by the MLL fusion protein (Fig. 5). This is potentially a key mechanism of transformation by MLL fusion proteins because both Hoxa7 and Hoxa9 in combination with Meis1 have been shown to cooperatively transform myeloid progenitors to produce aggressive leukemias in experimental models (6, 21). Importantly, these genes are also consistently upregulated in human leukemias (20). Hoxa7 and Hoxa9 have been recognized as target genes of unaltered MLL (48). Therefore, we tested whether MLL and the MLL fusion proteins regulate a largely overlapping set of genes and whether overexpression of these originally MLL-regulated genes is at the basis of the cellular immortalization process. If this hypothesis holds true it should be possible to abrogate MLL-ENL-mediated transformation by repression of MLL-regulated genes. In mice the direct biological counterpart of Mll is the Bmi-1 repressor oncoprotein. The haploinsufficieny phenotype of an Mll heterozygote animal is completely reverted if crossed into a Bmi-/- background, demonstrating that both proteins have opposite effects on a mostly identical set of targets (17). If MLL-activated genes play a decisive role in MLL fusion protein-mediated transformation, the overexpression of Bmi-1 should counteract the oncogenic transformation process. To test this supposition, the MLL-ENL cDNA was subcloned into a pMSCV vector, conferring puromycin resistance, and cotransduced with either a Neor Bmi-1 retrovirus (pMSCVneo-Bmi1) or a neomycin control virus into hematopoietic precursor cells. Transduction with two empty viruses served as an additional control. The cells were plated under double puromycin-neomycin selection in the standard methocel assay. As the results of triplicate experiments show in Fig. 6A, Bmi-1 was able to significantly reduce the formation of third-round colonies, indicating a weakened transformation potency of MLL-ENL in the presence this protein. This was not due to a simple toxic effect, as the growth properties and the number of colonies obtained in the first round of plating were comparable between different transductions. Figure 6B shows results of a representative example out of three experiments. The presence of the Bmi-1 virus was verified in the cell populations by southern blotting (Fig. 6B), and the coexpression of MLL-ENL and Bmi-1 RNA could be demonstrated by RT-PCR (Fig. 6C).
|
|
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
One of the advantages of the model we have developed is that it allows for testing of the role of individual targets of the fusion protein in the transformation process. Our experiments suggest that in isolation Hoxa7, Hoxa9, and Meis1 have similar partial effects on myeloid differentiation but that the combination of Hoxa9 and Meis1 in particular results in a complete block in differentiation that results in immortalization. Expression of these synergistic genes appears to be coordinately regulated, raising the question of whether all are direct targets of MLL. Considerable evidence suggests that Hox genes are directly regulated by MLL fusions. Expression of both Hoxa7 and Hoxa9 is dependent on wild-type MLL (17). Recently it has been shown that wild-type MLL binds to the Hoxa9 promoter and that changes in histone modifications at the promoter are MLL dependent (27, 30). In addition, using chromatin immunoprecipitation we have found that MLL fusion proteins also bind directly to a CpG-rich region in the first exon of the Hoxa9 gene in hematopoietic cells (26). These results suggest that Hox deregulation is mediated by direct fusion protein binding.
Increasing evidence supports a model for leukemogenesis in which disruption of transcription factors results in chimeric proteins that block differentiation and these act in concert with receptor tyrosine kinases that drive proliferation (15). It is noteworthy in this regard that the receptor tyrosine kinase Flt3, which is consistently expressed in MLL-associated leukemias, was also upregulated by the inducible MLL fusion protein. Thus, the MLL fusion protein might generate both the block in differentiation as a result of Hoxa7, Hoxa9, and Meis1 overexpression as well as overexpression of Flt3 to provide the "second hit" required for full transformation. Flt3 is likely to play a contributory role in MLL-induced leukemia because drugs that target the kinase activity effectively kill cells harboring MLL rearrangements (1).
Although we have shown that upregulation of Hox genes and Meis1 by MLL fusion proteins plays a pivotal role in blocking myeloid differentiation, other oncogenes upregulated by MLL-ENL-ERtm may contribute to transformation. For example N-myc expression was activated by MLL-ENL-ERtm. Given our previous results that MLL-ENL can cooperate with c-myc to establish an irreversible differentiation arrest (34), this suggests that N-myc may also contribute to blocking differentiation. Furthermore, Lmo2, which is overexpressed in some T-cell leukemias (13), also was upregulated by MLL-ENL-ERtm, suggesting that cross talk between several leukemogenic pathways may be operative in MLL-induced leukemia.
Despite the statistical significance the amplitude of the expression changes appears to be small for some of the genes listed. This is most likely because the study design allows only the sampling of one particular time point during a continuous process within a nonsynchronous cell population. Changes reflect only an average value and might be higher at other time points after 4-OHT withdrawal. In addition a small change in the expression of a master transcription factor or an initiating member of a signal transduction cascade will translate in a much larger and amplified signal output of the respective pathway. Therefore the numerical value alone is not necessarily proportional to the importance of the corresponding gene in the regulation of the differentiation process.
Finally, our results indicate that at least initially the transformed state established by MLL fusion proteins is reversible. This suggests that drugs that target the gain-of-function activity of the fusion proteins or perhaps the activity of downstream Hox genes may effectively reverse the differentiation block imposed by these oncogenes and ultimately be used as effective therapy for MLL-associated leukemias.
|
ACKNOWLEDGMENTS |
|---|
This work was supported by DFG grants SL27/6-1 and SFB473/B10 to R.K.S. and by a Specialized Center of Research (SCOR) grant from the Leukemia and Lymphoma Society and National Institutes of Health grant CA-92251 to J.L.H. R.KS. is a recipient of a Ria Freifrau-von-Fritsch Stiftung career development award.
|
FOOTNOTES |
|---|
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Armstrong, S. A., J. E. Staunton, L. B. Silverman, R. Pieters, M. L. den Boer, M. D. Minden, S. E. Sallan, E. S. Lander, T. R. Golub, and S. J. Korsmeyer. 2002. MLL translocations specify a distinct gene expression profile that distinguishes a unique leukemia. Nat. Genet. 30:41-47.[CrossRef][Medline]
3. Ayton, P. M., and M. L. Cleary. 2001. Molecular mechanisms of leukemogenesis mediated by MLL fusion proteins. Oncogene 20:5695-5707.[CrossRef][Medline]
4. Birke, M., S. Schreiner, M. P. Garcia-Cuellar, K. Mahr, F. Titgemeyer, and R. K. Slany. 2002. The MT domain of the proto-oncoprotein MLL binds to CpG-containing DNA and discriminates against methylation. Nucleic Acids Res. 30:958-965.
5. Butler, L. H., R. Slany, X. Cui, M. L. Cleary, and D. Y. Mason. 1997. The HRX proto-oncogene product is widely expressed in human tissues and localizes to nuclear structures. Blood 89:3361-3370.
6. Calvo, K. R., P. S. Knoepfler, D. B. Sykes, M. P. Pasillas, and M. P. Kamps. 2001. Meis1a suppresses differentiation by G-CSF and promotes proliferation by SCF: potential mechanisms of cooperativity with Hoxa9 in myeloid leukemia. Proc. Natl. Acad. Sci. USA 98:13120-13125.
7. Calvo, K. R., D. B. Sykes, M. P. Pasillas, and M. P. Kamps. 2002. Nup98-HoxA9 immortalizes myeloid progenitors, enforces expression of Hoxa9, Hoxa7 and Meis1, and alters cytokine-specific responses in a manner similar to that induced by retroviral co-expression of Hoxa9 and Meis1. Oncogene 21:4247-4256.[CrossRef][Medline]
8. DiMartino, J. F., P. M. Ayton, E. H. Chen, C. C. Naftzger, B. D. Young, and M. L. Cleary. 2002. The AF10 leucine zipper is required for leukemic transformation of myeloid progenitors by MLL-AF10. Blood 99:3780-3785.
9. Dimartino, J. F., and M. L. Cleary. 1999. Mll rearrangements in haematological malignancies: lessons from clinical and biological studies. Br. J. Haematol. 106:614-626.[CrossRef][Medline]
10. Djabali, M., L. Selleri, P. Parry, M. Bower, B. D. Young, and G. A. Evans. 1992. A trithorax-like gene is interrupted by chromosome 11q23 translocations in acute leukaemias. Nat. Genet. 2:113-118.[CrossRef][Medline]
11. Ernst, P., J. Wang, M. Huang, R. H. Goodman, and S. J. Korsmeyer. 2001. MLL and CREB bind cooperatively to the nuclear coactivator CREB-binding protein. Mol. Cell. Biol. 21:2249-2258.
12. Ernst, P., J. Wang, and S. J. Korsmeyer. 2002. The role of MLL in hematopoiesis and leukemia. Curr. Opin. Hematol. 9:282-287.[CrossRef][Medline]
13. Ferrando, A. A., D. S. Neuberg, J. Staunton, M. L. Loh, C. Huard, S. C. Raimondi, F. G. Behm, C. H. Pui, J. R. Downing, D. G. Gilliland, E. S. Lander, T. R. Golub, and A. T. Look. 2002. Gene expression signatures define novel oncogenic pathways in T cell acute lymphoblastic leukemia. Cancer Cell 1:75-87.[CrossRef][Medline]
14. Francis, M. K., D. G. Phinney, and K. Ryder. 1995. Analysis of the hormone-dependent regulation of a JunD-estrogen receptor chimera. J. Biol. Chem. 270:11502-11513.
15. Gilliland, D. G., and J. D. Griffin. 2002. The roles of FLT3 in hematopoiesis and leukemia. Blood 100:1532-1542.
16. Gu, Y., T. Nakamura, H. Alder, R. Prasad, O. Canaani, G. Cimino, C. M. Croce, and E. Canaani. 1992. The t(4;11) chromosome translocation of human acute leukemias fuses the ALL-1 gene, related to Drosophila trithorax, to the AF-4 gene. Cell 71:701-708.[CrossRef][Medline]
17. Hanson, R. D., J. L. Hess, B. D. Yu, P. Ernst, M. van Lohuizen, A. Berns, N. M. van der Lugt, C. S. Shashikant, F. H. Ruddle, M. Seto, and S. J. Korsmeyer. 1999. Mammalian Trithorax and polycomb-group homologues are antagonistic regulators of homeotic development. Proc. Natl. Acad. Sci. USA 96:14372-14377.
18. Hess, J. L., B. D. Yu, B. Li, R. Hanson, and S. J. Korsmeyer. 1997. Defects in yolk sac hematopoiesis in Mll-null embryos. Blood 90:1799-1806.
19. Hsieh, J. J., P. Ernst, H. Erdjument-Bromage, P. Tempst, and S. J. Korsmeyer. 2003. Proteolytic cleavage of MLL generates a complex of N- and C-terminal fragments that confers protein stability and subnuclear localization. Mol. Cell. Biol. 23:186-194.
20. Imamura, T., A. Morimoto, M. Takanashi, S. Hibi, T. Sugimoto, E. Ishii, and S. Imashuku. 2002. Frequent co-expression of HoxA9 and Meis1 genes in infant acute lymphoblastic leukaemia with MLL rearrangement. Br. J. Haematol. 119:119-121.[CrossRef][Medline]
21. Kroon, E., J. Krosl, U. Thorsteinsdottir, S. Baban, A. M. Buchberg, and G. Sauvageau. 1998. Hoxa9 transforms primary bone marrow cells through specific collaboration with Meis1a but not Pbx1b. EMBO J. 17:3714-3725.[CrossRef][Medline]
22. Lavau, C., C. Du, M. Thirman, and N. Zeleznik-Le. 2000. Chromatin-related properties of CBP fused to MLL generate a myelodysplastic-like syndrome that evolves into myeloid leukemia. EMBO J. 19:4655-4664.[CrossRef][Medline]
23. Lavau, C., S. J. Szilvassy, R. Slany, and M. L. Cleary. 1997. Immortalization and leukemic transformation of a myelomonocytic precursor by retrovirally transduced HRX-ENL. EMBO J. 16:4226-4237.[CrossRef][Medline]
24. Littlewood, T. D., D. C. Hancock, P. S. Danielian, M. G. Parker, and G. I. Evan. 1995. A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of heterologous proteins. Nucleic Acids Res. 23:1686-1690.
25. Luo, R. T., C. Lavau, C. Du, F. Simone, P. E. Polak, S. Kawamata, and M. J. Thirman. 2001. The elongation domain of ELL is dispensable, but its ELL-associated factor 1 interaction domain is essential for MLL-ELL-induced leukemogenesis. Mol. Cell. Biol. 21:5678-5687.
26. Martin, M. E., T. A. Milne, S. Bloyer, K. Galoian, W. Shen, D. Gibbs, H. W. Brock, R. Slany, and J. L. Hess. 2003. Dimerization of MLL fusion proteins immortalizes hematopoietic cells. Cancer Cell 4:197-207.[CrossRef][Medline]
27. Milne, T. A., S. D. Briggs, H. W. Brock, M. E. Martin, D. Gibbs, C. D. Allis, and J. L. Hess. 2002. MLL targets SET domain methyltransferase activity to Hox gene promoters. Mol. Cell 10:1107-1117.[CrossRef][Medline]
28. Moskow, J. J., F. Bullrich, K. Huebner, I. O. Daar, and A. M. Buchberg. 1995. Meis1, a PBX1-related homeobox gene involved in myeloid leukemia in BXH-2 mice. Mol. Cell. Biol. 15:5434-5443.[Abstract]
29. Nakamura, T., D. A. Largaespada, M. P. Lee, L. A. Johnson, K. Ohyashiki, K. Toyama, S. J. Chen, C. L. Willman, I. M. Chen, A. P. Feinberg, N. A. Jenkins, N. G. Copeland, and J. D. Shaughnessy, Jr. 1996. Fusion of the nucleoporin gene NUP98 to HOXA9 by the chromosome translocation t(7;11)(p15;p15) in human myeloid leukaemia. Nat. Genet. 12:154-158.[CrossRef][Medline]
30. Nakamura, T., T. Mori, S. Tada, W. Krajewski, T. Rozovskaia, R. Wassell, G. Dubois, A. Mazo, C. M. Croce, and E. Canaani. 2002. ALL-1 is a histone methyltransferase that assembles a supercomplex of proteins involved in transcriptional regulation. Mol. Cell 10:1119-1128.[CrossRef][Medline]
31. Owens, B. M., and R. G. Hawley. 2002. HOX and non-HOX homeobox genes in leukemic hematopoiesis. Stem Cells 20:364-379.
32. Picard, D., S. J. Salser, and K. R. Yamamoto. 1988. A movable and regulable inactivation function within the steroid binding domain of the glucocorticoid receptor. Cell 54:1073-1080.[CrossRef][Medline]
33. Rozenblatt-Rosen, O., T. Rozovskaia, D. Burakov, Y. Sedkov, S. Tillib, J. Blechman, T. Nakamura, C. M. Croce, A. Mazo, and E. Canaani. 1998. The C-terminal SET domains of ALL-1 and TRITHORAX interact with the INI1 and SNR1 proteins, components of the SWI/SNF complex. Proc. Natl. Acad. Sci. USA 95:4152-4157.
34. Schreiner, S., M. Birke, M. P. Garcia-Cuellar, O. Zilles, J. Greil, and R. K. Slany. 2001. MLL-ENL Causes a Reversible and myc-dependent block of myelomonocytic cell differentiation. Cancer Res. 61:6480-6486.
35. Schreiner, S. A., M. P. Garcia-Cuellar, G. H. Fey, and R. K. Slany. 1999. The leukemogenic fusion of MLL with ENL creates a novel transcriptional transactivator. Leukemia 13:1525-1533.[CrossRef][Medline]
36. Shen, W. F., S. Rozenfeld, A. Kwong, L. G. Kom ves, H. J. Lawrence, and C. Largman. 1999. HOXA9 forms triple complexes with PBX2 and MEIS1 in myeloid cells. Mol. Cell. Biol. 19:3051-3061.
37. Slany, R. K., C. Lavau, and M. L. Cleary. 1998. The oncogenic capacity of HRX-ENL requires the transcriptional transactivation activity of ENL and the DNA binding motifs of HRX. Mol. Cell. Biol. 18:122-129.
38. So, C. W., and M. L. Cleary. 2003. Common mechanism for oncogenic activation of MLL by forkhead family proteins. Blood 101:633-639.
39. So, C. W., and M. L. Cleary. 2002. MLL-AFX requires the transcriptional effector domains of AFX to transform myeloid progenitors and transdominantly interfere with forkhead protein function. Mol. Cell. Biol. 22:6542-6552.
40. Speck, N. A., and D. G. Gilliland. 2002. Core-binding factors in haematopoiesis and leukaemia. Nat. Rev. Cancer 2:502-513.[CrossRef][Medline]
41. Thorsteinsdottir, U., E. Kroon, L. Jerome, F. Blasi, and G. Sauvageau. 2001. Defining roles for HOX and MEIS1 genes in induction of acute myeloid leukemia. Mol. Cell. Biol. 21:224-234.
42. Thorsteinsdottir, U., A. Mamo, E. Kroon, L. Jerome, J. Bijl, H. J. Lawrence, K. Humphries, and G. Sauvageau. 2002. Overexpression of the myeloid leukemia-associated Hoxa9 gene in bone marrow cells induces stem cell expansion. Blood 99:121-129.
43. Tkachuk, D. C., S. Kohler, and M. L. Cleary. 1992. Involvement of a homolog of Drosophila trithorax by 11q23 chromosomal translocations in acute leukemias. Cell 71:691-700.[CrossRef][Medline]
44. Yagi, H., K. Deguchi, A. Aono, Y. Tani, T. Kishimoto, and T. Komori. 1998. Growth disturbance in fetal liver hematopoiesis of Mll-mutant mice. Blood 92:108-117.
45. Yeoh, E. J., M. E. Ross, S. A. Shurtleff, W. K. Williams, D. Patel, R. Mahfouz, F. G. Behm, S. C. Raimondi, M. V. Relling, A. Patel, C. Cheng, D. Campana, D. Wilkins, X. Zhou, J. Li, H. Liu, C. H. Pui, W. E. Evans, C. Naeve, L. Wong, and J. R. Downing. 2002. Classification, subtype discovery, and prediction of outcome in pediatric acute lymphoblastic leukemia by gene expression profiling. Cancer Cell 1:133-143.[CrossRef][Medline]
46. Yokoyama, A., I. Kitabayashi, P. M. Ayton, M. L. Cleary, and M. Ohki. 2002. Leukemia proto-oncoprotein MLL is proteolytically processed into 2 fragments with opposite transcriptional properties. Blood 100:3710-3718.
47. Yu, B. D., R. D. Hanson, J. L. Hess, S. E. Horning, and S. J. Korsmeyer. 1998. MLL, a mammalian trithorax-group gene, functions as a transcriptional maintenance factor in morphogenesis. Proc. Natl. Acad. Sci. USA 95:10632-10636.
48. Yu, B. D., J. L. Hess, S. E. Horning, G. A. Brown, and S. J. Korsmeyer. 1995. Altered Hox expression and segmental identity in Mll-mutant mice. Nature 378:505-508.[CrossRef][Medline]
49. Zeisig, B. B., S. Schreiner, M. P. Garcia-Cuellar, and R. K. Slany. 2003. Transcriptional activation is a key function encoded by MLL fusion partners. Leukemia 17:359-365.[CrossRef][Medline]
50. Zelent, A., F. Guidez, A. Melnick, S. Waxman, and J. D. Licht. 2001. Translocations of the RARalpha gene in acute promyelocytic leukemia. Oncogene 20:7186-7203.[CrossRef][Medline]
51. Zeleznik-Le, N. J., A. M. Harden, and J. D. Rowley. 1994. 11q23 translocations split the "AT-hook" cruciform DNA-binding region and the transcriptional repression domain from the activation domain of the mixed-lineage leukemia (MLL) gene. Proc. Natl. Acad. Sci. USA 91:10610-10614.
52. Ziemin-van der Poel, S., N. R. McCabe, H. J. Gill, R. Espinosa III, Y. Patel, A. Harden, P. Rubinelli, S. D. Smith, M. M. LeBeau, J. D. Rowley, et al. 1991. Identification of a gene, MLL, that spans the breakpoint in 11q23 translocations associated with human leukemias. Proc. Natl. Acad. Sci. USA 88:10735-10739.
This article has been cited by other articles:
| ||||||
