![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
* Ping Ji,1, Sven Diederichs,1 Jenny Potratz,1 Nicole Bäumer,1 Gabriele Köhler,2 Thomas Cauvet,1 Chunaram Choudary,1 Tiffany van der Meer,3 Wan-Yu Iris Chan,4 Conrad Nieduszynski,4 William H. Colledge,3 Mark Carrington,4 H. Phillip Koeffler,5 Anja Restle,6 Lisa Wiesmüller,6 Joëlle Sobczak-Thépot,7 Wolfgang E. Berdel,1 and Hubert Serve1
Hematology/Oncology, Department of Medicine,1 Gerhard Domagk Institute of Pathology, University of Münster, Münster,2 Gynaecological Oncology, Universitätsfrauenklinik, Ulm, Germany,6 Department of Physiology,3 Department of Biochemistry, University of Cambridge, Cambridge, United Kingdom,4 Division of Hematology/Oncology, Cedars-Sinai Medical Center/UCLA School of Medicine, Los Angeles, California,5 INSERM U370, Faculté de Médecine Necker, Institut Pasteur/Necker, Paris, France7
Received 22 March 2004/ Returned for modification 27 April 2004/ Accepted 21 July 2004
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-irradiation which was mediated by p53. cyclin A1–/– cells showed increased radiosensitivity. To unravel a potential role of cyclin A1 in DNA repair, we performed a yeast triple hybrid screen and identified the Ku70 DNA repair protein as a binding partner and substrate of the cyclin A1-CDK2 complex. DNA double-strand break (DSB) repair was deficient in cyclin A1–/– cells. Further experiments indicated that A-type cyclins activate DNA DSB repair by mechanisms that depend on CDK2 activity and Ku proteins. Both cyclin A1 and cyclin A2 enhanced DSB repair by homologous recombination, but only cyclin A1 significantly activated nonhomologous end joining. DNA DSB repair was specific for A-type cyclins because cyclin E was ineffective. These findings establish a novel function for cyclin A1 and CDK2 in DNA DSB repair following radiation damage. |
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cyclin A1 is a second A-type cyclin that binds CDK2. Cyclin A1 is abundantly expressed in the testis and has previously been shown to be essential for entry into the metaphase of meiosis I in the male germ line in mice (38, 44). Cyclin A1 is expressed at low levels in most other tissues, but no phenotype other than male infertility has been reported for mice lacking the cyclin A1 gene (19, 42). The expression of cyclin A1 in hematopoietic progenitor cells and in acute myeloid leukemia is best characterized in somatic cells (46). Surprisingly, recent microarray data suggested that cyclin A1 was transcriptionally induced following p53 activation (21).
Thus, the physiological role of cyclin A1 in somatic cells remains unknown. This prompted us to analyze the mechanisms of cyclin A1 induction in somatic cells and the functional consequences. Our analyses revealed a novel function for p53-induced cyclin A1 and CDK2 in DNA double-strand break (DSB) repair.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-irradiation.
cyclin A1 knockout mice were generated by substituting the cyclin A1 coding sequence with the ß-galactosidase gene (42). Six-week-old BALB/c mice were -irradiated with 5 Gy and sacrificed after 24 or 48 h. At least two mice were analyzed at each time point. Spleens were stained for ß-galactosidase activity as described previously (3), and sections were prepared after paraffin-embedding. For reverse transcription-PCR, RNA was isolated from various organs. Colony formation assays were performed with bone marrow cells prepared from cyclin A1–/– and matched wild-type mice. Bone marrow cells were -irradiated (1 Gy) in vitro before cells were plated in methylcellulose with appropriate growth factors as described (27). Colonies were counted on day 14. Experiments were performed in triplicates, and the box plots represent the results of three independent experiments. The comet assay was performed as described previously with slight modifications (32). In brief, cells were mixed with low-melting-point agarose and layered onto slides. Nuclei were lysed and electrophoresed in alkaline electrophoresis solution for 30 min at 300 mA (14 V). The slides were neutralized and stained with ethidium bromide. A fluorescence microscope (Axioskop; Zeiss, Jena, Germany) connected with a digital camera control unit (Spot RT) was used to acquire images of 100 randomly selected cells. The frequency of comet tail migration as an indication of DNA DSB repair was analyzed.
Real-time quantitative reverse transcription-PCR. Real-time quantitative reverse transcription-PCR was performed essentially as described (18, 22). Primer and probe sequences were as follows: mouse cyclin A1, forward (5'-TTTCCCCAATGCTGGTTGA) and reverse (5'-AACCAAAATCCGTTGCTTCCT) and probe (5'-CCCACCACCCATGCCCAGTCA; mouse glyceraldehhyde-3-phosphate dehydrogenase, forward (5'-TTGTGCAGTGCCAGCCTC) and reverse (5'-CCAATACGGCCAAATCCG) and probe (5'-TCCCGTAGACAAAATGGTGAAGGTCGGT; the primer and probe sequences for human cyclins and human glyceraldehhyde-3-phosphate dehydrogenase have been described (26). PCRs were followed in real time with an SDS7700 sequence detector (Applied Biosystems). Serial dilutions of cDNA were run on each plate as standard curves, and gene expression levels were calculated with regard to these standards. Expression levels were standardized to cDNA concentrations with glyceraldehhyde-3-phosphate dehydrogenase expression levels.
Cyclin A1 promoter constructs and luciferase assays. The cloning of the human cyclin A1 promoter has been described (23). The 5' deletions were generated with S1 exonuclease treatment. The GC boxes were point mutated with the transformer site-directed mutagenesis kit (Clontech) (26). For luciferase assays, NIH 3T3 cells were transfected with 2 µg of cyclin A1 luciferase reporter construct, the pRL-SV40 construct (100 ng) (Promega), and 2 µg of either pCMV-p53 or an empty cytomegalogivurs expression vector. Drosophila S2 cells were transfected with the cyclin A1 promoter construct with the two proximal Sp1 binding sites mutated along with the pRL-Null vector (Promega), the p53 expression vector, and the pAC-Sp1 expression plasmid (23). Transfections were performed with Superfect (QIAGEN), and cells were lysed after 48 h in passive lysis buffer (Promega). Activities of firefly and Renilla luciferases were determined with the dual-luciferase assay (Promega). Experiments were independently performed three times, and the data presented are means and standard errors.
Chromatin immunoprecipitation. Chromatin immunoprecipitation was performed as described with slight modifications (37). PCRs were followed in real time with either the 5'Nuclease assay with TaqMan technology (cyclin A1 and ß-globin promoter) or with SYBR Green (p21CIP1 promoter). The following primers were used: cyclin A1 forward (5'-CTCTTAACCGCGATCCTCCAG) and cyclin A1 reverse (5'-CAATAAAAGATCCAGGGTACATGATTG) and cyclin A1 probe (5'-FAM-TCCCGTCGTTATCTTTCTATGTGTCCGG-TAMRA) and p21CIP1 forward (CCGCTCGAGCCCTGTCGCAAGGATCC) and p21CIP1 reverse (GGGAGGAAGGGGATGGTAG). ß-:globin primers and probe were 5'-GTGAAGGCTCATGGCAAGAAAG-3' (forward), 5'-CAGCTCACTCAGTGTGGCAAAG-3' (reverse), and 5'-VIC-ATGGCCTGGCTCACCTGGACAACC-3' (probe). The results are presented as the average of two independent experiments with each condition being analyzed in three separate PCRs.
Triple hybrid screen. Full-length human cyclin A1 cDNA was cloned in frame with the Gal4 DNA binding domain into the EcoRI and SalI sites of the pBridge vector. (Clontech). Within the cyclin A1 cDNA, the destruction box was point-mutated (R81C) to ensure consistently high expression of the GAL4-binding domain-cyclin A1 fusion protein. Full-length human CDK2 cDNA was cloned into the NotI and BglII sites of pBridge so that expression was regulated by the conditional methionine promoter (PMet25). This construct was used as the bait in a triple hybrid screen of a cDNA library from human testis, constructed in pACT2 (Clontech). Approximately 8 x 106 colonies were screened for activation of the HIS3, ADE, and lacZ reporter genes with Saccharomyces cerevisiae strain AH109 in the absence of methionine. The cDNAs from positive colonies were amplified by PCR and sequenced with standard procedures.
Expression of cyclin A1, cyclin A2, cyclin E, and CDK2 in SF9 cells and in vitro kinase assay.
The cyclin A1, cyclin A2, and CDK2 cDNAs were individually cloned into pBacPAK8 (Invitrogen), and recombinant baculovirus was generated with the BaculoGold system (Pharmingen). Baculovirus with cyclin E was kindly provided by Heike Laman (Wolfson Institute, London, United Kingdom). Recombinant baculovirus was used to infect Sf9 cells. The multiplicity of infection was 10. Sixty hours after infection, cells were lysed in buffer (50 mM Tris-HCl, 150 mM NaCl, 1% Nonidet P-40, and 1x protease inhibitor cocktail, pH 7.5). For in vitro kinase assays, 1 µl of lysate (2 µg of total protein per µl) was used in a 36-µl kinase reaction (50 mM HEPES, 1 mM NaF, 0.1 mM NaVO4, 10 mM MgCl2, 1 mM dithiothreitol, pH 7.0) containing 10 µM ATP, 3 µCi of [-32P]ATP, and 2 µg of glutathione S-transferase (GST) fusion proteins bound to glutathione beads in a 50% slurry. The reactions were incubated at 30°C for 20 min. Beads were washed in kinase buffer once, and the phosphorylated proteins were analyzed by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) and autoradiography.
In vitro binding assay. The Ku70 and Ku80 cDNA or deletion constructs of Ku70 cDNA were expressed in Escherichia coli BL21 as GST fusion proteins; 1 µg of GST fusion protein or 1 µg of GST bound to Sepharose beads was incubated in 1 ml of binding buffer (20 mM HEPES, 150 mM NaCl, 10 mM NaF, 0.4 mM EDTA, 1% Triton X-100m and 1x protease inhibitor cocktail, pH 7.2) with 10 µg of Sf9 lysate with baculovirus-expressed proteins or with lysates from U937 leukemia cells.
Immunoprecipitation and immunoblotting. U937 cells were lysed in radioimmunoprecipitation (RIPA) buffer; 300 µg of cell lysate was used in the immunoprecipitation assays with 3 µg of primary antibody in 500 µl of RIPA buffer for 2 h at 4°C; 50 µl of a 50% slurry of protein A/G-Plus agarose (Santa Cruz Biotechnology) was added for another 1 h, and beads were washed three times with RIPA buffer. Immunoblot analyzes were performed following standard procedures (27). The antibodies used for immunoblotting were antiactin (Sigma), anti-Ku70 (BD-Transduction), anti-GST (Santa Cruz), anti-cyclin A2 (Sigma), anti-cyclin A1 (C20) (45), and anti-cyclin A1 (BD-Pharmingen).
Generation of murine embryonic fibroblasts. Mice with homozygous deletion of p53 were obtained from Jackson Laboratories. Murine embryonic fibroblasts (MEF) were established from E13.5 embryos derived from breeding of cyclin A1+/– females and males. Murine embryonic fibroblasts from Ku80–/– and Ku80+/+ mice were kindly provided by André Nussenzweig. MEF cells were grown in Dulbecco's modified Eagle's medium with 10% fetal bovine serum, and passage 4 to 6 cells were used for the experiments.
In vitro DNA repair assays. Whole-cell and nuclear extracts were prepared as described previously (12). For whole-cell extracts, 108 cells were used in each preparation to yield 0.5 ml of extract with a protein concentration of 8 to 12 mg/ml. For nuclear extracts, cells were incubated in lysis buffer (20 mM HEPES, 10 mM KCl, 0.1 mM EDTA, 1 mM dithiothreitol, 1.5 mM MgCl2, 0.25% NP-40, and 1x protease inhibitor cocktail [Roche, Mannheim, Germany]) for 20 min on ice. Nuclei were pelleted, resuspended in lysis buffer containing 0.4 M NaCl and 25% glycerol, and kept on ice for 30 min. The supernatant was dialyzed with dialysis buffer (50 mM Tris-HCl, 1 mM dithiothreitol, 1 mM EDTA, and 10% glycerol) for 4 h. Aliquots were snap frozen and stored at –80°C until use.
For DSB repair reactions, plasmid pEGFP-1 (Clontech) was linearized with SmaI and used as the substrate. The reactions were performed in a volume of 20 µl in 30 mM HEPES-KOH, pH 7.8, 7 mM MgCl2, 50 µg of bovine serum albumin per ml, 1 mM ATP, 100 µM deoxynucleoside triphosphates, 40 mM phosphocreatine, and 0.5 U of creatine phosphokinase, pH 7.8. Cell lysate containing 50 to 100 µg of protein was incubated with 100 ng of linearized plasmid for 4 h at 25°C. In all experiments with addition of baculovirus-produced recombinant protein, control samples were incubated with equal amounts of wild-type virus-produced lysate. Following deproteinization, 10% of the reaction products were loaded onto a 0.8% agarose gel. Following electrophoresis, Southern blotting was performed with a digoxigenin-labeled enhanced green fluorescent protein (EGFP) RNA probe. To analyze the fidelity of in vitro repair, the rejoined ends were amplified with the primers 5'-TTCGCCACCTCTGACTTGA and 5'-ATGGCGCTCCTGGACGTA. PCR products were cloned with the Topo TA cloning kit (Invitrogen) and sequenced.
In vivo DNA repair assays. Plasmid pGL3-control (Promega) was linearized with either HindIII (site between the promoter and the luciferase cDNA) or NcoI (site includes the ATG initiation codon of the luciferase cDNA). The plasmid DNA was cotransfected along with the pRL-SV40 Renilla luciferase plasmid into MEF cells from wild-type and cyclin A1–/– mice with Lipofectamine (Invitrogen). After 24 h, cells were lysed in passive lysis buffer and analyzed by the dual luciferase assay (Promega). The data presented are means plus standard deviation of three independent experiments.
NIH 3T3 cells were similarly transfected with HindIII-linearized pGL3 control plasmid along with the pRL-SV40 vector and different amounts of plasmid pcDNA3.1-cyclin A1. Empty pcDNA3.1 was added to keep the amount of DNA constant. Homologous recombination repair and nonhomologous end joining (NHEJ) assays in KMV5 cells were performed as described (1).
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To investigate the effect of DNA-damaging -irradiation on cell cycle regulators, we determined expression levels of all proliferation-associated cyclins in the duodenum carcinoma cell line HuTu80 and the colon carcinoma cell line LoVo (Fig. 1A). Cyclin A1 was the only consistently induced cyclin, in striking contrast to the expression of cyclin A2, which decreased upon irradiation. Moreover, cyclins E1, E2, B1, and B2 decreased after irradiation. Expression of p21CIP1 served as the control for radiation response in all experiments (Fig. 1A). Several additional cell lines induced expression of cyclin A1 mRNA dose-dependently after -irradiation (Fig. 1B) and UV irradiation (data not shown), whereas cyclin A2 expression remained unchanged or decreased. The increase in the cyclin A1 mRNA levels was only observed in p53 wild-type cell lines (HuTu80, LoVo, and SW837), but not in a leukemic cell line harboring a p53 mutation (U937) (Fig. 1B).
|
-irradiation of p53 wild-type HuTu80 cells. These experiments indicated that DNA damage-induced cyclin A1 mRNA expression was accompanied by a subsequent increase in cyclin A1 protein levels (Fig. 1C and D).
To determine whether cyclin A1 expression was also induced in tissues after -irradiation, RNA was prepared from a range of tissues 24 or 48 h after wild-type mice were exposed to 5 Gy whole body -irradiation. RNA was isolated from control tissues at the same time. Induction of p21CIP1 occurred following irradiation and served as a positive control. Cyclin A1 was significantly induced following -irradiation in several tissues (Fig. 1E). This effect was specific for cyclin A1, since cyclin A2 levels decreased following irradiation (Fig. 1E). Cyclin A1 expression was repressed after -irradiation in testis, an organ with physiologically high levels of cyclin A1. General repression of transcription and a lack of a p53 effect (see below) are possible explanations. These explanations are supported by the finding that p21CIP1P was also not induced in the testis after -irradiation (Fig. 1E).
To examine whether the endogenous murine cyclin A1 promoter responded to -irradiation in vivo, we took advantage of a previously generated knockout mouse line in which a lacZ gene was placed under the control of the endogenous cyclin A1 promoter (42). cyclin A1 heterozygous mice were irradiated with 5 Gy, and ß-galactosidase activity was analyzed after 24 and 48 h in various tissues.
Histological sections of the organs indicated that the murine cyclin A1 promoter was induced following -irradiation. Enhanced LacZ expression was found in brain and lung, while its induction was found in spleen (Fig. 1F and data not shown). These results indicated that -irradiation could induce the endogenous murine cyclin A1 promoter in the organs of mice in vivo. In addition, the human cyclin A1 promoter but not the cyclin A2 promoter was activated by UV and -irradiation in luciferase assays following transient transfections (data not shown).
Cyclin A1 deficiency increases radiosensitivity of hematopoietic progenitor cells and of MEF. Irradiation-induced genes are often involved in the cellular response to DNA damage, and alterations of these genes can lead to changes in cellular sensitivity to radiation damage. We analyzed primary cells from bone marrow, an organ which expresses cyclin A1, for changes in radiosensitivity. Bone marrow from cyclin A1–/– mice exhibited slightly decreased colony formation potential (median, 110 versus 101 CFU, P = 0.2, not significant). However, upon irradiation of bone marrow with 1 Gy, cyclin A1+/+ bone marrow formed twice as many colonies as cyclin A1–/– bone marrow (median, 47 versus 23.5 CFU, P < 0.001, Wilcoxon test) (Fig. 2A).
|
p53 activates the cyclin A1 promoter. Cyclin A1 mRNA has recently been described to be expressed following p53 expression (21). This prompted us to analyze whether p53 induced cyclin A1 on the transcriptional level. For this purpose, a 1,344-bp fragment of the cyclin A1 promoter was cloned upstream of a luciferase reporter gene. Transient transfections showed that p53 induced cyclin A1 promoter activity in several cell types, including NIH 3T3 cells (data not shown). Since the cyclin A1 promoter does not contain a consensus p53 binding site, 5' deletions of the cyclin A1 promoter were used to identify the relevant cis-acting sites. A section of the cyclin A1 promoter sequence from –112 to +145 was fully responsive to p53, whereas a fragment from –37 to +145 was unresponsive in NIH 3T3 cells (Fig. 3A). This portion of the cyclin A1 promoter (–112 to –37) contains four functionally active GC boxes that can be bound by Sp1 and Sp3 proteins (23). Analyses of point mutated constructs (described in (23) indicated that GC boxes 3 and 4 mediated p53 responsiveness (Fig. 3B).
|
The induction of the cyclin A1 promoter via a p53-dependent pathway hints at a probable mechanism for cyclin A1 upregulation after DNA damage and corroborates its putative role in DNA damage response. Therefore, we searched for cyclin A1-interacting proteins associated with DNA repair pathways to reveal the molecular function of cyclin A1 and its catalytic partner CDK2 in response to irradiation.
Yeast triple hybrid screen. A yeast triple hybrid screen was performed to identify proteins that interact with the cyclin A1/CDK2 complex (Fig. 4A). The bait vector constitutively expressed a human cyclin A1-GAL4 binding domain fusion protein and conditionally expressed human CDK2 in the absence of methionine. The yeast strain carrying this plasmid was transformed with a human testis cDNA library, and 107 independent clones were screened for histidine and adenine autotrophy and lacZ expression. Altogether, 80 positive colonies were identified, and the library cDNAs from these colonies were amplified and sequenced. Most of these cDNAs encoded testis-specific transcripts and an unknown gene. These data will be presented elsewhere. We also found fragments of the repair protein Ku70. The Ku70/Ku80 heterodimer plays an important role in DNA double-strand break repair and is expressed in all cell types (17).
|
-helical region of the opposite heterodimerization partner. GST pulldown experiments confirmed the interaction of both Ku70 and Ku80 with cyclin A1 in vitro (Fig. 4C). Complex formation between Ku70 and cyclin A1 required the C terminus of the Ku70 protein, as shown by GST pulldown experiments with Ku70 deletion constructs fused to GST (Fig. 4D). An isolated fragment of Ku70 (amino acids 201 to 400) containing most of the central ß-barrel domain did not bind to cyclin A1 (data not shown). To further investigate protein interaction in vivo, we took advantage of the high levels of expression of cyclin A1 in the leukemia cell line U937 (25). The endogenous Ku70 protein coimmunoprecipitated with cyclin A1, indicating protein-protein interaction in vivo (Fig. 4E). These experiments provided evidence that cyclin A1 interacts with Ku70 in vitro and in vivo.
Cyclin A1/CDK2 phosphorylates Ku70 in vitro. Ku70 contains both potential CDK1/CDK2 phosphorylation sites and recruitment motifs. GST-Ku70 and GST-Ku80 were used as phosphorylation substrates for lysates of insect cells expressing cyclin A1 or CDK2 or both (Fig. 4F). Following the in vitro kinase reaction, GST proteins were resolved by SDS-PAGE, and dried gels were analyzed by autoradiography. The lysate prepared from cells expressing both cyclin A1 and CDK2 phosphorylated GST-Ku70 to a much greater extent than the others. GST-Ku80 was not phosphorylated, indicating the specificity of Ku70 phosphorylation.
Cyclin A1 functions in DNA repair in vitro and in vivo. An important function of Ku70 is to mediate the repair of DSBs in DNA through the nonhomologous end joining pathway. The comet assay (Fig. 2B and C) already hinted at defective DNA DSB in of cyclin A1–/– cells. We therefore analyzed DSB repair in MEF cells. In wild-type MEFs, cyclin A1 expression was detected by quantitative reverse transcription-PCR at levels comparable to that in bone marrow (Fig. 5A). Cyclin A1 mRNA was not detected in MEF cells derived from the cyclin A1 deletion mutants (not shown). The MEFs derived from cyclin A1–/– embryos proliferated significantly more slowly than wild-type MEFs after several passages in culture (C. Müller-Tidow et al., unpublished data). Thus, cyclin A1 is present in MEFs at low but functionally significant levels.
|
To analyze DNA DSB repair in MEFs in vivo, cells were transfected with a luciferase reporter plasmid (pGL3-control) previously linearized by digestion with HindIII, which cuts between the luciferase promoter and coding sequence, or with NcoI, which cuts at the initiation codon of the luciferase coding sequence. Under both conditions, wild-type MEFs showed higher levels of luciferase activity than cyclin A1–/– MEFs (Fig. 5E).
To unequivocally decide whether the reduction in the rate of NHEJ in the cyclin A1–/– MEFs was attributable to the absence of cyclin A1, we performed in vitro assays with lysates from cyclin A1–/– MEFs supplemented with increasing amounts of recombinant cyclin A1 and CDK2 (Fig. 6A) There was a dose-dependent effect on religation of the plasmid: low doses of cyclin A1/CDK2 stimulated religation, whereas high levels of cyclin A1/CDK2 inhibited religation. A comparable result was obtained with nuclear extracts prepared from HeLa cells (HeLa cells express very low levels of endogenous cyclin A1 (22) (Fig. 6B).
|
To rule out that repair in these assays was mediated by alternative mechanisms, we employed a second in vivo system that is based on microhomology-mediated repair to assess NHEJ (1). The cotransfected SceI nuclease cuts the EJ-EGFP plasmid in vivo. Repair of the plasmid by NHEJ but not by other repair mechanisms enables transcription of a complete EGFP coding sequence. EGFP expression is visualized after 24 and 48 h by flow cytometry. With this assay, we tested the effects of transiently transfected cyclin A1 and compared it with that of cyclin A2. Cyclin A1 significantly activated NHEJ after 24 h (P = 0.028) and after 48 h (P = 0.028) (Mann-Whitney U test) (Fig. 6D). Cyclin A2 effects were smaller and statistically not significant compared to those of the control vector at 24 h (P = 0.35, not significant) and at 48 h (P = 0.08, not significant) (Fig. 6D). These data confirmed that cyclin A1 activated NHEJ.
We further analyzed whether cyclin A1 also activated the more complex homologous recombination repair pathway. For this purpose, another modified EGFP plasmid (HR-EGFP) was cut in vivo by cotransfection of an expression plasmid encoding the SceI restriction enzyme. Repair of the plasmid by homologous recombination in KMV5 cells in vivo led to EGFP expression which was quantitatively analyzed with flow cytometry (1). Transient cyclin A1 expression enhanced homology-directed DNA DSB repair by about 50% (Fig. 6E). We further analyzed homologous recombination repair with substrates with genomic integration of the HR-EGFP system. Both cyclin A1 (P = 0.028) and cyclin A2 (P = 0.046) significantly activated homologous recombination after 72 h. No difference was found between cyclin A1 and cyclin A2 (P = 0.6, not significant) (Fig. 6F). Taken together, cyclin A1 and cyclin A2 stimulate homologous recombination repair, while cyclin A1 specifically activates NHEJ.
DSB repair activation by cyclin A1 depends on CDK2 and Ku proteins. We next determined whether the cyclin A1-interacting proteins CDK2 and the Ku proteins were essential for the stimulatory effects of cyclin A1 on DSB repair. First, we tested the importance of CDK2 kinase activity by adding the CDK2 inhibitor olomoucine to cyclin A1–/– MEF extracts supplemented with cyclin A1 and CDK2. In these experiments, olomoucine-exposed extracts showed significantly lower rates of DNA DSB repair (Fig. 7A).
|
While these data evidenced a role for cyclin A1-CDK2 in DNA DSB repair, it remained unclear whether these effects depended on Ku proteins. Ku80–/– cells do not express Ku80 and also, because of decreased protein stability, do not express significant levels of Ku70 protein (Fig. 7D) (7, 29). Extracts from these cells and from the corresponding wild-type cells were prepared and tested for DSB repair activation by cyclin A1. Cyclin A1-CDK2 activated end joining in the wild-type cells but not in the Ku-deficient cells (Fig. 7E). Addition of recombinant Ku protein expressed as His-tagged proteins in the baculovirus system reconstituted the ability of cyclin A1-CDK2 to activate DNA DSB repair (Fig. 7F). These data demonstrated that the cyclin A1-CDK2 effects on DNA DSB repair by NHEJ are mediated by Ku proteins.
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cyclin A1 is (in the absence of DNA damage) a tissue-specific cyclin with high levels of expression in the testis and in acute myeloid leukemia (44, 46). In acute myeloid leukemia, cyclin A1 is induced by various mechanisms, including c-Myb and the promyelocytic leukemia-retinoic acid receptor alpha oncogene (24, 25). Here, we demonstrate that cyclin A1 is induced by -irradiation via a p53-mediated mechanism. This was a surprising finding given that the other CDK2-associated cyclins are inhibited and/or repressed following p53 activation. In combination with the finding of increased radiosensitivity of cyclin A1–/– cells, these results suggested a potential role for cyclin A1-CDK2 in the cellular response to DNA damage.
In a triple hybrid screen involving cyclin A1-CDK2 as the bait, we identified the Ku70 protein as a specific interaction partner. The Ku70 and Ku80 proteins function in DNA replication, recombination in B and T cells, and DNA repair (41). DNA replication critically depends on cyclin A2 (8), and therefore the Ku70-cyclin A1 interaction was more likely to play a role in other processes, since neither Ku70 nor cyclin A1 deficiency precluded DNA replication (19, 31). Also, meiotic recombination e.g., during spermatogenesis, utilizes elaborate regulatory mechanisms of DNA repair to avoid genomic instability. Cyclin A1 is essential for spermatogenesis (19, 42). Consequently, we analyzed the involvement of cyclin A1-CDK2 in the regulation of DNA DSB repair. Ku70 as well as its heterodimerization partner Ku80 bound to cyclin A1, and Ku70 was specifically phosphorylated by cyclin A1-CDK2 complexes in vitro. Phosphorylation of Ku70 protein has not been described before, and our findings suggest that cyclin A1-dependent phosphorylation might play a role in DNA DSB repair. Nonetheless, the functional consequences of Ku70 phosphorylation remain incompletely understood.
DNA DSB repair plays an important role in genomic stability (9, 10). The CDK2-associated cyclin E is a known inducer of genomic instability and is associated with a poor prognosis for several types of cancer (36). In contrast, cyclin A2 overexpression was not associated with genomic instability. Thus, it is likely that the relative expression patterns of the CDK-associated cyclins regulate DNA replication or DNA DSB repair. Changes in the expression patterns of different CDK2-associated cyclins (following DNA damage) might influence not only proliferation but also DNA DSB repair.
Cyclin A1 is essential during meiosis I in the male mouse, indicating a possible role of cyclin A1 in homologous recombination. In hematopoietic cells, expression peaks in S and G2 phases, consistent with a role in homologous recombination between sister chromatids. Still, it seems to be contradictory that cyclin A1 activates NHEJ and at the same time stimulates homology-directed DSB repair, two competing pathways in DSB repair that are differentially regulated by Ku (13, 33). Interestingly, however, Ku also carries functions in modulating the DNA protein kinase enzyme (6), which in turn suppresses homologous recombination (2). Moreover, Ku also affects ATM, which phosphorylates multiple proteins involved in homologous recombination (48). Thus, cyclin A1-dependent phosphorylation of Ku may function not only in promoting NHEJ but also in additional relevant processes. A coordinated response is compatible with the concept that homologous repair and NHEJ are not completely separable and that coupling of invasion of one chromosome end into homologous sequences and subsequent NHEJ of the originally broken chromosome effectively prevents rearrangements between different chromosomes (35). Thus, cyclin A1 is expected to play a role in the maintenance of genome stability under physiological conditions, whereas aberrant expression may cause deregulated DSB repair and therefore contribute to leukemogenesis.
How specific is the involvement of cyclin A1 in DNA DSB repair? In our in vitro experiments, cyclin A1 activated DNA DSB repair more strongly than cyclin A2. Accordingly, in NHEJ in vivo assays, cyclin A1 again was more active. Importantly, repair depended on CDK2, and cyclin E did not have a significant effect on DNA DSB repair. In homologous recombination repair, both cyclin A1 and cyclin A2 were active. These data indicate that with the experimental conditions used, A-type cyclins can activate DNA DSB repair. However, several points of evidence indicate that cyclin A1 might have a special role in DNA DSB repair. First, cyclin A1 was the only cyclin to be induced by -irradiation and p53, whereas cyclin A2 expression was consistently repressed. Thus, in circumstances that require DSB repair, cyclin A1 is induced, whereas cyclin A2 is downregulated. Second, cyclin A1-deficient MEF cells, which readily expressed cyclin A2, were impaired in DNA DSB repair. Third, increased radiosensitivity was observed in hematopoietic progenitor cells and MEFs of cyclin A1–/– mice. The high levels of cyclin A2 expressed in these proliferating cells did not protect from the radiation damage, indicating a special function for cyclin A1. Nonetheless, our data do not rule out that cyclin A2 also plays a role in DNA DSB repair.
What is the relationship between cyclin A1 induction by DNA damage and p53 and cyclin A1-activated DNA DSB repair? The p53 tumor suppressor is known to influence NHEJ. However, conflicting data exist about the role of p53 in DNA DSB repair. Several authors reported that p53 repressed NHEJ activity (1, 4, 16, 30). On the other hand, it has been reported that p53 activates DNA DSB repair (39, 47). These divergent findings do not merge easily into a coherent picture. It is tempting to speculate that the effects of p53 on DNA DSB repair may partially depend on the presence or absence of cyclin A1 in a particular cell type. Also, the late induction of cyclin A1 by p53 suggest that the effects of p53 on DNA DSB repair might vary at different times after genotoxic damage.
Taken together, our data provide evidence for a novel pathway linking p53 activity with cyclin A1 induction and subsequent DNA DSB repair.
|
ACKNOWLEDGMENTS |
|---|
This work is supported by grants from the Deutsche Forschungsgemeinschaft (Mu 1328/2-3 and Se 600/3), the Deutsche Krebshilfe (10-1539-Mü3), and the IZKF and IMF at the University of Münster. C.M.T. is supported by the DFG Heisenberg program (Mu 1328/3-1).
|
FOOTNOTES |
|---|
K.M.-T. and P.J. contributed equally.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Allen, C., A. Kurimasa, M. A. Brenneman, D. J. Chen, and J. A. Nickoloff. 2002. DNA-dependent protein kinase suppresses double-strand break-induced and spontaneous homologous recombination. Proc. Natl. Acad. Sci. USA 99:3758-3763.
3. Bäumer, N., T. Marquardt, A. Stoykova, R. Ashery-Padan, K. Chowdhury, and P. Gruss. 2002. Pax6 is required for establishing naso-temporal and dorsal characteristics of the optic vesicle. Development 129:4535-4545.
4. Bill, C. A., Y. Yu, N. R. Miselis, J. B. Little, and J. A. Nickoloff. 1997. A role for p53 in DNA end rejoining by human cell extracts. Mutat. Res. 385:21-29.[Medline]
5. Borellini, F., and R. I. Glazer. 1993. Induction of Sp1-p53 DNA-binding heterocomplexes during granulocyte/macrophage colony-stimulating factor-dependent proliferation in human erythroleukemia cell line TF-1. J. Biol. Chem. 268:7923-7928.
6. Chan, D. W., B. P. Chen, S. Prithivirajsingh, A. Kurimasa, M. D. Story, J. Qin, and D. J. Chen. 2002. Autophosphorylation of the DNA-dependent protein kinase catalytic subunit is required for rejoining of DNA double-strand breaks. Genes Dev. 16:2333-2338.
7. Chen, F., S. R. Peterson, M. D. Story, and D. J. Chen. 1996. Disruption of DNA-PK in Ku80 mutant xrs-6 and the implications in DNA double-strand break repair. Mutat. Res. 362:9-19.[Medline]
8. Coverley, D., H. Laman, and R. A. Laskey. 2002. Distinct roles for cyclins E and A during DNA replication complex assembly and activation. Nat. Cell. Biol. 4:523-528.[CrossRef][Medline]
9. Difilippantonio, M. J., J. Zhu, H. T. Chen, E. Meffre, M. C. Nussenzweig, E. E. Max, T. Ried, and A. Nussenzweig. 2000. DNA repair protein Ku80 suppresses chromosomal aberrations and malignant transformation. Nature 404:510-514.[CrossRef][Medline]
10. Ferguson, D. O., J. M. Sekiguchi, S. Chang, K. M. Frank, Y. Gao, R. A. DePinho, and F. W. Alt. 2000. The nonhomologous end-joining pathway of DNA repair is required for genomic stability and the suppression of translocations. Proc. Natl. Acad. Sci. USA 97:6630-6633.
11. Follows, G. A., H. Tagoh, P. Lefevre, D. Hodge, G. J. Morgan, and C. Bonifer. 2003. Epigenetic consequences of AML1-ETO action at the human c-FMS locus. EMBO J. 22:2798-2809.[CrossRef][Medline]
12. Frasca, D., P. Barattini, G. Tocchi, L. Guidi, L. Pierelli, and G. Doria. 2001. Role of DNA-dependent protein kinase in recognition of radiation-induced DNA damage in human peripheral blood mononuclear cells. Int. Immunol. 13:791-797.
13. Fukushima, T., M. Takata, C. Morrison, R. Araki, A. Fujimori, M. Abe, K. Tatsumi, M. Jasin, P. K. Dhar, E. Sonoda, T. Chiba, and S. Takeda. 2001. Genetic analysis of the DNA-dependent protein kinase reveals an inhibitory role of Ku in late S-G2 phase DNA double-strand break repair. J. Biol. Chem. 276:44413-44418.
14. Khanna, K. K., and S. P. Jackson. 2001. DNA double-strand breaks: signaling, repair and the cancer connection. Nat. Genet. 27:247-254.[CrossRef][Medline]
15. Koutsodontis, G., I. Tentes, P. Papakosta, A. Moustakas, and D. Kardassis. 2001. Sp1 plays a critical role in the transcriptional activation of the human cyclin-dependent kinase inhibitor p21(WAF1/Cip1) gene by the p53 tumor suppressor protein. J. Biol. Chem. 276:29116-29125.
16. Lee, H., D. Sun, J. M. Larner, and F. S. Wu. 1999. The tumor suppressor p53 can reduce stable transfection in the presence of irradiation. J. Biomed. Sci. 6:285-292.[CrossRef][Medline]
17. Lieber, M. R., Y. Ma, U. Pannicke, and K. Schwarz. 2003. Mechanism and regulation of human non-homologous DNA end-joining. Nat. Rev. Mol. Cell. Biol. 4:712-720.[CrossRef][Medline]
18. Linggi, B., C. Müller-Tidow, L. van de Locht, M. Hu, J. Nip, H. Serve, W. E. Berdel, B. van der Reijden, D. E. Quelle, J. D. Rowley, J. Cleveland, J. H. Jansen, P. P. Pandolfi, and S. W. Hiebert. 2002. The t(8;21) fusion protein, AML1 ETO, specifically represses the transcription of the p14(ARF) tumor suppressor in acute myeloid leukemia. Nat. Med. 8:743-750.[CrossRef][Medline]
19. Liu, D., M. M. Matzuk, W. K. Sung, Q. Guo, P. Wang, and D. J. Wolgemuth. 1998. Cyclin A1 is required for meiosis in the male mouse. Nat. Genet. 20:377-380.[CrossRef][Medline]
20. Lundberg, A. S., and R. A. Weinberg. 1998. Functional inactivation of the retinoblastoma protein requires sequential modification by at least two distinct cyclin-cdk complexes. Mol. Cell. Biol. 18:753-761.
21. Maxwell, S. A., and G. E. Davis. 2000. Differential gene expression in p53-mediated apoptosis-resistant versus apoptosis-sensitive tumor cell lines. Proc. Natl. Acad. Sci. USA 97:13009-13014.
22. Müller, C., C. Readhead, S. Diederichs, G. Idos, R. Yang, N. Tidow, H. Serve, W. E. Berdel, and H. P. Koeffler. 2000. Methylation of the cyclin A1 promoter correlates with gene silencing in somatic cell lines, while tissue-specific expression of cyclin A1 is methylation independent. Mol. Cell. Biol. 20:3316-3329.
23. Müller, C., R. Yang, L. Beck-von-Peccoz, G. Idos, W. Verbeek, and H. P. Koeffler. 1999. Cloning of the cyclin A1 genomic structure and characterization of the promoter region. GC boxes are essential for cell cycle-regulated transcription of the cyclin A1 gene. J. Biol. Chem. 274:11220-11228.
24. Müller, C., R. Yang, G. Idos, N. Tidow, S. Diederichs, O. M. Koch, W. Verbeek, T. P. Bender, and H. P. Koeffler. 1999. c-myb transactivates the human cyclin A1 promoter and induces cyclin A1 gene expression. Blood 94:4255-4262.
25. Müller, C., R. Yang, D. J. Park, H. Serve, W. E. Berdel, and H. P. Koeffler. 2000. The aberrant fusion proteins PML-RAR alpha and PLZF-RAR alpha contribute to the overexpression of cyclin A1 in acute promyelocytic leukemia. Blood 96:3894-3899.
26. Müller-Tidow, C., S. K. Metzelder, H. Buerger, J. Packeisen, A. Ganser, G. Heil, K. Kugler, G. Adiguzel, J. Schwable, B. Steffen, W. D. Ludwig, A. Heinecke, T. Buchner, W. E. Berdel, and H. Serve. 2004. Expression of the p14ARF tumor suppressor predicts survival in acute myeloid leukemia. Leukemia 18:720-726.[CrossRef][Medline]
27. Müller-Tidow, C., B. Steffen, T. Cauvet, L. Tickenbrock, P. Ji, S. Diederichs, B. Sargin, G. Kohler, M. Stelljes, E. Puccetti, M. Ruthardt, S. deVos, S. W. Hiebert, H. P. Koeffler, W. E. Berdel, and H. Serve. 2004. Translocation products in acute myeloid leukemia activate the Wnt signaling pathway in hematopoietic cells. Mol. Cell. Biol. 24:2890-2904.
28. Murphy, M., M. G. Stinnakre, C. Senamaud-Beaufort, N. J. Winston, C. Sweeney, M. Kubelka, M. Carrington, C. Brechot, and J. Sobczak-Thepot. 1997. Delayed early embryonic lethality following disruption of the murine cyclin A2 gene. Nat. Genet. 15:83-86.[CrossRef][Medline]
29. Nussenzweig, A., C. Chen, V. da Costa Soares, M. Sanchez, K. Sokol, M. C. Nussenzweig, and G. C. Li. 1996. Requirement for Ku80 in growth and immunoglobulin V(D)J recombination. Nature 382:551-555.[CrossRef][Medline]
30. Okorokov, A. L., L. Warnock, and J. Milner. 2002. Effect of wild-type, S15D and R175H p53 proteins on DNA end joining in vitro: potential mechanism of DNA double-strand break repair modulation. Carcinogenesis. 23:549-557.
31. Ouyang, H., A. Nussenzweig, A. Kurimasa, V. C. Soares, X. Li, C. Cordon-Cardo, W. Li, N. Cheong, M. Nussenzweig, G. Iliakis, D. J. Chen, and G. C. Li. 1997. Ku70 is required for DNA repair but not for T cell antigen receptor gene recombination In vivo. J. Exp. Med. 186:921-929.
32. Patton, W. P., U. Chakravarthy, R. J. Davies, and D. B. Archer. 1999. Comet assay of UV-induced DNA damage in retinal pigment epithelial cells. Investig. Ophthalmol. Vis. Sci. 40:3268-3275.
33. Pierce, A. J., P. Hu, M. Han, N. Ellis, and M. Jasin. 2001. Ku DNA end-binding protein modulates homologous repair of double-strand breaks in mammalian cells. Genes Dev. 15:3237-3242.
34. Porse, B. T., T. A. Pedersen, X. Xu, B. Lindberg, U. M. Wewer, L. Friis-Hansen, and C. Nerlov. 2001. E2F repression by C/EBPalpha is required for adipogenesis and granulopoiesis in vivo. Cell 107:247-258.[CrossRef][Medline]
35. Richardson, C., and M. Jasin. 2000. Coupled homologous and nonhomologous repair of a double-strand break preserves genomic integrity in mammalian cells. Mol. Cell. Biol. 20:9068-9075.
36. Spruck, C. H., K. A. Won, and S. I. Reed. 1999. Deregulated cyclin E induces chromosome instability. Nature 401:297-300.[CrossRef][Medline]
37. Steffen, B., H. Serve, W. E. Berdel, S. Agrawal, B. Linggi, T. Buchner, S. W. Hiebert, and C. Müller-Tidow. 2003. Specific protein redirection as a transcriptional therapy approach for t(8;21) leukemia. Proc. Natl. Acad. Sci. USA 100:8448-8453.
38. Sweeney, C., M. Murphy, M. Kubelka, S. E. Ravnik, C. F. Hawkins, D. J. Wolgemuth, and M. Carrington. 1996. A distinct cyclin A is expressed in germ cells in the mouse. Development 122:53-64.[Abstract]
39. Tang, W., H. Willers, and S. N. Powell. 1999. p53 directly enhances rejoining of DNA double-strand breaks with cohesive ends in gamma-irradiated mouse fibroblasts. Cancer Res. 59:2562-2565.
40. Torgeman, A., N. Mor-Vaknin, E. Zelin, Z. Ben-Aroya, M. Lochelt, R. M. Flugel, and M. Aboud. 2001. Sp1-p53 heterocomplex mediates activation of HTLV-I long terminal repeat by 12-O-tetradecanoylphorbol-13-acetate that is antagonized by protein kinase C. Virology 281:10-20.[CrossRef][Medline]
41. Tuteja, R., and N. Tuteja. 2000. Ku autoantigen: a multifunctional DNA-binding protein. Crit. Rev. Biochem. Mol. Biol. 35:1-33.[CrossRef][Medline]
42. van der Meer, T., W. Y. Chan, L. S. Palazon, C. Nieduszynski, M. Murphy, J. Sobczak-Thepot, M. Carrington, and W. H. Colledge. 2004. Cyclin A1 protein shows haplo-insufficiency for normal fertility in male mice. Reproduction 127:503-511.
43. Walker, J. R., R. A. Corpina, and J. Goldberg. 2001. Structure of the Ku heterodimer bound to DNA and its implications for double-strand break repair. Nature 412:607-614.[CrossRef][Medline]
44. Yang, R., R. Morosetti, and H. P. Koeffler. 1997. Characterization of a second human cyclin A that is highly expressed in testis and in several leukemic cell lines. Cancer Res. 57:913-920.
45. Yang, R., C. Müller, V. Huynh, Y. K. Fung, A. S. Yee, and H. P. Koeffler. 1999. Functions of cyclin A1 in the cell cycle and its interactions with transcription factor E2F-1 and the Rb family of proteins. Mol. Cell. Biol. 19:2400-2407.
46. Yang, R., T. Nakamaki, M. Lubbert, J. Said, A. Sakashita, B. S. Freyaldenhoven, S. Spira, V. Huynh, C. Müller, and H. P. Koeffler. 1999. Cyclin A1 expression in leukemia and normal hematopoietic cells. Blood 93:2067-2074.
47. Yang, T., H. Namba, T. Hara, N. Takmura, Y. Nagayama, S. Fukata, N. Ishikawa, K. Kuma, K. Ito, and S. Yamashita. 1997. p53 induced by ionizing radiation mediates DNA end-jointing activity, but not apoptosis of thyroid cells. Oncogene 14:1511-1519.[CrossRef][Medline]
48. Zhou, X. Y., X. Wang, H. Wang, D. J. Chen, G. C. Li, G. Iliakis, and Y. Wang. 2002. Ku affects the ATM-dependent S phase checkpoint following ionizing radiation. Oncogene 21:6377-6381.[CrossRef][Medline]
This article has been cited by other articles:
| ||||||||||||||||||||
40 ng) was serially diluted. The addition of small amounts of cyclin A1 increased rejoining activity, whereas high levels of cyclin A1 reduced rejoining. (B) Similar experiments were performed with nuclear extracts from HeLa cells, which endogenously express very low levels of cyclin A1. (C) Analysis of cyclin A1-activated DNA repair by end joining in vivo: Transfection of linearized luciferase reporter plasmid into NIH 3T3 cells with increasing amounts of cyclin A1 expression plasmid led to a dose-dependent effect on DNA repair and subsequent luciferase activity of the rejoined plasmid. A Renilla luciferase plasmid was cotransfected to standardize for transfection efficiency. The data represent mean and standard error of the mean of three independent experiments. (D) Microhomology-mediated NHEJ is activated by cyclin A1. The EJ-EGFP plasmid was transfected along with 10 µg of SceI and either 10 µg of a control or cyclin A1 or cyclin A2 expression plasmid into KMV5 cells (