Human DNA Polymerase {iota} Utilizes Different Nucleotide Incorporation Mechanisms Dependent upon the Template Base

Human DNA polymerase ${iota}$ (Pol ${iota}$ ) is a member of the Y family of DNApolymerases involved in translesion DNA synthesis. Pol ${iota}$ is highlyunusual in that it possesses a high fidelity on template A,but has an unprecedented low fidelity on template T, preferringto misincorporate a G instead of an A. To understand the mechanismsof nucleotide incorporation opposite different template basesby Pol ${iota}$ , we have carried out pre-steady-state kinetic analysesof nucleotide incorporation opposite templates A and T. Theseanalyses have revealed that opposite template A, the correctnucleotide is preferred because it is bound tighter and is incorporatedfaster than the incorrect nucleotides. Opposite template T,however, the correct and incorrect nucleotides are incorporatedat very similar rates, and interestingly, the greater efficiencyof G misincorporation relative to A incorporation opposite Tarises predominantly from the tighter binding of G. Based onthese results, we propose that the incipient base pair is accommodateddifferently in the active site of Pol ${iota}$ dependent upon the templatebase and that when T is the templating base, Pol ${iota}$ accommodatesthe wobble base pair better than the Watson-Crick base pair.

INTRODUCTION

Top

Introduction

Replicative DNA polymerases synthesize DNA with high fidelity,and because of their intolerance of distortions in the DNA geometry,they are blocked at DNA lesions (4, 5). The DNA polymerasesbelonging to the Y family, on the other hand, are low-fidelityenzymes with the ability to replicate through DNA lesions. Humanspossess three Y family DNA polymerases (Pols)—Pol ${eta}$ , Pol ${kappa}$ ,and Pol ${iota}$ —and in addition, they have Rev1, which displaysspecificity for incorporating a C opposite template G. Pol ${eta}$ fromboth yeast and humans synthesizes DNA with a low fidelity, misincorporatingnucleotides with frequencies of $~$ 10^-2 to 10^-3 (11, 14, 19). Thefidelity of Pol ${kappa}$ is somewhat better than that of Pol ${eta}$ , becauseit misincorporates nucleotides with frequencies of $~$ 10^-3 to 10^-4(9, 16).

In contrast to Pol ${eta}$ and Pol ${kappa}$ , which exhibit nearly similar efficienciesand fidelities of nucleotide incorporation opposite each ofthe four template bases, Pol ${iota}$ incorporates nucleotides oppositethe various template bases with very different efficienciesand fidelities (7, 10, 18, 23). Pol ${iota}$ is most efficient at incorporatingthe correct nucleotide T opposite template A, and it also exhibitsthe highest fidelity opposite this template base, misincorporatingnucleotides with frequencies of $~$ 10^-4 to 10^-5. Opposite templatesG and C, Pol ${iota}$ exhibits a significant reduction in the efficiencyof correct nucleotide incorporation, and opposite both thesetemplate bases, it misincorporates nucleotides with frequenciesof $~$ 10^-1 to 10^-2. Pol ${iota}$ exhibits the lowest efficiency for incorporatingthe correct nucleotide A opposite template T, and opposite thistemplate base, it synthesizes DNA with an unprecedented lowfidelity; in particular, it misincorporates a G with an $~$ 10-fold-higherefficiency than it incorporates an A.

While the steady-state kinetic analyses used in the measurementsof efficiencies and fidelities of Pol ${iota}$ and other related polymerasesnoted above provide accurate measurements of the fidelity ofnucleotide incorporation, they provide little information regardingthe mechanistic basis of the fidelity. Thus, in order to understandthe mechanistic basis of the very different fidelities of Pol ${iota}$ on different template residues, it was necessary to use pre-steady-statekinetic analyses. Because pre-steady-state kinetics allows oneto directly measure the kinetics of nucleotide incorporationin the first enzyme turnover, with this approach, it is possibleto examine the rates of the individual steps of nucleotide incorporation,which are not observable once the enzyme undergoes subsequent,steady-state turnovers (2, 8).

Pre-steady-state kinetic analyses have been performed on severalDNA polymerases, including the Klenow fragment of Escherichiacoli DNA polymerase I (12, 13), the bacteriophage T7 DNA polymerase(17, 22), mammalian DNA polymerase ß (1, 21, 24),human DNA polymerase ${gamma}$ (6), and yeast Pol ${eta}$ (20). From these studies,it has been concluded that the basic mechanism of nucleotideincorporation by DNA polymerases consists of at least the followingsteps (Fig. 1). In step 1, the polymerase binds to the DNA,forming the preinsertion polymerase-DNA binary complex. In step2, the deoxynucleoside triphosphate (dNTP) binds to this binarycomplex, forming the preinsertion polymerase-DNA-dNTP ternarycomplex. In step 3, the phosphodiester bond is formed betweenthe ${alpha}$ -phosphate of the incoming dNTP and the 3' OH at the primerterminus, forming a postinsertion polymerase-DNA-pyrophosphatecomplex. In step 4, pyrophosphate is released, forming the postinsertionpolymerase-DNA binary complex. Then either the polymerase advancesto the next template base, forming another preinsertion polymerase-DNAbinary complex (step 5), or the polymerase dissociates fromthe DNA (step 6). Some of these steps may involve additionalelementary steps, such as conformational changes within thebinary or ternary complexes. For example, structural and kineticevidence has suggested that the initial dNTP binding step (step2) is coupled to a rapid induced-fit conformational-change step(24) and that the subsequent nucleotide incorporation step (step3) follows a rate-limiting conformational-change step (3, 15,20).

View larger version (14K):
[in this window]
[in a new window]
FIG. 1. Minimal mechanism of DNA synthesis by DNA polymerases. Briefly, these steps are DNA binding (step 1), dNTP binding (step 2), phosphodiester bond formation (step 3), pyrophosphate release (step 4), and either advancement to the next template residue (step 5) or DNA release (step 6). The subscripts pre and post refer to the pre- and postnucleotide insertion complexes, respectively. The numbers refer to the steps described in the text.

Using pre-steady-state kinetics, here we investigate the mechanisticdifferences between nucleotide incorporation opposite templatesA and T by Pol ${iota}$ that are responsible for the high fidelity ontemplate A and extremely low fidelity on template T. We foundthat on template A, the correct nucleotide is preferred becauseit binds tighter (step 2) and is incorporated faster (step 3)than the incorrect nucleotides. In contrast, opposite templateT, the correct and incorrect nucleotides are incorporated atsimilar rates. Interestingly, the greater efficiency of G misincorporationopposite template T relative to correct A incorporation arisespredominantly from the tighter binding of G opposite T in theenzyme active site. We infer from these results that the incipientbase pair is accommodated differently in the active site ofPol ${iota}$ , depending on whether A or T is the templating base, andthat when the T is the templating base, the polymerase activesite better accommodates the wobble base pair rather than theWatson-Crick base pair.

MATERIALS AND METHODS

Top

Materials and Methods

DNA and nucleotide substrates. A synthetic 25-mer oligodeoxynucleotide (5'GCCTCGCAGCCGTCCAACCAACTCA)was used as the primer strand. Two synthetic 45-mer oligodeoxynucleotides(5'GGACGGCATTGGATCGACCTTGAGTTGGTTGGACGGCTGCGAGGC and 5'GGACGGCATTGGATCGACCATGAGTTGGTTGGACGGCTGCGAGGC)were used as the template T and A strands, respectively. Theprimer strand (10 µM) was 5'-³²P-end labeled with polynucleotidekinase (Boehringer Mannheim) and [ ${gamma}$ -³²P]ATP (6,000 Ci/mmol; AmershamPharmacia) at 37°C for 1 h. The labeled primer strands wereseparated from unreacted [ ${gamma}$ -³²P]ATP using a Sephadex G-25 spincolumn (Amersham Pharmacia). The 5'-³²P-end-labeled primer strandwas annealed to the template strand in 50 mM Tris Cl (pH 7.5)-100mM NaCl by heating to 90°C for 2 min and slowly coolingto room temperature over several hours. Annealed reactions werestored at 4°C for up to 1 week. Solutions of each dNTP (100mM, sodium salt) were purchased from U.S. Biochemicals and storedat -70°C.

Pol ${iota}$ purification. Pol ${iota}$ was overexpressed in yeast strain BJ5464 harboring plasmidpPOL114, which carries the glutathione S-transferase (GST) genefused in frame with full-length Pol ${iota}$ under control of the GALPGK promoter. The GST-Pol ${iota}$ fusion protein was purified by thesame protocol previously used to purify yeast Pol ${eta}$ (20). Followingcell lysis, the GST-Pol ${iota}$ fusion protein was bound to the glutathioneSepharose 4B matrix (Amersham Pharmacia). The Pol ${iota}$ protein wasthen eluted from the matrix by treatment with PreScission protease(Amersham Pharmacia), which cleaves between the GST and Pol ${iota}$ portions of the fusion protein, leaving full-length Pol ${iota}$ fusedto a 7-amino-acid N-terminal peptide. Protein concentrationswere determined by the Bio-Rad protein assay using bovine serumalbumin as a standard and by UV A₂₈₀ under denaturing conditions(8 M urea) using a molar extinction coefficient of 38,470 M^-1cm^-1 (calculated from the amino acid composition). Both methodsgave similar results. The total concentration of Pol ${iota}$ was comparedto the concentration of active Pol ${iota}$ (see Results), and the preparationof Pol ${iota}$ used in this study was found to be 87% active. The proteinwas stored in 10- to 50-µl aliquots at -70°C.

Pre-steady-state kinetics. All polymerase reactions were measured in 25 mM TrisCl (pH 7.5),5 mM MgCl₂, 5 mM dithiothreitol (DTT), and 10% glycerol at 22°C.The KinTek rapid chemical quench flow instrument was used toobserve the incorporation of dTTP opposite template A. PreincubatedPol ${iota}$ (130 nM final concentration) and DNA (300 nM final concentration)in the first syringe were rapidly mixed with various concentrationsof dTTP (0 to 50 µM final concentration) in the secondsyringe and quenched with 0.3 M EDTA from the third syringeafter specified time intervals (0 to 15 s). The extended primerproducts were separated from the unextended primer reactantson a 15% polyacrylamide sequencing gel containing 8 M urea.Gel band intensities were measured with the PhosphorImager instrument(Molecular Dynamics).

The incorporation of dGTP, dATP, and dCTP opposite templateA and the incorporation of each of the four dNTPs opposite templateT were slow enough to be measured without using the quench flowinstrument. Initially, incorporation opposite template T wascarried out under identical conditions by using the quench flowinstrument. However, because the kinetics were linear underthese conditions, the incorporation opposite template T weresubsequently measured by hand using a final Pol ${iota}$ concentrationof 45 nM.

Data analysis. For correct nucleotide incorporation opposite template A, theamount of product formed (P) was graphed as a function of time(t). The data were fit by nonlinear regression (Sigma Plot 7.0)to the burst equation:

(1)
where A isthe amplitude of the pre-steady-state burst phase, k_obs is theobserved first order rate constant for the pre-steady-stateburst phase, and v is the observed rate for the linear, steady-statephase.

To determine the concentration of active Pol ${iota}$ ([Pol ${iota}$ ]) and thedissociation constant (K_D) for the DNA binding step (K_D^DNA),the amplitude of the pre-steady-state burst phase (A) was graphedas a function of total DNA concentration, [DNA]. The data werefit by nonlinear regression to the quadratic equation:

(2)

To determine the K_D for the initial nucleotide binding stepand the maximal first-order rate constant of nucleotide incorporation(k_pol) for correct nucleotide incorporation opposite templateA, the observed first-order rate constant (k_obs) was graphedas a function of [dNTP]. The data were fit by nonlinear regressionto the hyperbolic equation:

(3)

For incorrect nucleotide incorporation opposite template A aswell as the incorporation of all four nucleotides opposite templateT, the amount of product formed was graphed as a function oftime. The k_obs values were obtained by dividing the slope ofthe line by the active Pol ${iota}$ concentration, and the k_obs valueswere graphed as a function of [dNTP]. The K_D for the initialnucleotide binding step and the k_pol for the nucleotide incorporationstep were determined by fitting the data to the hyperbolic equation.

RESULTS

Top

Results

Human Pol ${iota}$ synthesizes DNA with high fidelity on a template Aresidue, but synthesizes DNA with an unprecedented low fidelityon a template T residue. To gain a clearer understanding ofthe mechanistic basis of the high fidelity of Pol ${iota}$ on some templatebases and low fidelity on others, we have examined the incorporationof all four incoming dNTPs by Pol ${iota}$ opposite template A and Tresidues in the first enzyme turnover (i.e., under pre-steady-stateconditions).

Pol ${iota}$ displays biphasic kinetics. In order to examine the incorporation of nucleotides in thefirst enzyme turnover, we first had to determine whether ornot Pol ${iota}$ displays biphasic kinetics, also referred to as "burstkinetics." To do this, we had to use Pol ${iota}$ concentrations similarto those of the DNA substrate, and we had to quench the reactionsafter time intervals often shorter than 1 s. This required theuse of the quench flow instrument. Preincubated Pol ${iota}$ (130 nMfinal, active polymerase concentration [see the section "Activesite titration and K_D for DNA binding"]) and the DNA substrate(300 nM final concentration) containing a template A residue(Fig. 2A) in one syringe were rapidly mixed with dTTP (50 µMfinal concentration) from the other syringe and quenched aftervarious time intervals ranging from 0.2 to 15 s.

View larger version (14K):
[in this window]
[in a new window]
FIG. 2. Pre-steady-state kinetics of nucleotide incorporation by Pol ${iota}$ . (A) The DNA substrate (template A) used in this study. (B) Preincubated Pol ${iota}$ (130 nM) and DNA (300 nM) were rapidly mixed with 50 µM dTTP for various time intervals by using a rapid chemical quench flow instrument. The amount of product formed was graphed as a function of time, and the solid line represents the best fit of the data to the burst equation with an amplitude equal to 100 ± 7 nM, a burst rate constant equal to 0.63 ± 0.07 s^-1, and a linear rate equal to 2.4 ± 0.6 nM/s.

The amount of product formed was graphed as a function of time(Fig. 2B), and the kinetics of T incorporation opposite a templateA residue was indeed biphasic. The best fit of the data to theburst equation (see Materials and Methods) yielded a burst amplitudeequal to 100 ± 7 nM, an observed burst rate constantequal to 0.63 ± 0.07 s^-1, and an observed linear rateconstant equal to 0.018 ± 0.005 s^-1. Biphasic, or burst,kinetics was observed, because nucleotide incorporation was35-fold faster in the first enzyme turnover than in subsequentenzyme turnovers. This means that the step that has an observedfirst-order rate constant equal to 0.018 s^-1 and limits thesteady-state enzyme turnovers must occur following the nucleotideincorporation step (step 3, Fig. 1), which has an observed first-orderrate constant equal to 0.63 s^-1. This steady-state rate-determiningstep is likely dissociation of the enzyme from the DNA substrate(step 6, Fig. 1).

Active site titration and K_D for DNA binding. The presence of a clearly discernible pre-steady-state burstphase allowed us to directly measure the K_D for the initialnucleotide binding step (K_D^dNTP) (step 2, Fig. 1) as well asthe first-order rate constant (k_pol) for the nucleotide incorporationstep (step 3, Fig. 1). However, before proceeding with thesemeasurements, we had to better define the reaction conditionsfor these experiments. Thus, we needed to measure the concentrationof active Pol ${iota}$ molecules and the K_D^DNA (step 1, Fig. 1). Becausethe amplitude of the pre-steady-state burst phase is equal tothe concentration of the Pol ${iota}$ -DNA complex at the beginning ofthe reaction, it is possible to determine the concentrationof active Pol ${iota}$ molecules and the K_D^DNA by looking at the variationof the pre-steady-state burst amplitude with the total concentrationof the DNA substrate used (8).

Pol ${iota}$ (150 nM final total concentration; see Materials and Methods)was preincubated with various concentrations of the DNA substrate(25 to 300 nM final concentration) in one syringe, and reactionswere initiated by rapidly mixing with dTTP (50 µM finalconcentration) from the other syringe. For each DNA concentration,the amount of product formed was graphed as a function of time(Fig. 3A), and the data from each plot were fit to the burstequation. The burst amplitude from each plot was then graphedas a function of DNA concentration (Fig. 3B). From the bestfit of these data to the quadratic equation (see Materials andMethods), we obtained a K_D^DNA equal to 44 ± 7 nM anda concentration of active Pol ${iota}$ molecules equal to 130 ±10 nM. Thus, the concentration of Pol ${iota}$ used in this study was87% active, and all other experiments were corrected for theconcentration of active Pol ${iota}$ .

View larger version (16K):
[in this window]
[in a new window]
FIG. 3. Determination of active Pol ${iota}$ concentration and the K_D for the DNA binding step (K_D^DNA). (A) Pol ${iota}$ (130 nM) was preincubated with various concentrations of DNA (•, 25 nM; ${blacksquare}$ , 50 nM; ${blacktriangleup}$ , 100 nM; ${blacktriangledown}$ , 150 nM; ${diamondsuit}$ , 200 nM; and , 300 nM), and the reactions were initiated by rapid mixing with 50 µM dTTP. The amount of product formed was graphed as a function of time, and the solid lines represent the best fits of these data to the burst equation. (B) The burst amplitudes from these fits were graphed as a function of DNA concentration, and the solid line represents the best fit of the data to the quadratic equation with a concentration of active Pol ${iota}$ equal to 130 ± 10 nM and a K_D^DNA equal to 44 ± 7 nM.

Mechanism of correct nucleotide incorporation opposite template A. We next determined the K_D^dNTP for the initial nucleotide bindingstep (step 2, Fig. 1) and the first-order rate constant k_polfor the nucleotide incorporation step (step 3, Fig. 1) in thecase of correct nucleotide T incorporation opposite a templateA residue. Pol ${iota}$ (130 nM) was preincubated with DNA (300 nM) inone syringe and mixed with various concentrations of dTTP (1to 50 µM) from the other syringe. For each dTTP concentration,the amount of product formed was plotted as a function of time(Fig. 4A), and the data in each plot were fit to the burst equation.The observed pre-steady-state burst rate constant (k_obs) wasthen graphed as a function of dTTP concentration (Fig. 4B),and the data were fit to the equation describing a hyperbola(see Materials and Methods). The average K_D^dNTP for the initialnucleotide binding step (step 2, Fig. 1) was 4.9 µM, andthe average first-order rate constant, k_pol, for the nucleotideincorporation step (step 3, Fig. 1) was 0.63 s^-1 (Table 1).

View larger version (16K):
[in this window]
[in a new window]
FIG. 4. Kinetics of incorporation of the correct nucleotide opposite a template A residue by Pol ${iota}$ . (A) Pol ${iota}$ (130 nM) was preincubated with DNA (300 nM), and the reactions were initiated by rapid mixing with various concentrations of dTTP (•, 1 µM; ${blacksquare}$ , 2 µM; ${blacktriangleup}$ , 5 µM; ${blacktriangledown}$ , 10 µM; ${diamondsuit}$ , 20 µM; and , 50 µM). The amount of product formed was graphed as a function of time, and the solid lines represent the best fits of these data to the burst equation. (B) The burst rate constants from these fits were graphed as a function of dTTP concentration, and the solid line represents the best fit of the data to the hyperbolic equation with a k_pol equal to 0.59 ± 0.02 s^-1 and a K_D^dTTP equal to 4.7 ± 0.4 µM.

View this table:
[in this window]
[in a new window]
TABLE 1. Nucleotide incorporation by Pol ${iota}$ on template A

Mechanism of incorrect nucleotide incorporation opposite template A. To better understand the mechanistic basis of the moderate fidelityof Pol ${iota}$ on the template A residue, we next determined the K_D^dNTPand k_pol values for incorrect nucleotide incorporation oppositethe template A base. Because of the slower rate of nucleotideincorporation with the incorrect nucleotides, it was possibleto do these experiments without the assistance of the quenchflow instrument. Pol ${iota}$ (130 nM) and DNA (300 nM) were mixed withvarious concentrations of dGTP, dATP, or dCTP (50 to 2000 µM)for various time points ranging from 15 to 90 s. The amountof product formed varied linearly with time, and no pre-steady-stateburst phase was observed in any of these reactions. This indicatesthat nucleotide incorporation in the first enzyme turnover occursat the same rate as incorporation in the subsequent enzyme turnovers.Thus, the nucleotide incorporation step (step 3, Fig. 1) hasnow become rate limiting in the steady state.

For each dNTP concentration, we plotted the amount of productformed versus time and calculated the observed first-order rateconstant, k_obs, for nucleotide incorporation from the slopeof each line. The k_obs was then graphed as a function of dNTPconcentration (Fig. 5), and from the best fit of these datato the hyperbolic equation, we obtained K_D^dNTP and k_pol valuesfor incorrect nucleotide binding and incorporation, respectively,opposite template A. The average K_D^dNTP values for the incorrectnucleotides ranged from 200 to 470 µM, and the averagek_pol values for the incorrect nucleotides ranged from 0.0019to 0.013 s^-1 (Table 1).

View larger version (14K):
[in this window]
[in a new window]
FIG. 5. Kinetics of incorporation of the incorrect nucleotides opposite a template A residue by Pol ${iota}$ . (A) Pol ${iota}$ (130 nM), DNA (300 nM), and dGTP (0 to 2000 µM) were reacted for various time intervals, and the linear rate constants of nucleotide incorporation were graphed as a function of dGTP concentration. The solid line represents the best fit of the data to the hyperbolic equation with a k_pol equal to 0.0038 ± 0.0003 s^-1 and a K_D^dGTP equal to 520 ± 110 µM. (B) Pol ${iota}$ (130 nM), DNA (300 nM), and dATP (0 to 1000 µM) were reacted for various time intervals, and the linear rate constants of nucleotide incorporation were graphed as a function of dATP concentration. The solid line represents the best fit of the data to the hyperbolic equation with a k_pol equal to 0.012 ± 0.001 s^-1 and a K_D^dATP equal to 240 ± 20 µM. (C) Pol ${iota}$ (130 nM), DNA (300 nM), and dCTP (0 to 2000 µM) were reacted for various time intervals, and the linear rate constants of nucleotide incorporation were graphed as a function of dCTP concentration. The solid line represents the best fit of the data to the hyperbolic equation with a k_pol equal to 0.0019 ± 0.0002 s^-1 and a K_D^dCTP equal to 280 ± 70 µM.

Mechanism of nucleotide incorporation opposite template T. To better understand the mechanistic basis of the extremelylow fidelity of Pol ${iota}$ on template T residues, we determined theK_D^dNTP and k_pol values for nucleotide incorporation oppositethis templating base. As was the case for incorrect nucleotideincorporation opposite template A, nucleotide incorporation—bothcorrect and incorrect—was slow enough to perform theseexperiments by hand, and the amount of product formed variedlinearly with time in the case of G, A, and T incorporation.We were unable to observe the incorporation of C opposite thetemplate T residue under any of the conditions tested. The k_obswas then graphed as a function of dNTP concentration (Fig. 6),and from the best fit of these data to the hyperbolic equation,we obtained K_D^dNTP values for correct and incorrect nucleotidebinding opposite a template T and k_pol values for subsequentnucleotide incorporation. The average K_D^dNTP value for dGTPbinding was 5.7 µM, while the K_D^dNTP values for dATP anddTTP were 46 and 61 µM, respectively (Table 2). The averagek_pol values for the nucleotide incorporation opposite templateT ranged from 0.029 to 0.054 s^-1 (Table 2).

View larger version (13K):
[in this window]
[in a new window]
FIG. 6. Kinetics of incorporation of nucleotides opposite a template T residue by Pol ${iota}$ . (A) Pol ${iota}$ (43 nM), DNA (300 nM), and dGTP (0 to 20 µM) were reacted for various time intervals, and the linear rate constants of nucleotide incorporation were graphed as a function of dGTP concnetration. The solid line represents the best fit of the data to the hyperbolic equation with a k_pol equal to 0.058 ± 0.002 s^-1 and a K_D^dGTP equal to 6.4 ± 0.4 µM. (B) Pol ${iota}$ (43 nM), DNA (300 nM), and dATP (0 to 50 µM) were reacted for various time intervals, and the linear rate constants of nucleotide incorporation were graphed as a function of dATP concentration. The solid line represents the best fit of the data to the hyperbolic equation with a k_pol equal to 0.021 ± 0.001 s^-1 and a K_D^dATP equal to 25 ± 2 µM. (C) Pol ${iota}$ (43 nM), DNA (300 nM), and dTTP (0 to 1,000 µM) were reacted for various time intervals, and the linear rate constants of nucleotide incorporation were graphed as a function of dTTP concentration. The solid line represents the best fit of the data to the hyperbolic equation with a k_pol equal to 0.034 ± 0.001 s^-1 and a K_D^dTTP equal to 60 ± 5 µM.

View this table:
[in this window]
[in a new window]
TABLE 2. Nucleotide incorporation by Pol ${iota}$ on template T

DISCUSSION

Top

Discussion

One remarkable feature of DNA polymerases is that their specificityfor the incoming nucleotide changes dramatically depending onthe template base present in their active site. For virtuallyall polymerases, there is a strong preference for incorporatingthe nucleotide that forms the correct Watson-Crick base pairwith the template base. Moreover, the catalytic efficiencieswith which any given polymerase forms the 4 possible correctbp are approximately the same. Pol ${iota}$ is an exception to theserules.

Pol ${iota}$ incorporates the correct nucleotide opposite template Awith an efficiency of several hundred to several thousand foldgreater than that opposite template T, while the efficiencyof correct nucleotide incorporation opposite templates G andC is intermediate between these extremes. The fidelity of nucleotideincorporation opposite the different template residues variesin a similar manner. The fidelity of Pol ${iota}$ is high opposite templateA, with error frequencies of 10^-4 to 10^-5. Opposite templatesG and C, Pol ${iota}$ has a relatively low fidelity, with error frequenciesranging from 10^-1 to 10^-2. Pol ${iota}$ has an unprecedented low fidelityopposite template T, with error frequencies ranging from 10⁺¹to 10^-1. The fidelity opposite template T is so poor that Pol ${iota}$ preferentially inserts the incorrect G $~$ 10-fold more efficientlythan the correct A (7, 10, 18, 23). These efficiencies and errorfrequencies of Pol ${iota}$ in the presence of each template residuewere previously determined by using steady-state kinetics. However,while steady-state kinetics allows one to accurately quantifythe efficiency and fidelity of nucleotide incorporation, itprovides little information about the mechanistic basis of theefficiency and fidelity. Pre-steady-state kinetics, in contrast,allows one to directly examine the contributions of the individualsteps of the nucleotide incorporation reaction to the efficiencyand fidelity of the reaction. Thus, to understand the mechanisticdifferences when various template bases are present in the activesite of Pol ${iota}$ , we examined the pre-steady-state kinetics of theincorporation of all four incoming nucleotides opposite templateA and template T residues.

Mechanistic basis of the high fidelity of Pol ${iota}$ opposite template A. A comparison of the K_D^dNTP values for the correct and incorrectnucleotides opposite template A indicates that the correct nucleotidebinds the polymerase-DNA binary complex with a 40- to 100-fold-higheraffinity than the incorrect nucleotides. Assuming an arbitrarynucleotide concentration of 100 µM, this would correspondto changes in the ${Delta}$ G associated with binding the correct versusthe incorrect nucleotide ( ${Delta}$ ${Delta}$ G) of 2.2 to 2.7 kcal/mol. From acomparison of the k_pol values for the incorporation of correctand incorrect nucleotides opposite template A, we find thatwhen the correct nucleotide is bound, it is incorporated 50to several hundred times faster than when the incorrect nucleotideis bound. This corresponds to changes in the free energy ofactivation when bound to the correct versus the incorrect nucleotide( ${Delta}$ ${Delta}$ G) of 2.2 to 3.4 kcal/mol. Thus, the enzyme binds the transitionstate of the elementary step corresponding to k_pol, be it thechemical step of phosphodiester bond formation or a conformationalchange step immediately preceding and limiting chemistry, betterwhen T is bound opposite template A than when the incorrectnucleotides are bound opposite A. From these observations, weconclude that opposite a template A residue, Pol ${iota}$ maintains arelatively high fidelity because of its selectivity for thecorrect nucleotide at both the initial nucleotide binding step(step 2, Fig. 1) and at the subsequent nucleotide incorporationstep (step 3, Fig. 1).

Mechanistic basis of the low fidelity of Pol ${iota}$ opposite template T. Opposite template T, we find that the correct nucleotide A doesnot bind the polymerase-DNA binary complex any better than theincorrect nucleotide T. In fact, the ${Delta}$ ${Delta}$ G for binding A versusT opposite template T is less than 0.2 kcal/mol. What is evenmore surprising is that the incorrect nucleotide G binds oppositetemplate T with an eightfold-better affinity than does A, whichcorresponds to a ${Delta}$ ${Delta}$ G of -1.2 kcal/mol. This indicates that Pol ${iota}$ binds the ground state of the incipient G-T wobble pair somewhattighter than the A-T Watson-Crick pair. From a comparison ofthe k_pol values for the correct and incorrect nucleotides, wefind that once bound to the polymerase-DNA complex, the threenucleotides A, G, and T are incorporated at similar rates, andthe ${Delta}$ G values for the incorporation of these different nucleotidesdiffer by less than 0.4 kcal/mol. We note that Pol ${iota}$ is very poorat incorporating a C opposite template T, and it remains unclearhow the polymerase discriminates so well against this incorrectbase pair.

Comparison of nucleotide incorporation opposite templates A and T. The incorporation of a correct T opposite template A differsdramatically from the incorporation of a correct A oppositetemplate T. When T is the templating base, the K_D^dNTP for thecorrect nucleotide increases by a factor of 10 compared to theK_D^dNTP for the correct nucleotide when A is the templating base.The change in the ${Delta}$ G associated with binding T opposite A versusbinding A opposite T ( ${Delta}$ ${Delta}$ G) is 1.3 kcal/mol. Thus, the presenceof T as the template base interferes with the ability of Pol ${iota}$ to bind the correct incoming nucleotide in the ground state.Similarly, when T is the template base, the k_pol for the correctnucleotide incorporation step decreases 20-fold compared towhen A is the template base. This corresponds to a ${Delta}$ ${Delta}$ G for incorporatingT bound opposite template A versus A bound opposite templateT of 1.8 kcal/mol. This means that Pol ${iota}$ does not stabilize thetransition state of the correct nucleotide incorporation stepto the same degree with template T as it does with templateA.

Interestingly, for the misincorporation of G opposite templateT, the initial nucleotide binding step is remarkably similarto that of the T incorporation opposite template A. A comparisonof K_D^dNTP values shows that Pol ${iota}$ binds a G when T is the templatewith the same affinity as it binds T when A is the template;the ${Delta}$ G values in these two cases differ by less than 0.1 kcal/mol.Thus, with respect to the initial nucleotide binding step (step2, Fig. 1), no differences are observed between the bindingaffinity of an incorrect G opposite T and the binding of a correctT opposite A. A comparison of the k_pol values indicates thatupon nucleotide binding, the G opposite a template T is incorporated12-fold slower than the incorporation of a T opposite templateA, and this corresponds to a ${Delta}$ ${Delta}$ G for incorporating T bound oppositeA versus G bound opposite T of 1.4 kcal/mol. Thus, despite nearlythe same affinity for binding the T-A and G-T base pairs inthe ground state, Pol ${iota}$ does not stabilize the transition stateof the nucleotide incorporation step (step 3, Fig. 1) to thesame degree with G-T base pair as it does with the T-A basepair.

Structural basis for the unusual specificity of Pol ${iota}$ . Although an understanding of the observed nucleotide incorporationspecificities at the structural level awaits the structuresof Pol ${iota}$ in ternary complexes with several different incipientbase pairs, based on the pre-steady-state kinetics reportedhere, we can make some predictions about the interactions ofthe enzyme with different incipient base pairs. Our resultssuggest that the incipient base pair is accommodated differentlyin the active site of Pol ${iota}$ , depending on whether an A or a Tis the template base. Because the K_D^dNTP is lower for bindingthe correct nucleotide T opposite template A than it is forbinding the incorrect nucleotides, Pol ${iota}$ must bind the incipientbase pair in the ground state for the correct incoming nucleotideT opposite template A better than the incorrect nucleotides.That would suggest that when A is the template base, the enzymestabilizes the cannonical Watson-Crick base pairing geometryby making more close contacts with the T-A base pair than withthe three possible mispairs.

In contrast, the K_D^dNTP is lower for binding the incorrect nucleotideG opposite template T than it is for binding the correct nucleotideA. This implies that Pol ${iota}$ binds the ground state for the G-Tmispair better than the A-T base pair, suggesting that whenT is the template base, the enzyme better accommodates the G-Twobble base pairing geometry than the Watson-Crick base pairinggeometry. Furthermore, the fact that the K_D^dNTP for bindingG opposite T is the same as for binding T opposite A impliesthat Pol ${iota}$ must bind the ground state for the G-T mispair withnearly the same affinity as the T-A base pair. These resultspredict that in the ternary complexes of the T-A base pair andG-T mispair, the enzyme makes similar close contacts with theground state of the incipient base pair in these seemingly verydifferent cases.

ACKNOWLEDGMENTS

This work was supported by National Institutes of Health grantGM19261 and National Institute of Environmental Health Sciencesgrant ES012411.

FOOTNOTES

* Corresponding author. Mailing address: Sealy Center for Molecular Science, University of Texas Medical Branch at Galveston, 6.104 Blocker Medical Research Building, 11th and Mechanic Streets, Galveston, TX 77555-1061. Phone: (409) 747-8602. Fax: (409) 747-8608. E-mail: s.prakash{at}utmb.edu.

REFERENCES

Top