This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kwon, H.-J. Articles by Harrington, M. A. Search for Related Content PubMed PubMed Citation Articles by Kwon, H.-J. Articles by Harrington, M. A.

Tumor Necrosis Factor Alpha Induction of NF-B Requires the Novel Coactivator SIMPL

Hyung-Joo Kwon,^1, Erin Haag Breese,¹ Eva Vig-Varga,¹ Yong Luo,¹ Younghee Lee,^2, Mark G. Goebl,¹ and Maureen A. Harrington^1*

Departments of Biochemistry and Molecular Biology,¹ Microbiology and Immunology, Indiana University School of Medicine, Indiana University Cancer Center and Walther Cancer Institute, Indianapolis, Indiana²

Received 27 April 2004/ Returned for modification 7 June 2004/ Accepted 6 August 2004

	ABSTRACT

Top Abstract Introduction Materials and Methods Results Discussion References

 
A myriad of stimuli including proinflammatory cytokines, viruses, and chemical and mechanical insults activate a kinase complex composed of IB kinase ß (IKK-ß), IKK-, and IKK-/N, leading to changes in NF-B-dependent gene expression. However, it is not clear how the NF-B response is tailored to specific cellular insults. Signaling molecule that interacts with mouse pelle-like kinase (SIMPL) is a signaling component required for tumor necrosis factor alpha (TNF-)-dependent but not interleukin-1-dependent NF-B activation. Herein we demonstrate that nuclear localization of SIMPL is required for type I TNF receptor-induced NF-B activity. SIMPL interacts with nuclear p65 in a TNF--dependent manner to promote endogenous NF-B-dependent gene expression. The interaction between SIMPL and p65 enhances p65 transactivation activity. These data support a model in which TNF- activation of NF-B dependent-gene expression requires nuclear relocalization of p65 as well as nuclear relocalization of SIMPL, generating a TNF--specific induction of gene expression.

	INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

 
The innate immune response is an evolutionarily conserved process that plays a pivotal role in an organism's defense against pathogenic agents and is integral to the repair of damaged tissue. Recent data have implied that the innate immune response may direct the nature of the adaptive immune response (21). Moreover, dysregulation of the innate immune response contributes to the pathophysiological states associated with diabetes, atherosclerosis, and certain forms of cancer (for a review, see references 1 and 18). Changes in innate immune response gene expression are controlled by the transcription factor NF-B. In vivo, the cytokine tumor necrosis factor alpha (TNF-), necessary for the innate immune response, increases the expression of genes whose products facilitate recruitment, activation, and adherence of phagocytic cells. Analysis of fibroblasts derived from TNF receptor knockout animals has linked TNF- activation of NF-B-dependent gene expression to the type I TNF receptor (TNF RI) (11).

In most cells, under steady-state conditions, NF-B is in an IB-containing complex that shuttles between the cytoplasm and the nucleus (for a review, see reference 14). Current models predict that stimulation of cells activates a preformed complex containing the following: IB kinase (IKK), IKKß, and IKK/NEMO, a nonenzymatic protein that may function as a scaffold. Activated IKK and IKKß phosphorylate two key serine residues located amino terminal to the ankyrin repeat region in IB and IBß (3, 19, 20, 29, 30), targeting phospho-IB to a protein complex containing ubiquitin-conjugating enzymes (2). Phosphorylated IB is ubiquitinated on lysine residues near the phosphorylated residues, leading to removal via proteolysis of IB from the NF-B-containing complex. IB degradation allows NF-B nuclear translocation and allows NF-B-dependent changes in gene transcription (activation and repression). These data predict a model in which TNF RI-dependent NF-B activation requires IKK/ß activation. Consistent with this model, TNF--dependent NF-B activation does not occur in fibroblasts derived from animals in which the IKK and IKKß genes have been deleted (15). Analysis of animals in which either the IKK or the IKKß gene is deleted revealed that TNF--dependent NF-B activity is compromised more severely in IKKß than with IKK nulligenics (8, 14, 16-20, 24, 25). While nuclear translocation of NF-B is clearly necessary, it is unclear whether it is sufficient for TNF--dependent activation of NF-B-dependent gene expression.

In a previous report, we described the isolation of a novel protein, signaling molecule that interacts with pelle-like kinase (SIMPL), which we determined was required for TNF-- and not interleukin 1 (IL-1)-dependent activation of NF-B activity (28). SIMPL was originally identified in a yeast two-hybrid screen with IRAK-1; mass spectrometry and immunocomplexing assays confirmed the interaction between endogenous IRAK-1 and endogenous SIMPL (28). We demonstrate here that nuclear localization of SIMPL is required for TNF RI-induced NF-B activity. SIMPL interacts with p65 in a TNF--dependent manner to enhance the transactivation activity of p65, leading to increased endogenous gene expression. These data taken together with our previous work allow us to describe a model in which TNF--dependent activation of endogenous NF-B-dependent gene expression requires the two independent events: nuclear relocalization of NF-B and nuclear relocalization of SIMPL.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

 
Plasmid constructs and antibodies. The IL-8-LUC and (NF-B)₃-LUC reporter constructs as well as the wild-type SIMPL expression construct have been described previously (27, 28). The SIMPL mutant (SIMPLNLS) was generated by PCR with the following primer set: 5' primer (TCGGGCCGCGTCCGATGTCGCTG) and 3' primer (AGTATCGATACCTACGAAGCTGCATGG). The PCR-amplified cDNA sequence was subcloned into the NotI/ClaI sites of the pFLAG-CMV-2 expression vector (Eastman Kodak Company, New Haven, Conn.), which introduced an amino-terminal Flag epitope. SIMPLNLS contains residues 1 to 241 of SIMPL. The nucleotide sequence of the SIMPLNLS construct was confirmed by sequencing (Biochemistry Biotechnology Facility; Indiana University School of Medicine). Wild-type and catalytically inactive versions of IKK and IKKß were kindly provided by Michael Karin (University of California, San Diego); the p65 construct was kindly provided by Warner Greene (University of California, San Francisco); the IBSR, c-Jun, and Gal4-estrogen receptor transactivation domain constructs were kindly provided by Harikrishna Nakshatri (Indiana University School of Medicine), and the C/EBP plasmid was kindly provided by Steven McKnight (University of Texas Southwestern [UTSW]). The p65-Gal4 and Gal4-LUC constructs were kindly provided by Richard Gaynor (UTSW). The mouse c-myc monoclonal antibody, 9E10, was purchased from Roche Biochemicals (Indianapolis, Ind.). Chromatographically purified mouse immunoglobulin G was purchased from Zymed Laboratories (South San Francisco, Calif.). IKK, IKKß, and p65 antisera were purchased from Santa Cruz Biotechnology (Santa Cruz, Calif.).

Cell culture and transfections. The human embryonic kidney epithelial cells (HEK 293 cell line) were maintained and transfected using Fugene as described previously (27). To monitor transfection efficiencies, DNA precipitates also included a construct containing Renilla luciferase cDNA. Cultures were harvested 24 or 48 h following transfection, and luciferase activities were determined using the Dual-Luciferase Reporter assay system (Promega, Madison, Wis.) according to the manufacturer's specifications. Individual assays were normalized for Renilla luciferase activity, and data are presented as n-fold increases in activity relative to empty vector control. Data are from two to three independent experiments performed in duplicate or triplicate with similar qualitative results and standard errors indicated.

Indirect immunofluorescence assays. HEK 293 cells (3 x 10⁴) were cultured directly on glass coverslips in 24-well plates. Twenty-four hours later, cells were transfected with the indicated constructs. After an additional 24 h, cells were fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS) (for 10 min at room temperature), permeabilized with 0.2% Triton X-100 in PBS for 10 min, and blocked with a solution of PBS, 15% normal donkey serum (Jackson ImmunoResearch Laboratories, West Grove, Pa.), and 0.2% Tween 20. Monoclonal antibodies to Flag were applied for 1 h, followed by a 1-h incubation with Texas Red-conjugated donkey anti-mouse immunoglobulin G (Jackson ImmunoResearch Laboratories). In some experiments, DNA staining (0.5 µg of Hoechst no. 33258/ml; SIGMA) was used to identify cell nuclei. For double immunofluorescence staining of SIMPL and IRAK/mPLK, primary mouse antibody that recognizes the Flag epitope was used and detected with mouse anti-Myc antibodies linked to fluorescein isothiocyanate (Zymed, San Francisco, Calif.). Coverslips were mounted in Fluoromount-G (Southern Biotechnology Associates, Inc, Birmingham, Ala.).

Confocal microscopy. Samples were scanned with a Zeiss LSM 510 laser scanning confocal device attached to an Axiovert 100 microscope using a C-Apochromat x40/1.2 W Corr objective or a Plan-Apochromat x100/Oil DIC objective (Carl Zeiss). Hoechst 33258, fluorescein, or Texas Red was excited with laser light at wavelengths of 351, 488, or 543 nm, respectively. Fluorescence acquisitions were performed with the 351-, 488-, or 543-nm laser lines to excite UV, fluorescein isothiocyanate, or Texas Red, respectively. To avoid bleed-through effects in double-staining experiments, each dye was scanned independently using the multitracking function of the LSM 510 unit. Images were electronically merged using the LSM 510 software and stored as TIFF files. Figures were assembled from TIFF files by using Adobe Photoshop or Microsoft PowerPoint software.

Immunoprecipitations and Western blotting. Immunoprecipitations, sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and Western analysis were performed as described previously (27).

RNase protection assays. Total cellular RNA was isolated from HEK 293 cells transfected with mammalian expression vectors encoding SIMPL, c-Jun, and/or p65 using a MicroRNA isolation kit according to manufacturer's specifications (Strategene). For detection and quantitation of mRNA species, RNase protection assays were performed, using the RiboQuant Multi-Probe RNase protection system (Pharmagin, San Diego, Calif.) according to the manufacturers' specifications. [³²P]TTP-labeled RNA probes were prepared by in vitro transcription, using the Multi-probe template set hCK-5 (Pharmagin) as a template. Five to ten micrograms of total cellular RNA samples were hybridized overnight with the purified radiolabeled RNA probe, after which free probe and other single-stranded RNA were digested with an RNase A and T1 mix. The remaining RNase-protected probes were purified and resolved on 5% denaturating polyacrylamide gels, and autoradiograms were prepared. Developed autoradiograms were quantitated using a ChemiImager4000 (Alpha Innotech Corporation).

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

 
SIMPL contains a nuclear localization signal. Sequence analysis of the SIMPL protein did not initially identify any known conserved functional domains. However, further inspection revealed a subcellular targeting sequence, specifically, a lysine-rich region, a motif common to nuclear proteins, in the SIMPL carboxyl terminus (4, 5, 10). Comparison of the lysine-rich sequence in SIMPL to sequence of other known nuclear proteins suggests that SIMPL contains either a mono- or bipartite nuclear localization signal (Table 1). To determine if the lysine-rich domain in SIMPL was necessary for nuclear localization, a SIMPL mutant was engineered in which the seven most carboxy-terminal lysine residues are removed (SIMPLNLS; contains amino acids 1 to 241). In HEK 293 cells expressing Flag-tagged wild-type SIMPL, the SIMPL protein is found in the cytoplasm and the nucleus (Fig. 1A, SIMPL); in contrast, Flag-tagged SIMPLNLS is detected only in the cytoplasm (Fig. 1A, SIMPLNLS). We also examined whether the lysine-rich domain derived from SIMPL was sufficient to direct the nuclear localization of an unrelated protein. A construct encoding a chimeric protein in which the SIMPL nuclear localization signal (SIMPL-NLS) (amino acids 239 to 259) is added to the carboxyl terminus of green fluorescent protein (GFP) to generate GFP-SIMPL-NLS (Clontech) was generated. Wild-type GFP is detected predominantly as a cytoplasmic protein, whereas the GFP-SIMPL-NLS chimera accumulates in the nucleus (data not presented). These data demonstrate that the carboxy-terminal domain of SIMPL contains a nuclear localization signal capable of working in trans.

View larger version (40K): [in this window] [in a new window]   FIG.1. SIMPL contains a nuclear localization signal that is required for activation of NF-B. (A) HEK 293 cells were transfected with vector alone or a vector encoding Flag-tagged SIMPL or Flag-tagged SIMPLNLS. Twenty-four hours later, cultures were fixed, processed for indirect immunofluorescence with Flag-specific antisera (column labeled SIMPL), or stained with Hoechst no. 33258 to visualize the nuclei (column labeled Nuclei). (B and C) HEK 293 cells were transfected with an IL-8 promoter-firefly luciferase construct, a promoterless sea pansy luciferase construct, and 0.5 µg of the indicated plasmid constructs. Forty-eight hours later, cultures were harvested and either (B) subjected to dual-luciferase assays as described under Materials and Methods or (C) normalized for protein content and subjected to Western analysis using the indicated antisera.

Nuclear relocalization is required for SIMPL- and TNF RI-dependent activation of NF-B.

Since SIMPL activity is required for TNF RI-dependent activation of NF-B-dependent reporter constructs (28), it was of interest to determine if nuclear localization of SIMPL was required. TNF- treatment of cultures overexpressing wild-type SIMPL results in a greater increase in IL-8 promoter activity than is detected in cultures treated with TNF- alone or in cultures ectopically expressing SIMPL (Fig. 2A). If cultures overexpress SIMPLNLS instead of wild-type SIMPL, the TNF--induced increase in IL-8 promoter activity decreases to a level below that detected when cultures are treated with TNF- alone (Fig. 2A). The IL-8 promoter is a complex promoter composed of binding sites for several transcription factors in addition to NF-B, including activator protein 1 and CCAAT/enhancer binding protein beta (C/EBPß). Previous studies linked the SIMPL binding partner IRAK-1 activity to NF-B-dependent changes in gene expression (28). Thus, it was of interest to determine if SIMPLNLS affected TNF--dependent activation of a reporter construct composed of NF-B response elements (6). In comparison to the activity detected for the IL-8 promoter, ectopic expression of SIMPLNLS blocked a greater fraction of the TNF--induced activation of the (NF-B)₃-LUC reporter construct (compare Fig. 2A and B). These data support a role for SIMPL in the TNF RI signaling pathway coupled to the regulation of NF-B activity.

View larger version (13K): [in this window] [in a new window]   FIG. 2. Nuclear localization of SIMPL is required for TNF RI-dependent NF-B activation. (A and B) HEK 293 cells were transfected with 0.5 µg of the indicated constructs, 20 ng of the promoterless sea pansy luciferase construct, and 0.2 µg of either (A) a firefly luciferase construct under the control of the IL-8 gene promoter or (B) an artificial promoter composed of three tandem repeats of the NF-B response element from the human immunodeficiency virus long terminal repeat. Twenty-four hours later, cultures were harvested and processed for luciferase activity as described in Materials and Methods.

View larger version (66K): [in this window] [in a new window]   FIG. 3. SIMPL modulates p65 and not c-Jun- or C/EBP-dependent transcription. (A to D) HEK 293 cells were transfected with 0.5 µg of the indicated constructs, 20 ng of the promoterless sea pansy luciferase construct, and 0.2 µg of either (A and C) a firefly luciferase construct under the control of the IL-8 gene promoter or (B and D) an artificial promoter composed of three tandem repeats of the NF-B response element from the human immunodeficiency virus long terminal repeat. Twenty-four hours later, cultures were harvested and processed for luciferase activity as described in Materials and Methods. In all experiments, cell lysates normalized for protein content were subjected to Western analysis to confirm expression of the Flag-tagged SIMPL construct and the p65 construct. (E) HEK cells were transfected with 0.5 µg of the indicated constructs. Twenty-four hours later, cultures were harvested, RNA was isolated, and RNase protection assays were performed as described in Materials and Methods. (F) The autoradiogram used to generate the figure in panel E was quantitated by densitometry, and the ratio of the values obtained (IL-8/GAPDH) was replotted as a histogram.

SIMPL-p65 complexes form in response to TNF-. The ability of SIMPL to modulate p65-dependent gene expression suggested a physical interaction between p65 and SIMPL. Immunocomplexing assays were used to determine if p65-SIMPL complexes could be isolated. HEK 293 cells transfected with wild-type p65 and either wild-type SIMPL or SIMPLNLS were treated with TNF- for 15 min, and immunocomplexes were generated with p65 antisera (Fig. 4A). In control cultures, a trace amount of wild-type SIMPL or SIMPLNLS could be found in the p65-containing complexes. However, in response to TNF-, there was a significant increase in the amount of SIMPL but not SIMPLNLS present in immunocomplexes generated with p65 antisera. We next confirmed that the interaction between endogenous p65 and endogenous SIMPL occurs in cells stimulated with TNF- (Fig. 4C). These data reveal that TNF- treatment enhances SIMPL-p65 complex formation and suggest that SIMPL may directly modulate p65 transcriptional activity.

View larger version (25K): [in this window] [in a new window]   FIG. 4. SIMPL-p65 complexes form in response to TNF-. (A and B) HEK 293 cells were transfected with an expression vector encoding p65 and an expression vector encoding either wild-type SIMPL or SIMPLNLS. Twenty-four hours later, the indicated cultures were treated with recombinant human TNF- and were harvested 15 min later. Cell lysates were prepared, and p65 antisera were used to generate immunocomplexes. (A) Immunocomplexed materials or (B) cell lysates used to generate the immunocomplexes were analyzed by Western analysis for SIMPL or p65. (C) Duplicate sets of HEK 293 cell cultures were plated; 24 h later, one set was not treated and the second set was treated with rhuTNF for 15 min; all cultures were then harvested. Cell lysates were prepared, and immunocomplexes were generated with SIMPL antisera. Immunocomplexes (-SIMPL) were subjected to SDS-PAGE, and Western blots were prepared and probed with p65 antisera.

View larger version (71K): [in this window] [in a new window]   FIG. 5. Loss of SIMPL does not prevent nuclear localization of p65. (A) Duplicate sets of C3H10T1/2 mouse embryo fibroblasts were transfected with 0.5 µg of the indicated constructs. Twenty-four hours later, half of the cultures were treated with TNF- (+), and all cultures were fixed and washed with PBS 15 min later. Cultures were processed for indirect immunofluorescence by using antiserum that recognizes p65. (B) C3H10T1/Z mouse embryo fibroblasts were transfected with a construct encoding Flag-SIMPL. Forty-eight hours later, cultures were treated with recombinant human TNF- (10 ng/ml) for 15 min. Cytoplasmic and nuclear fractions were prepared, and equal amounts of cellular protein were subjected to SDS-PAGE. A Western blot was prepared and probed with p65 or Flag-specific antiserum.

View larger version (31K): [in this window] [in a new window]   FIG. 6. SIMPL functions as a p65 coactivator. (A) HEK 293 cells were transfected with 1.0 µg of the indicated constructs, 5 ng of a p65-Gal4 construct, and 200 ng of a Gal4-luciferase construct. Cultures were allowed to incubate for 24 to 36 h, at which time cells were harvested and lysates were made and assayed for luciferase activity. (B) Wild-type (first three bars) or RelA–/– (last three bars) MEFs were transfected with 250 ng of the indicated vectors plus 200 ng of an IL-8-luciferase construct and 20 ng of the promoterless sea pansy luciferase construct. Twenty-four hours later, cultures were harvested and luciferase activities were measured. (C) HEK 293 cells were transfected with empty vector (control) or a construct expressing antisense SIMPL. Twenty-four hours later, cultures were stimulated with recombinant human-TNF- (10 ng/ml), and cultures were harvested at the indicated times. Cell lysates, normalized by protein concentration, were subjected to SDS-PAGE, Western blots were prepared and probed with IB and GAPDH antisera. Films were scanned and quantitated by using TotalLab (Nonlinear Dynamics). (D) Model of TNF control of NF-B-dependent gene expression.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Comparison of a lysine-rich region in the carboxyl terminus of SIMPL to other known nuclear proteins revealed a nuclear localization signal. SIMPL nuclear localization is necessary for SIMPL and for TNF RI activation of NF-B-dependent gene expression. The promoters of genes whose expression is controlled by TNF- are complex, with binding sites for multiple transcription factors. SIMPL specifically modulates p65-dependent transcription and has no effect upon the ability of either c-Jun or C/EBPß to modulate gene transcription. SIMPL interacts with p65 in a TNF-dependent manner but is not necessary for the nuclear localization of p65 or p65 DNA binding activity. The ability of SIMPL to enhance p65-dependent endogenous IL-8 gene expression is most likely the result of SIMPL functioning as a p65-specific coactivator. The lack of SIMPL activity in the relA^–/– MEFs further suggests that SIMPL does not function as a coactivator for either c-Rel or Rel-B, since both are present in RelA^–/– MEFs (7).

The data present herein, combined with the knowledge that the IKK complex is required for TNF-dependent NF-B-dependent gene expression, reveal that two distinct nuclear relocalization events are necessary for the activation of NF-B-dependent promoters. Under steady-state conditions, NF-B-IB complexes shuttle between the cytoplasm and the nucleus (26), and there is a modest level of NF-B-dependent gene expression which appears to be IKK dependent (15). In response to TNF- treatment, there is a decrease in cellular IB protein levels and an accumulation of nuclear NF-B. In cells derived from animals deficient in either IKK or IKKß, TNF- treatment induces nuclear relocalization of p65, a response absent in cells deficient in both IKK and IKKß (15, 16, 24). Interestingly, nuclear accumulation of NF-B is not lost in cells that have lost SIMPL function in spite of the fact that IKKß protein levels are greatly diminished (28; unpublished observation), yet there is a significant decrease in the activation of NF-B-dependent gene expression. These data argue that TNF RI-dependent changes in NF-B gene expression require more than the targeted destruction of IB and the nuclear accumulation of p65. We propose a model in which two interrelated pathways are required for effective TNF- induction of NF-B-dependent gene expression (Fig. 6D). Binding of TNF- to TNF RI results in the activation of the IKK complex, targeting IB for degradation and allowing NF-B to be retained in the nucleus. Coordinate activation of SIMPL by TNF- allows SIMPL to translocate into the nucleus. Thus, optimal TNF--dependent NF-B activation requires nuclear p65 and SIMPL.

Many signals cause activation of p65-containing complexes, including TNF-, IL-1, UV light, bacterial products, and viruses, yet the genes expressed in response to these stimuli differ (for a review, see reference 12). Since mammalian gene promoters contain binding sites for multiple transcription factors, the coordinate activation of additional signaling pathways culminating in activation of different combinations of transcription factors provides one mechanism to explain differences in the pattern of gene expression. The discovery of SIMPL as a coactivator specific for TNF--dependent NF-B activation provides another mechanism to explain how TNF- can share in common a signaling complex (e.g., the IKK complex) and generate a different pattern of gene expression. Since SIMPL activity is required for TNF--dependent and not IL-1-dependent NF-B activation (28), this model provides a basis for examining the more complex issue of how cytokine-specific gene expression occurs in signaling pathways that require IKK activity.

	ACKNOWLEDGMENTS

 
This work was supported by Public Health Service grant AI/GM 42798 from the National Institutes of Health (M.A.H.) and National Science Foundation grant MCB 9728069 (M.G.G.).

	FOOTNOTES

 
* Corresponding author. Mailing address: Department of Biochemistry & Molecular Biology, 635 Barnhill Dr., MS 4071, Indianapolis, IN 46202-5122. Phone: (317) 274-7527. Fax: (317) 274-4686. E-mail: mharrin{at}iupui.edu.

Present address: Institute of Life Science & Biotechnology, Yonsei University, Seoul 120-749, South Korea.

	REFERENCES

Top Abstract Introduction Materials and Methods Results Discussion References

 
1. Baldwin, A. S. 2001. The transcription factor NF-B and human diseases. J. Clin. Investig. 107:3-6.[CrossRef][Medline]

2. Chen, Z. J., L. Parent, and T. Maniatis. 1996. Site-specific phosphorylation of IkBa by a novel ubiquitination-dependent protein kinase activity. Cell 84:853-862.[CrossRef][Medline]

3. DiDonato, J. A., M. Hayakawa, D. M. Rothwarf, E. Zandi, and M. Karin. 1997. A cytokine-responsive IB kinase that activates the transcription factor NF-B. Nature 388:548-554.[CrossRef][Medline]

4. Efthymiadis, A., H. Shao, S. Hubner, and D. A. Jans. 1997. Kinetic characterization of the human retinoblastoma protein bipartite nuclear localization sequence (NLS) in vivo and in vitro. J. Biol. Chem. 272:22134-22139.[Abstract/Free Full Text]

5. Fontes, M. R. M., T. The, and B. Kobe. 2000. Structural basis of recognition of monopartite and bipartite nuclear localization sequences by mammalian importin-. J. Mol. Biol. 297:1183-1194.[CrossRef][Medline]

6. Hedin, K. E., M. P. Bell, K. R. Kalli, C. J. Huntoon, B. M. Sharp, and D. J. McKean. 1997. Delta-opioid receptors expressed by Jurkat T cells enhance IL-2 secretion by increasing AP-1 complexes and activity of the NF-AT/AP-1-binding promoter element. J. Immunol. 159:5431-5440.[Abstract]

7. Hoffmann, A., T. H. Leung, and D. Baltimore. 2003. Genetic analysis of NF-kB/Rel transcription factors defines functional specificities. EMBO J. 22:5530-5539.[CrossRef][Medline]

8. Hu, Y., V. Baud, M. Delhase, P. Zhang, T. Deerinck, M. Ellisman, R. Johnson, and M. Karin. 1999. Abnormal morphogenesis but intact IKK activation in mice lacking the IKK subunit of IB kinase. Science 284:316-320.[Abstract/Free Full Text]

9. Ito, C. Y., A. G. Kazantsev, and A. S. Baldwin. 1994. Three NF-B sites in the IB- promoter are required for induction of gene expression by TNF. Nucleic Acids Res. 22:3787-3792.[Abstract/Free Full Text]

10. Jans, D. A., C.-Y. Xiao, and M. H. C. Lam. 2000. Nuclear targeting signal recognition: a key control point in nuclear transport? BioEssays 22:532-544.[CrossRef][Medline]

11. Kalb, A., H. Bluethmann, M. W. Moore, and W. Lesslauer. 1996. Tumor necrosis factor receptors (Tnfr) in mouse fibroblasts deficient in Tnfr1 or Tnfr2 are signaling competent and activate the mitogen-activated protein kinase pathway with differential kinetics. J. Biol. Chem. 271:28097-28104.[Abstract/Free Full Text]

12. Karin, M., and Y. Ben-Neriah. 2000. Phosphorylation meets ubiquitination: the control of NF-B activity. Annu. Rev. Immunol. 18:621-663.[CrossRef][Medline]

13. Le Bail, O., R. Schmidt-Ullrich, and A. Israel. 1993. Promoter analysis of the gene encoding the I kappa B-alpha/MAD3 inhibitor of NF-kappa B: positive regulation by members of the rel/NF-kappa B family. EMBO J. 12:5043-5049.[Medline]

14. Li, Q., and I. Verma. 2002. NF-kappaB regulation in the immune system. Nat. Rev. Immunol. 2:725-734.[CrossRef][Medline]

15. Li, Q., G. Estepa, S. Memet, A. Israel, and I. M. Verma. 2000. Complete lack of NF-kappaB activity in IKK1 and IKK2 double-deficient mice: additional defect in neurulation. Genes Dev. 14:1729-1733.[Abstract/Free Full Text]

16. Li, Q., Q. Lu, J. Y. Hwang, D. Buscher, K. F. Lee, J. C. Izpisua-Belmonte, and I. M. Verma. 1999. IKK1-deficient mice exhibit abnormal development of skin and skeleton. Genes Dev. 13:1322-1328.[Abstract/Free Full Text]

17. Li, Q., D. Van Antwerp, F. Mercurio, K. F. Lee, and I. M. Verma. 1999. Severe liver degeneration in mice lacking the IB kinase 2 gene. Science 284:321-325.[Abstract/Free Full Text]

18. Medzhitov, R., and C. Janeway, Jr. 2000. Innate immunity. N. Engl. J. Med. 343:338-344.[Free Full Text]

19. Mercurio, F., H. Zhu, B. W. Murray, A. Shevchenko, B. L. Bennett, J. W. Li, D. B. Young, M. Barbosa, M. Mann, A. Manning, and A. Rao. 1997. IKK-1 and IKK-2: cytokine-activated IkB kinases essential for NF-kB activation. Science 278:860-866.[Abstract/Free Full Text]

20. Regnier, C. H., H. Y. Song, X. Gao, D. V. Goeddel, Z. Cao, and M. Rothe, M. 1997. Identification and characterization of an IkB kinase. Cell 90:373-383.[CrossRef][Medline]

21. Schnare, M., G. M. Barton, A. C. Holt, K. Takeda, S. Akira, and R. Medzhitov. 2001. Toll-like receptors control activation of adaptive immune responses. Nat. Immunol. 2:947-950.[CrossRef][Medline]

22. Stein, B., A. S. Baldwin, Jr., B. W. Ballard, W. C. Greene, P. Angel, and P. Herrlich. 1993. Cross-coupling of the NF-B p65 and Fos/Jun transcription factors produces potential biological function. EMBO J. 12:3879-3891.[Medline]

23. Stein, B., P. C. Cogswell, Jr., and A. S. Baldwin. 1993. Functional and physical associations between NF-B and C/EBP family members: Rel domain-b-ZIP interaction. Mol. Cell. Biol. 13:3964-3974.[Abstract/Free Full Text]

24. Takeda, K., O. Takeuchi, T Tsujimura, S. Itami, O. Adachi, T. Kawai, H. Sanjo, K. Yoshikawa, N. Terada, and S. Akira. 1999. Limb and skin abnormalities in mice lacking IKK. Science 284:313-316.[Abstract/Free Full Text]

25. Tanaka, M., M. E. Fuentes, K. Yamaguchi, M. H. Durnin, S. A. Dalrymple, K. L. Hardy, and D. V. Goeddel. 1999. Embryonic lethality, liver degeneration, and impaired NF-kappa B activation in IKK-beta-deficient mice. Immunity 10:421-429.[CrossRef][Medline]

26. Turpin, P., B. Ossareh-Nazari, and C. Dargemont. 1999. Nuclear transport and transcriptional regulation. FEBS Lett. 452:82-86.[CrossRef][Medline]

27. Vig, E., M. Green, Y. Liu, D. B. Donner, N. Mukaida, M. G. Goebl, and M. A. Harrington. 1999. Modulation of tumor necrosis factor and interleukin-1 dependent NF-kB activity by mPLK/IRAK. J. Biol. Chem. 274:13077-13084.[Abstract/Free Full Text]

28. Vig, E., M. Green, Y. Liu, K. Kang-Yeol, H.-J. Kwon, J. Tian, M. Goebl, and M. A. Harrington. 2001. SIMPL is a TNF RI-mPLK/IRAK dependent NF-B activator. J. Biol. Chem. 276:7859-7866.[Abstract/Free Full Text]

29. Woronicz, J. B., Z. Gao, Z. Cao, M. Rothe, and D. V. Goeddel. 1997. IB kinase-ß: NF-B activation and complex formation with IB kinase- and NIK. Science 278:866-869.[Abstract/Free Full Text]

30. Zandi, E., D. M. Rothwarf, M. Delhase, M. Hayakawa, and M. Karin. 1997. The IB kinase complex (IKK) contains two kinase subunits, IKK and IKKß, necessary for IB phosphorylation and NF-B activation. Cell 91:243-252.[CrossRef][Medline]

This article has been cited by other articles:

• Conner, J. R., Smirnova, I. I., Poltorak, A. (2008). Forward genetic analysis of Toll-like receptor responses in wild-derived mice reveals a novel antiinflammatory role for IRAK1BP1. J. Exp. Med. 205: 305-314 [Abstract] [Full Text]  
• Luo, Y., Kwon, H.-J., Montano, S., Georgiadis, M., Goebl, M. G., Harrington, M. A. (2007). Phosphorylation of SIMPL modulates RelA-associated NF-{kappa}B-dependent transcription. Am. J. Physiol. Cell Physiol. 292: C1013-C1023 [Abstract] [Full Text]  
• Rahman, I., Adcock, I. M. (2006). Oxidative stress and redox regulation of lung inflammation in COPD.. Eur Respir J 28: 219-242 [Abstract] [Full Text]  
• Song, Y.-J., Jen, K.-Y., Soni, V., Kieff, E., Cahir-McFarland, E. (2006). IL-1 receptor-associated kinase 1 is critical for latent membrane protein 1-induced p65/RelA serine 536 phosphorylation and NF-{kappa}B activation. Proc. Natl. Acad. Sci. USA 103: 2689-2694 [Abstract] [Full Text]  
• Ziegler, E. C., Ghosh, S. (2005). Regulating Inducible Transcription Through Controlled Localization. Sci Signal 2005: re6-re6 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kwon, H.-J. Articles by Harrington, M. A. Search for Related Content PubMed PubMed Citation Articles by Kwon, H.-J. Articles by Harrington, M. A.