The Ribosome-Bound Chaperones RAC and Ssb1/2p Are Required for Accurate Translation in Saccharomyces cerevisiae

The chaperone homologs RAC (ribosome-associated complex) andSsb1/2p are anchored to ribosomes; Ssb1/2p directly interactswith nascent polypeptides. The absence of RAC or Ssb1/2p resultsin a similar set of phenotypes, including hypersensitivity againstthe aminoglycoside paromomycin, which binds to the small ribosomalsubunit and compromises the fidelity of translation. In orderto understand this phenomenon we measured the frequency of translationtermination and misincorporation in vivo and in vitro with anovel reporter system. Translational fidelity was impaired inthe absence of functional RAC or Ssb1/2p, and the effect wasfurther enhanced by paromomycin. The mutant strains sufferedprimarily from a defect in translation termination, while misincorporationwas compromised to a lesser extent. Consistently, a low levelof soluble translation termination factor Sup35p enhanced growthdefects in the mutant strains. Based on the combined data weconclude that RAC and Ssb1/2p are crucial in maintaining translationalfidelity beyond their postulated role as chaperones for nascentpolypeptides.

INTRODUCTION

Top

Introduction

RAC (ribosome-associated complex) is a stable heterodimer thatis almost entirely associated with ribosomes of yeast. RAC consistsof the Hsp70 homolog Ssz1p and the Hsp40 homolog zuotin (22).A significant fraction of the Hsp70 homolog Ssb1/2p is alsobound to the yeast ribosome (41). RAC associates with the ribosomein a salt-sensitive manner (22). Ssb1/2p binding to nontranslatingribosomes is salt sensitive; however, when the ribosome is involvedin translation, binding of Ssb1/2p becomes salt resistant (41,47). RAC and Ssb1/2p functionally interact in vivo and in vitro(23, 30). Based on the idea that they act on nascent polypeptides,these chaperones are thought to localize close to the tunnelexit of the large ribosomal subunit. Although structural dataare not available for that point, this view is supported bythe finding that Ssb1/2p can form cross-link products with nascentpolypeptides as short as 45 amino acids (21). RAC has not beenfound in contact with nascent polypeptides, but it influencestheir interaction with Ssb1/2p (23). Mainly based on localizationand homology it has been suggested that RAC and Ssb1/2p areinvolved in folding or maintaining nascent polypeptides in afolding-competent state, facilitating their transit throughthe ribosomal tunnel and preventing backward movement or clearingaggregated proteins from the ribosome—experimental evidence,however, is scarce (11, 28, 54). Recently it was shown thatSsb1/2p participates in posttranslational completion of proteinfolding and has partly overlapping function with the chaperonintailless complex polypeptide 1 (TCP1) ring complex (TRiC) cochaperoneGimC (58). However, zuotin was not required for this function,and most likely it is the soluble pool of Ssb1/2p that cooperateswith the TRiC/GimC system (58).

In vivo ${Delta}$ ssb1 ${Delta}$ ssb2, ${Delta}$ ssz1, and ${Delta}$ zuo1 strains display a complexset of phenotypes, including hypersensitivity against aminoglycosides,e.g., paromomycin (22, 41, 70). Although the drug is only weaklyactive against eukaryotic ribosomes (49), paromomycin causesphenotypic suppression of nonsense and missense mutations inyeast, indicating that the frequency of translational errorsis increased (46). A number of yeast mutants in proteins orrRNA close to the decoding center display enhanced sensitivityto paromomycin (1, 9, 14, 38, 62). Strains expressing mutantversions of the translation termination factors Sup35p and Sup45pdisplay paromomycin sensitivity (2, 66). The aforementionedexamples are readily explained by a direct involvement of thecomponents in the maintenance of translational fidelity; however,mutants exist in which the causes of paromomycin sensitivityare less obvious. For instance, some glycosylation mutants ormutants of the plasma membrane ATPase display sensitivity againstaminoglycosides (12, 33, 34).

In an attempt to better define the roles of Ssb1/2p and RACin vivo, we have examined how the deleterious effects of paromomycinare linked to translational fidelity in strains lacking functionalRAC or Ssb1/2p. To this end we have tested translation terminationand misincorporation of amino acids in vivo and in vitro. Theresults indicate that lack of these ribosome-associated chaperonesprimarily induces readthrough on the ribosome. The data arein agreement with a model in which a combination of paromomycinand the absence of functional RAC or Ssb1/2p cause lethalitybecause of severe defects in translation termination.

MATERIALS AND METHODS

Top

Materials and Methods

Yeast strains, media, and culture conditions. Standard yeast genetic techniques were applied (57). MH272-3fa/ ${alpha}$ (ura3/ura3 leu2/leu2 his3/his3 trp1/trp1 ade2/ade2 HMLa/HMLa)is the parental wild-type strain (22, 29) for the constructionof ${Delta}$ ssb1 ${Delta}$ ssb2 (Ida56A), ${Delta}$ zuo1 ${Delta}$ ssz1 (Ida12), ${Delta}$ zuo1 (Ida1), and ${Delta}$ ssz1(Ida2) deletion strains, which has been reported elsewhere (22,23). In Ida56A, SSB1 is replaced by the kanMX module (65), whichcauses partial resistance against paromomycin. For this reasona second ${Delta}$ ssb1 ${Delta}$ ssb2 deletion strain (Ida56C) was generated byreplacing the ClaI/AgeI 1,461-bp fragment in SSB1 with the ADE2marker. Ida56C and derivatives were used in experiments involvingparomomycin. During the course of this study the MH272-3f-derivedstrains turned out to contain the [PSI⁺] element. For this reason, ${Delta}$ zuo1 (GT- ${Delta}$ zuo1), ${Delta}$ ssz1 (GT- ${Delta}$ ssz1), and ${Delta}$ zuo1 ${Delta}$ ssz1 (GT- ${Delta}$ zuo1 ${Delta}$ ssz1)were generated in the [psi^–] strain GT197, which is derivedfrom strain GT81 (MATa ade1-14 ura3 leu2 his3 trp1 lys2) (67;M. Boguta, personal communication).

Strains were grown in a solution of 1% yeast extract, 2% peptone,2% dextrose (YPD) or in minimal medium (0.67% yeast nitrogenbase without amino acids, 2% dextrose, supplemented with allamino acids and bases except those needed for selection). Drugeffects either were determined by spotting serial 10-fold dilutionsof early-log-phase cultures containing the same number of cellson YPD plates with supplements as indicated or were determinedin liquid cultures as described previously (13). In order tocure cells from the plasmid overexpressing HSP104, strains expressingthe chaperone on a plasmid with a URA3 marker were grown on5-fluoro-orotic acid-containing media (5). Loss of the plasmidwas confirmed by testing the ability of the strains to growon media lacking uracil. Curing of HSP104 was carried out justbefore experiments, as MH272-3f and derivatives showed a tendencyto revert to [PSI⁺]. For the same reason, 2 mM GndHCl was includedin the medium when the [psi^–] status of MH272-3f-derivedstrains was required. Paromomycin gradient plates were preparedby pouring 20 ml of YPD medium containing the maximum concentrationof the drug into plates resting at an incline. After drug-containingmedium was solidified, plates were laid flat and 20 ml of YPDmedium was poured in (35).

Plasmids. Vectors used for the expression of ssz1-S295F, zuo1-H128Q, andHSP104 were from the pY series (24) or pRS series (10). ssz1-S295Fwas generated by exchanging codon TCT (bp 883 to 885) for TTCin SSZ1, resulting in the replacement of Ser-295 with phenylalanine(27). ssz1-S295F plus 300 bp upstream and downstream of thecoding region was cloned into pYEPlac112(2µm TRP1) andwas expressed in the Ida2 background lacking the wild-type SSZ1gene. zuo1-H128Q was expressed from either pRS423(2µmHIS3) or pYCPlac33(CEN, URA3) in the Ida1 background lackingwild-type ZUO1 (23). HSP104 plus 500 bp upstream and 300 bpdownstream of the open reading frame was cloned into pRS423(2µmHIS3) and pYEPlac112(2µm TRP1), resulting in p423-HSP104and p112-HSP104. In order to generate strains overexpressingHSP104, p423-HSP104, p112-HSP104, or plasmid, pA1/4(2µmURA3) (7) was transformed into the respective strains accordingto the requirements for positive selection.

Reporter constructs contained a hybrid lacZ-luc gene under controlof the simian virus 40 (SV40) early promoter, which is activein yeast and higher eukaryotes. Construction of the readthroughreporters was based on previously published information (4).All hybrid reporter constructs were expressed from the multicopyplasmid pYEPlac195(2µm URA3). Primers SV40-F1 (GGATCCGCGCAGCACCATGGCCTGAAATAACCTC)and ß-Gal-R1 (GTCGACTTAGCTAGCTTTTTGACACCAGACCAACTGGTAATGGTAGCG)were used to amplify the SV40 promoter region plus ß-galactosidasewith pSV-ß-galactosidase (Promega) as a template.The PCR product was cloned into the BamHI/SalI site of pYEPlac195.In the next step primers Luc+-F1 (GCTAGCAGATCTGAAGACGCCAAAAACATAAAGAAAGGCC)and Luc+-R1 (CTGCAGTCAGCTAATTATTACACGGCGATCTTTCCGCCCTTCTTGGCC)were used to amplify luciferase with pSP-luc+ (Promega) as atemplate. The PCR product was cut with NheI/PstI and was clonedinto pYEPlac195 containing ß-galactosidase. This proceduregenerated an in-frame fusion between ß-galactosidaseand luciferase. The two genes were separated by a short in-framelinker that can be cut with NheI and BglII and was used to insertshort oligonucleotides generating lacZ-luc and lacZ-STOP-luc(see Fig. 2A). The basis of the in vivo misincorporation reporterswas lacZ-luc. lacZ-luc* was generated by exchanging codon AGAfor AGC, resulting in the replacement of R-218 with serine (Fig.2A). lacZ-luc** was generated by exchanging codon AGA for TCT,also resulting in the replacement of R-218 with serine (Fig.2A).

View larger version (32K):
[in this window]
[in a new window]
FIG. 2. Determination of readthrough efficiency in strains lacking Ssb1/2p or the subunits of the RAC complex in vivo. (A) An in-frame fusion between ß-galactosidase and luciferase (lacZ-luc) served to determine the relative enzymatic activities upon equimolar expression of the two enzymes. Readthrough efficiency was determined using the lacZ-STOP-luc construct (for details see Results). (B) lacZ-STOP-luc was transformed into wild type or wild type plus HSP104, and readthrough was determined after growth on YPD plus or minus 2 mM GndHCl as indicated. Readthrough frequency is expressed as the ratio of luciferase/ß-galactosidase activity (RLU/A₄₂₀) obtained with the lacZ-STOP-luc construct normalized to the ratio obtained with lacZ-luc. Parts of the results shown in panel B are included in Fig. 4 to facilitate comparison between wild-type and mutant strains. (C) Readthrough efficiency was determined in wild-type, ${Delta}$ ssb1 ${Delta}$ ssb2, and ${Delta}$ ssz1 ${Delta}$ zuo1 strains and in the same set of strains overexpressing HSP104 described above. Strains were grown on YPD or YPD supplemented with 2 mM GndHCl as indicated. Numbers below the columns indicate the relative increase of readthrough frequency compared to that of the wild type. All experiments were performed at least in triplicate; when error bars are missing, numbers were identical. (D) ${Delta}$ zuo, ${Delta}$ ssz1, and ${Delta}$ zuo1 ${Delta}$ ssz1 were generated in the [psi^–] strain GT197. The respective proteins were probed in total extracts derived from GT197 and in the corresponding mutant strains by immunoblotting as described in the legend to Fig. 1. The ribosomal marker Rpl16a was used as a loading control. (E) lacZ-STOP-luc was transformed into GT197, GT197- ${Delta}$ zuo1, GT197- ${Delta}$ ssz1, and GT197- ${Delta}$ zuo1 ${Delta}$ ssz1. Readthrough was determined after growth on YPD as described in the legend to panel B.

Plasmid pSP-luc+ (Promega) served as a template for the in vitroreporter constructs. pSP-luc+* was generated as described above.In pSP-luc+STOP, leucine 210 was replaced with a stop codon(see Fig. 5A). luc, luc*, and luc-STOP were transferred intopSPUTK (Stratagene). Resulting plasmids pSPUTK-luc+, pSPUTK-luc+*,and pSPUTK-luc+STOP were used to generate mRNA for in vitrotranslation as described previously (16).

View larger version (33K):
[in this window]
[in a new window]
FIG. 5. Determination of misincorporation efficiency in strains lacking Ssb1/2p or functional RAC in vivo. (A) lacZ-luc* (near cognate) and lacZ-luc** (noncognate) both encode inactive luciferase-R218S. Active luciferase can be regained from lacZ-luc* or lacZ-luc** if serine 218 is mistranslated into arginine (for details see Results). (B) Misincorporation efficiency was determined for the wild type transformed with either lacZ-luc* or lacZ-luc** after growth on YPD or YPD plus 2 mM GndHCl. Misincorporation is expressed as the ratio of luciferase/ß-galactosidase activity obtained after expression of the lacZ-luc* or lacZ-luc** constructs normalized to the in-frame control. (C) Misincorporation efficiency was determined in wild-type, ${Delta}$ ssb1 ${Delta}$ ssb2, ${Delta}$ ssz1 ${Delta}$ zuo1, zuo1-H128Q, and ssz1-S295F strains as described above using the lacZ-luc* construct. (D) Misincorporation was determined in wild-type, zuo1-H128Q, and ssz1-S295F strains grown on YPD containing 2 mM GndHCl plus increasing concentrations of paromomycin as indicated. Note that the paromomycin concentration used in this experiment was adjusted according to the inhibitory concentration for each strain (see Fig. 3B).

Ribosome binding assay. Association of RAC and Ssb1/2p with ribosomes under low-salt(120 mM potassium acetate) or high-salt (800 mM potassium acetate)conditions was determined as described previously (22). Theeffect of paromomycin was determined by the same approach. Inbrief, yeast cytosol (40 µl) was layered on top of a 100-µllow-salt sucrose cushion (20 mM HEPES-KOH, 25% sucrose, 120mM potassium acetate, 2 mM dithiothreitol [DTT], 5 mM magnesiumacetate, 1 mM phenylmethylsulfonyl fluoride [PMSF], pH 7.4)or a paromomycin sucrose cushion (20 mM HEPES-KOH [pH 7.4],25% sucrose, 120 mM potassium acetate, 2 mM DTT, 5 mM magnesiumacetate, 100 µg of paromomycin/ml, 1 mM PMSF, pH 7.4).After centrifugation at 200,000 x g in an RC M120 GX ultracentrifuge(Sorvall) for 120 min at 4°C, samples were split into supernatantand pellet and corresponding amounts were analyzed by sodiumdodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)followed by immunoblotting. A total corresponding to the amountloaded onto the sucrose cushion was analyzed in parallel.

Preparation of cell extracts for the determination of ß-galactosidase and luciferase activity. Twenty-milliliter cultures were grown to an optical densityat 600 nm (OD₆₀₀) of 0.8 to 1.2 on YPD containing 2 mM guanidinehydrochloride (GndHCl). Higher concentrations of GndHCl affectedgrowth of strains lacking functional RAC or Ssb1/2p (32). Cellscorresponding to an OD₆₀₀ of 1 were collected by centrifugationat 10,000 x g, washed once with 1 ml of distilled water, andresuspended in 250 µl of cold TEP-I buffer (50 mM Tris-HCl[pH 8.0], 5 mM EDTA, 1 mM PMSF, 1% dimethyl sulfoxide [DMSO])containing protease inhibitor mix (1.25 µg of leupeptin/ml,0.75 µg of antipain/ml, 0.25 µg of chymostatin/ml,0.25 µg of elastatinal/ml, 5 µg of pepstatin A/ml).Acid-washed glass beads (0.2 g/sample) were added, and cellswere disrupted by three cycles of vortexing (1 min) and cooling(1 min) at 4°C. Samples were centrifuged for 1 min at 3,000x g in order to pellet glass beads and cell debris. Supernatantswere transferred to fresh tubes and were spun at 4°C for10 min at 10,000 x g.

Determination of ß-galactosidase activity. Activity of ß-galactosidase was assayed by using o-nitrophenyl-ß-D-galactopyranoside(ONPG) as a substrate as described previously (60). In orderto ensure that the reaction was in the linear range, each cellextract was diluted 25- and 50-fold into a 1-ml final volumeof buffer Z (50 mM NaH₂PO₄, 45 mM Na₂HPO₄, 10 mM KCl, 10 mMMgSO₄, pH 7). ONPG solution (200 µl; 4 mg/ml in bufferZ) was added, and samples were incubated at 28°C for 30min with gentle shaking. The reaction was stopped by the additionof 500 µl of 1 M Na₂CO₃, and the absorbance at 420 nmwas measured relative to a blank.

Determination of luciferase activity. Each cell extract was diluted 25- and 50-fold into a 1-ml finalvolume of luciferase assay buffer (100 mM KH₂PO₄, 1 mM EDTA,1 mM DTT, pH adjusted to 7.8 with KOH). The diluted cell extracts(100 µl) were mixed with 100 µl of luciferase reagent(20 mM Tricine, 5 mM MgCl₂, 0.1 mM EDTA, 3.3 mM DTT, 270 µMcoenzyme A, 500 µM D-luciferin, 500 µM ATP) usinga Lumat LB 9507 device (Berthold Technologies GmbH, Wildbad,Germany). Luciferase activity is given in relative light units(RLU).

Estimation of readthrough and misincorporation efficiencies in vivo and in vitro. ß-Galactosidase activity served as an internal standardfor possible variation in translation efficiency, mRNA stability,and folding in vivo. Readthrough and misincorporation was determinedbased on the relative ratio of luciferase (in RLU) to ß-galactosidase(A₄₂₀) activity. The RLU/A₄₂₀ obtained was set to 100% whenthe enzymes were expressed at equimolar quantities from thein-frame lacZ-luc construct. Normalization with lacZ-luc wasperformed for each strain and growth condition. Efficiency ofreadthrough and misincorporation was then expressed as the percentageof RLU/A₄₂₀ obtained when the enzymes were expressed eitherfrom the lacZ-STOP-luc, lacZ-luc*, or lacZ-luc** construct (seeFig. 2A and B).

For the determination of in vitro readthrough and misincorporation,translation extracts were primed with mRNA luc, luc*, or luc-STOP(see Fig. 5). After translation, luciferase activity (RLU) wasdetermined as described above. The amount of luciferase synthesizedwas determined by densitometry of fluorograms and is expressedin relative units (quantum level [QL]) (see Fig. 5B). RLU/QLobtained was set to 100% when luc mRNA was used to prime thetranslation reaction mixture. Efficiency of readthrough andmisincorporation is expressed as the percentage of RLU/QL obtainedafter translation of luc* or luc-STOP mRNA. Because the 23-kDaluciferase fragment generated in the presence of luc-STOP mRNAcontains only 9 methionines (compared to 14 methionine residuesin full-length luciferase), relative units in this case weremultiplied by 1.55.

Preparation and optimization of yeast translation extracts. Yeast translation extracts were prepared as described previously(20). Translation reactions were performed in the presence of³⁵S-labeled methionine as described previously (16). The amountof translation extract for each strain was optimized, and theMg²⁺ concentration in each reaction mixture was adjusted preciselyto 1 mM. The Mg²⁺ concentration is a critical parameter forthe accuracy of decoding (52). Translation efficiency in thedifferent lysates was similar and did not vary by more than30%. Translation reaction mixtures (20 µl) were incubatedfor 55 min at 20°C. Tubes were then placed on ice, and 20µl of STOP buffer (20 mM HEPES-KOH, 2 mM DTT, 5 mM magnesiumacetate, 2 mM EDTA, 50 mM potassium acetate, 5 mM PMSF, proteaseinhibitor mix, pH 7.4) was added. One aliquot was used for determinationof luciferase activity, and another aliquot was boiled in SDS-samplebuffer containing 1 µg of ovalbumin/ml. Samples were runon 10% Tris-Tricine gels and were subsequently quantified withan Aida ImageAnalyzer (Raytest; Isotopenmessgeräte GmbH).

Miscellaneous. Ssb1/2p represents Ssb1p and Ssb2p, two 99% identical proteinswith identical function and similar expression levels. The term"mutant strains " is used collectively for ${Delta}$ zuo1 ${Delta}$ ssz1, ${Delta}$ ssb1 ${Delta}$ ssb2,zuo1-H128Q, and ssz1-S295F strains. Proteins were separatedon Tris-Tricine gels (56). ¹²⁵J-protein A was used to developthe immunoblots (26).

RESULTS

Top

Results

Paromomycin does not affect ribosome association of RAC or Ssb1/2p. Aminoglycoside binding to the small ribosomal subunit inducesstructural changes that might affect the entire ribosome (17,31). Hence, we asked whether paromomycin sensitivity of ${Delta}$ ssb1 ${Delta}$ ssb2 or ${Delta}$ zuo1 ${Delta}$ ssz1 strains resulted from a reduction in ribosomalassociation of RAC or Ssb1/2p, respectively. The distributionof Ssb1/2p in the ${Delta}$ ssz1 ${Delta}$ zuo1 strain and of RAC in the ${Delta}$ ssb1 ${Delta}$ ssb2strain was comparable to the distribution in wild-type cytosolunder low-salt and high-salt conditions (Fig. 1A). Ribosomeassociation was then tested in the presence of 100 µgof paromomycin/ml, a concentration that completely inhibitsgrowth of ${Delta}$ ssb1 ${Delta}$ ssb2 and ${Delta}$ zuo1 ${Delta}$ ssz1 strains (23). The distributionof RAC and Ssb1/2p in the deletion strains was unaffected, indicatingthat paromomycin did not directly interfere with ribosome association(Fig. 1B).

View larger version (57K):
[in this window]
[in a new window]
FIG. 1. Paromomycin does not affect binding of RAC and Ssb1/2p to ribosomes. Total yeast cytosol (T) derived from wild-type, ${Delta}$ ssb1 ${Delta}$ ssb2, or ${Delta}$ ssz1 ${Delta}$ zuo1 strains was separated into ribosomal pellet (P) and postribosomal supernatant (S) (A) in the presence of low salt (120 mM potassium acetate) or high salt (800 mM potassium acetate) or (B) in the presence (paro) or absence (–) of 100 µg of paromomycin/ml in a buffer containing 120 mM potassium acetate (see Materials and Methods). Aliquots were separated on 10% Tris-Tricine gels, transferred to nitrocellulose, and decorated with antibodies directed against Ssb1/2p, Ssz1p, zuotin, and Rpl16a (ribosomal marker).

Quantification of translational readthrough reveals that the wild-type strain MH272-3f ${alpha}$ contains the [PSI⁺] element. Readthrough was determined for the TAG stop codon flanked byCAA, promoting a high basal readthrough level (Fig. 2A, lacZ-STOP-luc)(4, 40). In the wild-type strain MH272-3f ${alpha}$ , readthrough efficiencywas about 50%, which was significantly higher than that previouslyreported for a different genetic background (Fig. 2B) (4). Manylaboratory strains contain the [PSI⁺] element, a property thatis not readily detectable because no general growth defectsare connected to [PSI⁺] (63). However, [PSI⁺] strains displaya high readthrough frequency, because a large fraction of thetranslation termination factor Sup35p is trapped in prion aggregates.These aggregates can be dissolved by different means, such asgrowth on GndHCl, overexpression of HSP104, or deletion of HSP104(for reviews on [PSI⁺] see references 37, 45, 64, and 68). Weexposed MH272-3f to two conditions that eliminate the prion:growth on GndHCl and overexpression of HSP104. Indeed, bothconditions reduced readthrough to about 13%, which is similarto previous results (Fig. 2B) (4). We conclude that readthroughin wild-type MH272-3f can be significantly reduced by conditionsthat cure [PSI⁺].

Readthrough is increased in the absence of RAC or Ssb1/2p in vivo. Readthrough in ${Delta}$ ssb1 ${Delta}$ ssb2 and ${Delta}$ zuo1 ${Delta}$ ssz1 strains approached thelimit of the lacZ-STOP-luc reporter assay (Fig. 2C, first panel).To lower readthrough and avoid interference with [PSI⁺], ${Delta}$ ssb1 ${Delta}$ ssb2 and ${Delta}$ zuo1 ${Delta}$ ssz1 strains were transformed with a plasmid overexpressingHSP104 or were grown on GndHCl. For this, two earlier observationshad to be considered. First, ${Delta}$ ssb1 ${Delta}$ ssb2 (32) and ${Delta}$ zuo1 ${Delta}$ ssz1 strains(data not shown) are more sensitive to GndHCl than is wild-typeyeast. Second, HSP104 overexpression fails to cure [PSI⁺] ina ${Delta}$ ssb1 ${Delta}$ ssb2 background (8, 45). We found that 2 mM GndHCl wassufficient to significantly reduce the readthrough level (Fig.2C, second panel) while only slightly affecting growth of ${Delta}$ ssb1 ${Delta}$ ssb2 and ${Delta}$ zuo1 ${Delta}$ ssz1 strains (Fig. 3B and data not shown). Aspredicted, overexpression of HSP104 reduced readthrough in ${Delta}$ zuo1 ${Delta}$ ssz1 but not in ${Delta}$ ssb1 ${Delta}$ ssb2 strains (Fig. 2C, third panel). Thecombined data indicate that, like the parental strain, ${Delta}$ ssb1 ${Delta}$ ssb2 and ${Delta}$ zuo1 ${Delta}$ ssz1 strains contain the [PSI⁺] element. Bothstrains displayed increased readthrough frequency, which wasfurther enhanced when [PSI⁺] was present (Fig. 2C). In orderto determine the effect of the chaperones on translational readthroughwithout possible interference with [PSI⁺], we constructed GT197- ${Delta}$ zuo1,GT197- ${Delta}$ ssz1, and GT197- ${Delta}$ zuo1 ${Delta}$ ssz1 strains (Fig. 2D). These strainswere derived from the [psi^–] strain GT197 (see Materialsand Methods). As expected, GT197 displayed a low level of readthrough,similar to that of MH272-3f cured from [PSI⁺] (Fig. 2B and E).Growth on GndHCl did not significantly change the efficiencyof readthrough in GT197 (data not shown). Readthrough frequencyin the mutant strains GT197- ${Delta}$ zuo1, GT197- ${Delta}$ ssz1, and GT197- ${Delta}$ zuo1 ${Delta}$ ssz1 was approximately twofold increased, confirming that RACinfluenced translational readthrough in a [PSI⁺]-independentmanner.

View larger version (22K):
[in this window]
[in a new window]
FIG. 3. zuo1-H128Q and ssz1-S295F strains tolerate higher paromomycin concentrations than ${Delta}$ ssb1 ${Delta}$ ssb2 or ${Delta}$ ssz1 ${Delta}$ zuo1 strains. (A) Serial dilutions of logarithmically growing cultures were spotted on YPD containing the specified supplements and were incubated as indicated. (B) Strains were inoculated at the same OD₆₀₀ into YPD plus 2 mM GndHCl (control) or into the same medium containing paromomycin as indicated. Cultures were grown until the control without paromomycin had reached an OD₆₀₀ of 1.2, which was set to 100%.

Readthrough is increased in paromomycin-sensitive strains expressing point mutants of either Ssz1p or zuotin in vivo. As a possible explanation for defects in translational fidelity,we considered that the complete absence of RAC or Ssb1/2p mighthave severe consequences on ribosome structure. To address thispossibility we made use of point mutants in either RAC subunitwhich affect paromomycin sensitivity; however, neither affectstability or ribosome association (23; data not shown). We firstused zuo1-H128Q, which contains a point mutation in the J domainof zuotin causing growth defects similar to those observed inthe deletion strains (23, 30). We next used ssz1-S295F, whichcontains a single mutation in the ATPase domain of Ssz1p (27).ssz1-S295F was originally identified as a dominant gain-of-functionallele increasing pleiotropic drug resistance against, e.g.,cycloheximide (27 and Fig. 3A). The ssz1-S295F strain displayedwild-type growth under most conditions; however, the strainwas sensitive to elevated concentrations of paromomycin (Fig.3A). A direct comparison revealed that paromomycin sensitivityincreased in the following order: ${Delta}$ zuo1 ${Delta}$ ssz1 = ${Delta}$ ssb1 ${Delta}$ ssb2 >zuo1-H128Q > ssz1-S295F > wild type (Fig. 3B). Both zuo1-H128Qand ssz1-S295F strains displayed an increased level of readthroughthat was further increased in the presence of [PSI⁺] (Fig. 4A).In accord with paromomycin sensitivity, readthrough was moreseverely affected in zuo1-H128Q (Fig. 4A). The results ruledout purely structural effects caused by the lack of RAC or Ssb1/2pand suggested a requirement for functional RAC to maintain translationalfidelity in vivo.

View larger version (32K):
[in this window]
[in a new window]
FIG. 4. Paromomycin strongly affects translational readthrough in zuo1-H128Q and ssz1-S295F strains. (A) Readthrough was determined in wild-type, ssz1-S295F, and zuo1-H128Q strains or the respective strains overexpressing HSP104 grown on YPD or YPD containing 2 mM GndHCl. Numbers below the columns indicate increase of readthrough compared to that of the wild type grown under the same conditions. (B) Readthrough was determined in wild-type, zuo1-H128Q, and ssz1-S295F strains grown on YPD containing 2 mM GndHCl plus increasing concentrations of paromomycin as indicated. Note that the paromomycin concentration used in this experiment was adjusted according to the inhibitory concentration for each strain (see Fig. 3B). Readthrough was quantified as described in the legend to Fig. 2.

Correlation between paromomycin-induced growth inhibition and translational readthrough in zuo1-H128Q and ssz1-S295F strains in vivo. As ${Delta}$ ssb1 ${Delta}$ ssb2 and ${Delta}$ zuo1 ${Delta}$ ssz1 strains grew only very poorly inthe presence of paromomycin, we examined readthrough in thezuo1-H128Q and ssz1-S295F point mutants in the presence of thedrug. In the wild-type strain readthrough frequency remainedlow even at growth-inhibiting concentrations (>500 µg/ml)(Fig. 4B). To the contrary, paromomycin strongly enhanced readthroughin zuo1-H128Q and ssz1-S295F strains (Fig. 4B). Consistent withparomomycin effects on cell growth, the zuo1-H128Q strain respondedto lower concentrations than the ssz1-S295F strain. The pronounceddifference between wild-type and mutant strains suggests thatstop codon recognition became limiting in the presence of paromomycin.

Quantification of misincorporation reveals a paromomycin-induced increase in the mutant strains. In order to test whether the mutant strains were specificallyaffected in translation termination or displayed a more generaltranslational defect, we devised an in vivo misincorporationassay. Replacing arginine in position 218 of luciferase withserine inactivates the enzyme (6). To test whether luciferase-R218Swas suited as a misincorporation reporter, two different versionswere generated. AGA (encoding R218) was either replaced withAGC (encoding S; lacZ-luc*) or TCT (encoding S; lacZ-luc**)(Fig. 5A). Mistranslation of AGC (encoding S) into AGA or AGG(encoding R) requires recognition by a near-cognate tRNA. TCT(encoding S), however, will only be mistranslated into arginineby noncognate tRNAs, a much less frequent event (51). Indeed,the noncognate version produced significantly less active luciferasethan the near-cognate version, indicating that the residualactivity of luciferase-R218S was lower than activity gainedby misincorporation. lacZ-luc* and lacZ-luc** were also testedafter curing of [PSI⁺] (Fig. 5B). In accordance with a specificeffect of [PSI⁺] on translation termination, the misincorporationfrequency remained unchanged. The frequency of arginine misincorporationin position 218 of lacZ-luc* was about 1.5 x 10^–3. Missenseerror frequencies vary with codon bias, mRNA template contexts,and the identity of the specific tRNA species involved. Thefrequency determined for the lacZ-luc* reporter is consistentwith previous estimates for prokaryotes and eukaryotes (reference61 and references therein).

Under normal growth conditions, misincorporation frequenciesin the mutant strains were unaltered (Fig. 5C). Paromomycinaffected misincorporation in the zuo1-H128Q strain only slightly.In the ssz1-S295F strain, however, which tolerates higher paromomycinconcentrations in vivo, misincorporation was raised to significantlyhigher values than that in the wild-type strain (Fig. 5D). Thecombined data suggest that the lack of functional RAC primarilyaffected the fidelity of translation termination and, to a lesserextent, the elongation process. The degree of known translationalerrors depends on the specific codon and its flanking region;however, the finding suggests that increased misincorporationwas unlikely to be the major cause for paromomycin sensitivity.

Readthrough and misincorporation frequencies are increased in the absence of RAC or Ssb1/2p in vitro. In vivo experiments demonstrated a correlation between translationalfidelity and growth defects caused by lack of functional RACor Ssb1/2p. However, indirect effects, such as increased permeabilityof the cytoplasmic membrane for paromomycin, cannot readilybe excluded based on in vivo data alone. In order to addressthis possibility and to characterize the mutant strains in moredetail, we devised an in vitro system to assess translationalfidelity. To this end, luciferase reporter constructs were generated.Readthrough was monitored using a construct in which leucineat position 210 was replaced with a stop codon (luc-STOP) (Fig.6A). As a result, a truncated, enzymatically inactive versionof luciferase was generated (Fig. 6B). Misincorporation wasassessed using the active-site mutant R218S (luc*) (Fig. 6A and B).This novel assay closely mimics the in vivo translationprocess and allowed for the quantification not only of misincorporationbut also of readthrough, an advantage over the classical poly(U)-directedsystem (59).

View larger version (27K):
[in this window]
[in a new window]
FIG. 6. Determination of readthrough and misincorporation efficiency in vitro. (A) luc encodes wild-type luciferase; luc-STOP contains a nonsense mutation in position 210 which, upon translation, generates a 23-kDa fragment; and luc* contains a missense mutation in position 218, generating inactive luciferase. (B) The amount of luciferase synthesized in a wild-type lysate primed with luc, luc-STOP, or luc* was determined via quantification of autoradiography. Activity of an aliquot was determined as described in Materials and Methods. As luc-STOP was generated with higher efficiency, only one-third of the sample was loaded onto the gel and applied to the activity assay. The ratio between luciferase activity and intensity (RLU/QL) obtained for luc mRNA was set to 100%.

In a wild-type translation extract, readthrough frequency forluc-STOP was approximately 10^–4 (Fig. 7A). As expected,recognition of the stop codon introduced into the open readingframe of luciferase was much more efficient than the inherentlyleaky stop codon separating ß-galactosidase and luciferasein the lacZ-STOP-luc in vivo construct (Fig. 2). The [PSI⁺]status of the strains used for generation of yeast translationextracts did not affect readthrough efficiency, indicating thatthe level of Sup35p was not limiting for translation terminationin vitro (data not shown). When luc* mRNA was translated ina wild-type extract, active luciferase was generated with afrequency of 3.6 x 10^–4, which is comparable to the frequencydetermined for the same mistranslation event in vivo (Fig. 5Band 7B). Next, luc, luc-STOP, and luc* mRNAs were used to primeyeast translation extracts derived from wild-type, ${Delta}$ ssb1 ${Delta}$ ssb2, ${Delta}$ zuo1 ${Delta}$ ssz1, zuo1-H128Q, and ssz1-S295F strains. Overall, thein vitro experiments confirmed the results obtained in vivo.Translational fidelity in ${Delta}$ zuo1 ${Delta}$ ssz1 and ${Delta}$ ssb1 ${Delta}$ ssb2 strains wasmost severely affected, consistent with their growth defects(Fig. 3B and 7A and B). Misincorporation in the mutant strainswas more severely affected in vitro than in vivo (Fig. 5C and7B). Additional factors involved in translation elongation possiblybecame limiting in the in vitro translation reaction.

View larger version (47K):
[in this window]
[in a new window]
FIG. 7. Paromomycin affects translational fidelity in the absence of functional RAC or Ssb1/2p in vitro. (A to D) Wild-type, ${Delta}$ ssb1/2, ${Delta}$ ssz1 ${Delta}$ zuo1, zuo1-H128Q, and ssz1-S295F translation extracts were primed with mRNA carrying luc, luc-STOP, or luc*. Paromomycin was added at the indicated concentrations. The ratio of luciferase activity to luciferase intensity (RLU/QL) obtained in the presence of luc mRNA was set to 100%. Experiments depicted in panels A and B were performed in triplicate. (E) Translation reactions performed in wild-type and zuo1-H128Q strains in the presence of increasing concentrations of paromomycin were analyzed on SDS-PAGE followed by autoradiography. Lanes 1, no paromomycin; lanes 2, 1 µg of paromomycin/ml; lanes 3, 5 µg of paromomycin/ml; lanes 4, 7.5 µg of paromomycin/ml; lanes 5, 10 µg of paromomycin/ml; lanes 6, 15 µg of paromomycin/ml; lanes 7, 20 µg of paromomycin/ml. Note that full-length luciferase derived by readthrough is detectable only in zuo1-H128Q.

Effects of paromomycin in vitro correlate with results obtained in vivo. The overall translation efficiency in vitro was not affectedby paromomycin up to a concentration of $~$ 20 µg/ml. Higherconcentrations led to inhibition of translation in all extracts(Fig. 7E and data not shown). The in vitro system enabled usto test the effect of the drug at concentrations that led togrowth inhibition in vivo. In agreement with the in vivo results,paromomycin did not significantly affect readthrough in a wild-typetranslation extract while readthrough in the absence of functionalRAC or Ssb1/2p strongly increased (Fig. 7C). The most pronouncedeffect was obtained in the ${Delta}$ zuo1 ${Delta}$ ssz1 extract. The presence ofparomomycin led to a more than 10-fold increase in stop codonreadthrough (Fig. 7C). Although the basic readthrough levelin zuo1-H128Q extract was only slightly higher than that inthe wild type, paromomycin caused strong enhancement (Fig. 7A and C).Readthrough in the presence of paromomycin was so efficientin the mutant strains that full-length luciferase became detectableon autoradiograms (Fig. 7E and data not shown). Paromomycinincreased misincorporation in wild-type and mutant lysates;however, differences were less pronounced (Fig. 7D). The overallcorrelation between effects in vivo and in vitro strongly suggeststhat paromomycin-mediated growth inhibition in the mutant strainsis directly linked to the translation process.

[PSI⁺] enhances the growth defects caused by the lack of functional RAC or Ssb1/2p. The mutant strains suffered from translational defects, particularlyin translation termination. If [PSI⁺] was present, translationtermination was decreased even further (compare Fig. 2C to 4A).For this reason we analyzed the effect of [PSI⁺] on growth inmore detail. Wild-type and mutant strains overexpressing HSP104were grown on paromomycin gradient plates (Fig. 8A). As expected,growth of the ${Delta}$ ssb1 ${Delta}$ ssb2 strain was not influenced by overexpressionof HSP104 (compare Fig. 2C). The other strains, including thewild type, were able to tolerate significantly higher concentrationsof paromomycin when HSP104 was overexpressed (Fig. 8A). In orderto cure yeast from [PSI⁺] it is sufficient to transiently overexpressHSP104 (64). Consistently, even after loss of the HSP104-overexpressingplasmid, higher concentrations of paromomycin were tolerated.Interestingly, growth defects at 30°C and lower temperaturein the ${Delta}$ ssz1 ${Delta}$ zuo1 strain also were reduced after loss of [PSI⁺],indicating that defects in translation termination were at leastpartly also responsible for the general growth defects (Fig.8B and data not shown).

View larger version (37K):
[in this window]
[in a new window]
FIG. 8. [PSI⁺] effects growth of ${Delta}$ ssb1/2, ${Delta}$ ssz1 ${Delta}$ zuo1, zuo1-H128Q, and ssz1-S295F strains. (A) Logarithmically growing cultures of wild type, ${Delta}$ ssb1/2, ${Delta}$ ssz1 ${Delta}$ zuo1, zuo1-H128Q, ssz1-S295F, and the respective isogenic strains overexpressing HSP104 were spotted onto paromomycin gradient plates and were incubated at 30°C for 2 days. (B) Serial dilutions of ${Delta}$ ssz1 ${Delta}$ zuo1, ${Delta}$ ssz1 ${Delta}$ zuo1 plus HSP104, and ${Delta}$ ssz1 ${Delta}$ zuo1* strains were spotted onto YPD and were incubated as indicated. ${Delta}$ ssz1 ${Delta}$ zuo1* was cured from the plasmid overexpressing HSP104 before the experiment.

DISCUSSION

Top

Discussion

A role of RAC and Ssb1/2p in translational fidelity. We found that the lack of functional RAC or Ssb1/2p caused severeproblems in translational fidelity, which were strongly enhancedby paromomycin and correlated with growth inhibition. To thebest of our knowledge RAC and Ssb1/2p are the first chaperonesimplicated in translational fidelity. As they localize far fromthe decoding center, this effect is at first quite unexpected.RAC and Ssb1/2p may affect translational fidelity via facilitatingthe folding of one or more proteins involved in translationalfidelity. However, increased protein aggregation in the absenceof RAC or Ssb1/2p has not been detected so far (data not shown).Given the recently emerging picture of the ribosome as a highlydynamic and flexible machine, the effect of RAC and Ssb1/2pmay also be more direct (19).

Paromomycin binds to the rRNA of the small subunit of the eubacterialribosome and induces conformational changes (15, 31). Kineticanalysis revealed that these changes stabilize the aminoacyl-tRNA(aa-tRNA) in the A site irrespective of whether the codon-anticodonpair is cognate or near cognate (52). It is now understood thataminoglycosides not only increase the binding affinity of near-cognateaa-tRNA but also promote domain closure of the 30S ribosomalsubunit—a process otherwise only observed upon bindingof cognate aa-tRNA (44). Conformational changes not only providean explanation for the effect of paromomycin but also explainbiochemical and genetic data on translational accuracy (43,50). Upon a conformational switch in the 16S rRNA, major rearrangementsin the entire 70S ribosomal structure have been observed (17).In accord, not only mutants in rRNA of the small subunit butalso in the 23S rRNA have been found to affect translationalfidelity (42). By using hybrid archaebacterial ribosomes, itwas shown that their response to paromomycin depended criticallyon the large ribosomal subunit (55). A connection to translationalfidelity was also suggested for Rpl39p, a protein of the largeribosomal subunit conserved in eukaryotes and archaebacteria.The archaebacterial homolog localizes at the polypeptide tunnelexit and extends into the tunnel (3). Deletion of RPL39 in yeastcauses cold sensitivity, slow growth, and paromomycin hypersensitivity,phenotypes very similar to the ones observed in the absenceof functional RAC or Ssb1/2p. Using the poly(U)-directed invitro system it was shown that lack of Rpl39p increases misincorporationin vitro (13). Whether ${Delta}$ rpl39 affects translation terminationis presently unknown. Recent experiments suggest that Rpl39is also involved in the identification of newly synthesizedtransmembrane segments of proteins targeted to the endoplasmicreticulum membrane and participates in the opening of the sealbetween ribosome and translocon (53, 69).

Of specific interest is the observation that overexpressionof SSB1 results in more efficient stop codon recognition invivo (I. Hatin and J.-P. Rousset, personal communication). Thisfinding is in excellent agreement with the data presented inthis study and supports a model in which Ssb1/2p directly affectsthe fidelity of translation. Possibly, RAC, Ssb1/2p, and Rpl39pcould function in coordinating the movement of the nascent polypeptidewith the movement of the mRNA. Irregularities in this coordinationobviously may affect the kinetics of polypeptide bond formationand, as a consequence, translational fidelity (25). In fact,evidence has been presented that communication between the tworibosomal subunits regulates gating of the polypeptide tunnelentrance and is required to coordinate the movement of nascentpolypeptide and mRNA (18).

Why does yeast lacking functional RAC or Ssb1/2p die in the presence of aminoglycosides? What causes death of bacteria in the presence of aminoglycosideshas been debated for decades and is still not understood. Accordingto the error catastrophe theory, accumulated errors in proteinswhich themselves function in protein synthesis (such as ribosomalproteins) cause additional errors. This positive feedback looppoints toward an inescapable decay of translational accuracy.The issue, however, is still controversial, and it is unclearwhether it can account for the bactericidal action of aminoglycosides(48). In the same context, it has been speculated that errorsleading to incorrect translation termination (that is, readthrough,frame shifting, premature termination) have a greater effecton cell growth than missense errors (36). The results presentedhere point in the same direction. Paromomycin sensitivity ofthe mutant strains correlated well with an effect on readthrough.Reduction of readthrough by eliminating the [PSI⁺] element significantlyimproved the fitness of the mutant strains (Fig. 8). Most likely,however, the consequences of [PSI⁺] (that is, low level of thetranslation termination factor Sup35p), paromomycin, or thelack of functional RAC or Ssb1/2p overlap but are not identical.[PSI⁺] or the lack of RAC/Ssb1/2p may well affect differenttermination events to different degrees. In this context itis interesting that some stop codons are insensitive to thepresence of [PSI⁺] (39). It is not hard to imagine that an increasedlevel of proteins that carry a C-terminal extension can be deleterious.This effect could be specifically relevant for proteins thatnaturally display a high level of readthrough (39). However,one should keep in mind that RAC and Ssb1/2p, as most chaperoneproteins, are likely to serve additional functions in the cellthat will contribute to the defects displayed in the absenceof these chaperones.

ACKNOWLEDGMENTS

This work was supported by the Kultusministerium des LandesSachsen-Anhalt (to S.R.), the Fonds der Chemischen Industrie(to S.R.), and by SFB 388 and 610 (to S.R.).

We thank Suzanne Ross, Andrej Mun, and Tina Wölfle forexcellent technical assistance. We thank Magda Boguta for yeaststrain GT197. We also thank Agnieszka Chacinska, Yves Dubaquié,Matthias Gautschi, Klaus Pfanner, and members of the laboratoryfor discussion and critically reading the manuscript.

FOOTNOTES

* Corresponding author. Mailing address: Institut für Biochemie und Molekularbiologie, Universität Freiburg, Hermann-Herder-Strasse 7, D-79104 Freiburg, Germany. Phone: 49-761-2035259. Fax: 49-761-2035257. E-mail: sabine.rospert{at}biochemie.uni-freiburg.de.

REFERENCES

Top