This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Conrad, M. Articles by Brielmeier, M. Search for Related Content PubMed PubMed Citation Articles by Conrad, M. Articles by Brielmeier, M.

Essential Role for Mitochondrial Thioredoxin Reductase in Hematopoiesis, Heart Development, and Heart Function

Marcus Conrad,^1, Cemile Jakupoglu,^1, Stéphanie G. Moreno,¹ Stefanie Lippl,¹ Ana Banjac,¹ Manuela Schneider,² Heike Beck,¹ Antonis K. Hatzopoulos,¹ Ursula Just,¹ Fred Sinowatz,³ Wolfgang Schmahl,⁴ Kenneth R. Chien,⁵ Wolfgang Wurst,⁶ Georg W. Bornkamm,^1, and Markus Brielmeier^2,

Institute of Clinical Molecular Biology and Tumour Genetics, GSF Research Centre for Environment and Health,¹ Department of Veterinary Anatomy II,³ Institute of Veterinary Pathology, Ludwig-Maximilian University of Munich, Munich,⁴ Department of Comparative Medicine,² Institute of Developmental Genetics, GSF Research Centre for Environment and Health, Neuherberg, Germany,⁶ Institute of Molecular Medicine, University of California at San Diego School of Medicine, La Jolla, California⁵

Received 18 February 2004/ Returned for modification 21 April 2004/ Accepted 22 July 2004

	ABSTRACT

Top Abstract Introduction Materials and Methods Results Discussion References

 
Oxygen radicals regulate many physiological processes, such as signaling, proliferation, and apoptosis, and thus play a pivotal role in pathophysiology and disease development. There are at least two thioredoxin reductase/thioredoxin/peroxiredoxin systems participating in the cellular defense against oxygen radicals. At present, relatively little is known about the contribution of individual enzymes to the redox metabolism in different cell types. To begin to address this question, we generated and characterized mice lacking functional mitochondrial thioredoxin reductase (TrxR2). Ubiquitous Cre-mediated inactivation of TrxR2 is associated with embryonic death at embryonic day 13. TrxR2^{TrxR2–/–minus;/TrxR2–/–minus;} embryos are smaller and severely anemic and show increased apoptosis in the liver. The size of hematopoietic colonies cultured ex vivo is dramatically reduced. TrxR2-deficient embryonic fibroblasts are highly sensitive to endogenous oxygen radicals when glutathione synthesis is inhibited. Besides the defect in hematopoiesis, the ventricular heart wall of TrxR2^{TrxR2–/–minus;/TrxR2–/–minus;} embryos is thinned and proliferation of cardiomyocytes is decreased. Cardiac tissue-restricted ablation of TrxR2 results in fatal dilated cardiomyopathy, a condition reminiscent of that in Keshan disease and Friedreich's ataxia. We conclude that TrxR2 plays a pivotal role in both hematopoiesis and heart function.

	INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

 
Reactive oxygen species (ROS)—generated mainly as a by-product of the respiratory chain or by oxidases—are implicated in the pathogenesis and pathophysiology of a variety of human diseases such as cancer, cardiovascular, and degenerative disorders. A variety of cellular antioxidant systems control the balance of free intra- and extracellular oxygen radicals. Previous efforts have addressed the physiological role of superoxide dismutases, catalases, and glutathione (GSH) peroxidases in vivo, but the role of the thioredoxin/thioredoxin reductase/peroxiredoxin system in ROS removal has only recently attracted attention.

Thioredoxins are small redox-active proteins with an essential function in DNA metabolism and repair, transcription, and cell-cell communication (1). Acting through peroxiredoxins, they also efficiently protect cells from oxidative damage (27). Cytosolic (Trx1) and mitochondrial (Trx2) thioredoxins are required for proliferation and protection from apoptosis during early embryogenesis (26). Moreover, in chicken B cells, Trx2 is critically involved in the regulation of mitochondrion-dependent apoptosis (37). More recently, heart-specific overexpression of dominant-negative Trx1 was shown to be associated with increased oxidative stress and cardiac hypertrophy in mice (39).

Trx activities are governed by thioredoxin reductases (TrxRs) that, in turn, use NADPH/H⁺ as the reducing agent (23). TrxRs are members of the pyridine nucleotide-disulfide oxidoreductase family, form homodimers, and possess two interacting redox-active centers. The C-terminal redox center contains a catalytically important selenocysteine (SeCys) (9, 17, 41). In mammals, three TrxRs are known—one cytosolic (TrxR1) (8), one mitochondrial (TrxR2) (7), and one testis-specific GSH-TrxR (33)— each encoded by individual genes. In contrast to their well-studied biochemical properties, little is known about the individual contribution of the different TrxRs in living organisms or about possible redundancies among the different redox systems. To dissect the complex network of redox metabolism in vivo, we have established mice deficient for mitochondrial TrxR2. To overcome possible embryonic lethality, as observed in Trx1- and Trx2-null mice, and to investigate TrxR2 function in specific organs and at defined time points, we used a conditional ablation strategy. Ubiquitous deletion of TrxR2 results in embryonic lethality at embryonic day 13 (E13). TrxR2^–/– embryos are severely anemic and exhibit a marked thinning of the ventricular heart wall. To further dissect the contribution of the two major defects in the overall phenotype, we generated mice with cardiac cell-specific inactivation of the TrxR2 gene. These mice developed fatal dilated cardiomyopathy and died shortly after birth. Analysis of fibroblasts isolated from TrxR2^–/– embryos revealed a critical role of TrxR2 in the removal of toxic ROS species and the maintenance of mitochondrial integrity.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

 
Gene targeting, mouse breeding and genotyping. Mouse expressed sequence tag clone IMAGp998N131993 (RZPD, Berlin, Germany), covering exons 10 to 18 of TrxR2, was used to screen a 129/SV mouse lambda-phage library (Stratagene, Inc., La Jolla, Calif.). Five clones were isolated and cloned into pBluescript SK(+) (Stratagene). The insert of one clone containing the 3' region of the TrxR2 gene was sequenced and used for the generation of the targeting constructs. In brief, a NheI/XmaI fragment representing the 5' arm for homologous recombination was subcloned in pBluescript SK(+), and a loxP element, including an EcoRI site, was inserted in the unique FseI site. The 3' arm was inserted as an XmaI/XmaI fragment in pPNT4, a vector containing an frt-flanked neomycin phosphotransferase (neo) gene and one loxP site (4). The targeting construct pPNT11 was completed by inserting the 5' arm including the second loxP site. The conditional lacZ knockin construct is comprised of the same homologous arms but contains additional elements as depicted in Fig. 1E. Gene targeting of both constructs in E14 embryonic stem (ES) cells was carried out as described previously (14). ES cell clones with successful homologous recombination arose at a frequency of 5 to 8% when tested with both external probes pMC67 and pMC68. Additional integration sites were excluded by Southern blot analysis with a neo gene probe. Flp-mediated removal of the neo gene by transient overexpression of Flp recombinase in targeted ES cell clones occurred at a frequency of 6% (29). Backcross of chimeric animals to C57BL/6 mice, produced upon microinjection of ES cell clones into C57BL/6 blastocysts, gave rise to germ line transmission of the loxP flanked (floxed) TrxR2 allele (11). These mice were crossed to congenic C57BL/6 Cre deleter mice, resulting in deletion of the floxed allele (31). Mice with either the floxed or the deleted TrxR2 allele were backcrossed on a C57BL/6 background. To facilitate genotyping of mice, primer pairs were designed for detection of wild-type (WT), floxed, or deleted alleles (TrxR2flox1/2, CAGGTCACTAGGCTGTAGAGTTTGC/ATGTCCCAGTGTACTTATGATGAATC; TrxR2Del1/2, TGCTTCCAGGCCCAGTGCTCTGACTGG/CAGGCTCCTGTAGGCCCATTAAGGTGC). The Cre-specific primer pair was as follows: GATGCAACGAGTGATGAGGTTCGC/ACCCTGATCCTGGCAATTTCGGC (CreA/B).

View larger version (60K): [in this window] [in a new window]   FIG. 1. Gene targeting and expression pattern of TrxR2 in mice. (A) Strategy for conditional disruption of the TrxR2 gene. The 3' region of the TrxR2 gene including exons 12 to 18 is shown in the upper line. The SeCys codon UGA is marked with an asterisk. For conditional gene targeting, exons 15 to 18 were flanked with loxP sites (open triangles). Homologous recombination, subsequent Flp-mediated removal of the frt (black triangles)-flanked neomycin phosphotransferase gene (neo), and Cre-mediated deletion of the C-terminally located redox-center are outlined below. Underneath, the expected DNA fragments from characteristic restriction digests (E, EcoRI; K, KpnI) detected with the corresponding 5' (pMC67), 3' (pMC68) and internal (int.) probes (striped rectangles) are schematically depicted. In the targeting vector the thymidine kinase gene (TK) is placed downstream from the 3' arm for negative selection. (B) Homologous recombination in ES cell clones was confirmed by Southern blotting of EcoRI-digested DNA hybridized with 3' (lanes 1 and 2) and 5' (lane 3) external probes and after removal of the neo gene (lane 2). (C) Germ line transmission of the modified TrxR2 allele was verified by PCR genotyping of tail DNA (lanes 1 and 2). The floxed TrxR2 allele gives rise to a 40-bp-longer product than the WT allele (lane 1; lane 2, 100-bp ladder). Southern blotting of KpnI-digested DNA, isolated from E12.5 embryos of TrxR2+/– intercrosses, was hybridized with the internal probe (lanes 3 to 5) revealing heterozygous (lane 3), WT (lane 4), and KO (lane 5) embryos. (D) Semiquantitative RT-PCR analyses of mRNA obtained from E12.5 embryos of TrxR2+/– intercrosses. (E) Additional gene targeting strategy to study the TrxR2 expression pattern with ß-galactosidase as a reporter gene. TrxR2+/–[lacZk.i.] mice were generated and identified by Southern blotting as described in panels B and C. (F to I) Immunohistochemistry of TrxR2+/+ (F and H) and TrxR2+/–[lacZ k.i.] (G and I) embryos stained with an anti-lacZ antibody (brown color; arrows) revealed strong expression in the atrium (A) and ventricle (V) of the heart (F and G) and lower expression in the liver (H and I). Cryosections were counterstained with hematoxylin. Scale bars (F to I), 100 µm.

Mice were kept under standard conditions with food and water ad libitum (Altromin GmbH, Lage, Germany). All animal experiments were performed in compliance with the German animal welfare law and have been approved by the institutional committee on animal experimentation and the government of Upper Bavaria.

RNA isolation and semiquantitative reverse transcription-PCR (RT-PCR). Total RNA was isolated from homogenized embryonic tissue by using peqGOLDTriFast (peqLab, Erlangen, Germany). DNase-treated total RNA (DNase I, RNase I free, catalog no. 776785; Roche, Mannheim, Germany) was reverse transcribed by using a reverse transcription system (Promega Corp., Madison, Wis.). Primer pairs specific for Aldolase (Aldolase1/2, AGCTGTCTGACATCGCTCACCG/CACATACTGGCAGCGCTTCAAG) and TrxR2(TrxR2E6/10, CAGCTTTGTGGATGAGCACACAGTTCG/GATCCTCCCAAGTGACCTGCAGCTGG; and TrxR2E15/18, TTCACGGTGGCGGATAGGGATGC/TGCCCAGGCCATCATCATCTGACG) were used to detect the transcripts.

In situ end labeling (ISEL). Detection of apoptotic cells was performed with the ApopTag kit (S7100; Serologicals Corp., Norcross, Ga.) on PFA-fixed (4% [wt/vol] paraformaldehyde [PFA] in phosphate-buffered saline), paraffin-embedded sections according to the manufacturer's instructions. Digoxigenin-deoxynucleoside triphosphate-labeled cells were incubated with an anti-digoxigenin peroxidase conjugate and visualized with 3,3'-diaminobenzidine (DAB, SK-4100; Vector Laboratories, Inc., Burlingame, Calif.).

Immunohistochemistry. (i) LacZ staining. Upon standard pretreatment and blocking with M.O.M. blocking reagent (M.O.M Immunodetection Kit, PK-2200; Vector Laboratories), cryosections were incubated overnight with an anti-ß-galactosidase monoclonal antibody (1:50; MAB1802; Chemicon International, Inc., Temecula, Calif.). Visualization of avidin-biotin complexes was performed with 3-amino-9-ethylcarbazole (SK-4200; Vector Laboratories).

(ii) PCNA staining. PFA-fixed paraffin-embedded sections were incubated for 1 h at 37°C with anti-PCNA monoclonal antibody (1:200; PC10; Dako, Glostrup, Denmark) and visualized with DAB.

(iii) Double antibody-apoptosis labeling. Cryosections were incubated overnight at 4°C with a rat anti-mouse CD45 antibody (1:20; catalog no. 550539; BD Pharmingen, San Jose, Calif.). In the case of rat anti-K8 or -K18 antibodies, initial incubation was performed for 90 min at 37°C (1:10; Troma1 and Troma2 [kindly provided by Solange Magre, CNRS/Université Pierre et Marie Curie, Paris, France, and Rolf Kemler, Max Planck Institute, Freiburg, Germany]). Sections were subsequently incubated with a secondary biotinylated antibody for 1 h at room temperature. After avidin-biotin complex reaction was performed (ABC alkaline phosphatase staining kit, AK-5000; Vector Laboratories), bound antibodies were visualized with a substrate for alkaline phosphatase (Vector Blue, SK-5300; Vector Laboratories). Sections were washed and postfixed in cold ethanol-acetic acid (2:1) at –20°C, the endogenous peroxidase activity was blocked with 3% (vol/vol) H₂O₂, and the sections were subjected to the standard ISEL procedure.

Electron microscopy. Hearts were isolated and immediately fixed in 2.5% glutaraldehyde-2% PFA in 0.1 M sodium cacodylate buffer (pH 7.2) for 24 h, rinsed three times in the same buffer, and postfixed in 1% osmium tetroxide-1.5% potassium ferrocyanide in potassium cacodylate buffer for 2 h. Samples were washed three times, dehydrated, and embedded in Propylenoxyd and Polyembed 812 (Plano, Wetzlar, Germany). Ultrathin sections (60 nm) were stained with uranyl acetate and lead acetate and then examined on a Zeiss 902 electron microscope at 80 kV.

BrdU incorporation and detection. 5-Bromodeoxyuridine (BrdU; catalog no. 100171; ICN Biomedicals, Aurora, Ohio) was injected intraperitoneally in pregnant mice at E13.0 at a dose of 100 mg/kg of body weight. After 2 h, isolated embryos were fixed in PFA and embedded in paraffin. Incorporated BrdU was visualized by immunohistochemistry with an anti-BrdU monoclonal antibody (catalog no. 1170376; Roche Diagnostics Corp.) and a secondary biotinylated antibody (ABC peroxidase staining).

Mouse embryonic fibroblast (MEF) culture. Embryos were isolated from pregnant mice at E12.5, the body trunk was dissected away from other structures and then treated with trypsin, treated with DNase, minced with a syringe, and cultivated under standard conditions in Dulbecco modified Eagle medium (Invitrogen GmbH, Karlsruhe, Germany) with 10% fetal calf serum (FCS), glutamine, and penicillin-streptomycin. Buthionine sulfoximine (BSO; Sigma-Aldrich, Taufkirchen, Germany) was used at a 50 µM final concentration.

Staining of MEFs. Cell nuclei were stained with 1 µM Hoechst 33342 (Sigma-Aldrich), and the mitochondria were stained with 0.5 µM MitoTracker Green FM (Molecular Probes, Inc., Oreg.). RedoxSensor Red CC-1 was used according to the manufacturer's protocol (2) (Molecular Probes). Stained cells were assessed with a Zeiss Axiovert 200 M microscope (Carl Zeiss, Jena, Germany) and Openlab software (version 3.0; Improvision, Coventry, United Kingdom).

CFU assays. CFU assays were performed as described previously (30). In brief, livers from E12.5 embryos were prepared, minced with a syringe in Iscove modified Dulbecco medium (including 20% FCS), centrifuged, and resuspended for hemolysis in 1 volume of medium without FCS and 1 volume of 2x hemolysis buffer (1.5 M NH₄Cl, 0.1 M KHCO₃, and 1 mM EDTA in 500 ml [pH 7.4] with KOH). The hemolysis step was repeated twice. Cells were plated at equal cell numbers on 35-mm dishes containing methylcellulose, 10% bovine serum albumin (catalog no. 652237; Roche), 20% FCS (pretested), 1% penicillin-streptomycin, 1% glutamine, 50 µM ß-mercaptoethanol, and cytokines (100 U of mouse interleukin-3 [IL-3] conditioned medium, 2 U of erythropoietin, 10 ng of stem cell factor, 10 ng of FLIT ligand, 10 ng of thrombopoietin, 10 ng of granulocyte-macrophage colony-stimulating factor, and 10 ng of IL-6/ml). After 1 week of incubation, colonies with >50 cells were counted and subdivided into granulocytes, macrophages, mixed colonies (more than three different cell types), granulocytes and macrophages, and burst-forming units that were additionally visualized by benzidine staining (0.1 volume of benzidine, 0.1 volume of H₂O₂, and 0.5 volume of H₂O).

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

 
Generation of TrxR2-deficient and lacZ knockin reporter mice and embryonic expression pattern of TrxR2. The TrxR2 gene is composed of 18 exons spanning a region of 57 kb (22). The last four exons harboring the C-terminal catalytic center were flanked by two loxP sites (Fig. 1A). The SeCys codon UGA is encoded by exon 17. The selenocysteine insertion sequence (SECIS) element, essential for cotranslational SeCys incorporation at the UGA codon, and the transcription termination signal are both encoded by exon 18. After homologous recombination of the targeting construct in ES cells (Fig. 1A and B), Flp-mediated removal of the frt-flanked neomycin phosphotransferase gene (neo) in ES cells results in a TrxR2 allele with two loxP and one frt inserted sites. Cre-mediated excision of the loxP-flanked exons 15 to 18 in mice leads to removal of the C-terminally located enzymatic domain of TrxR2 (Fig. 1C). TrxR2^+/– mice, obtained after breeding with Cre deleter mice, are viable and fertile, show no obvious phenotype, and have a normal life span compared to WT littermates. Since no specific antibody for the detection of TrxR2 was available, semiquantitative RT-PCR with embryonic mRNA was used to verify the knockout (KO) of the targeted region (Fig. 1D). Two primer pairs, one covering the central region (TrxR2E6-10) and one covering the deleted region (TrxR2E15-18) of the TrxR2 gene, were used to study mRNA levels in embryos. Aldolase served as a control. The absence of the last four exons in TrxR2^–/– embryos was confirmed with primer pair TrxR2E15-18. Reduction of mRNA levels was noticeable in TrxR2^+/– embryos compared to WT siblings. Faint RT-PCR products were observed in TrxR2^–/– embryos with primer pair TrxR2E6-10, indicating very low levels of truncated TrxR2 message.

To study the TrxR2 expression pattern, we designed a conditional lacZ knockin approach into the TrxR2 locus (Fig. 1E). A translational and transcriptional stop/internal ribosomal entry site-ß-galactosidase(lacZ) cassette was placed in the 3'-nontranscribed region of the TrxR2 gene. This brings LacZ under the control of the endogenous TrxR2 promoter upon Cre-mediated removal of exons 15 to 18, including the transcriptional stop signal (derived from the mouse phosphoglycerine kinase gene). Immunohistochemistry of TrxR2^{+/–(lacZ-k.i.)} embryos with an anti-lacZ antibody revealed strong expression in the embryonic heart, especially in the myocardium and atrial walls, and to a lower extent in the embryonic liver (Fig. 1F to I). These findings are consistent with mRNA expression data obtained from adult tissues (21).

Embryonic lethality caused by TrxR2 deficiency. Intercross of TrxR2^+/– mice did not yield TrxR2^–/– offspring (of 137 viable offspring, 33.6% were genotypically WT and 66.4% hemizygous). Genotyping of littermates at different days of gestation revealed that TrxR2^–/– embryos died between E12.5 and E13.5. TrxR2^–/– embryos were reduced in size and had an anemic appearance (Fig. 2A). The blood vessels of the yolk sac and the embryo proper were markedly less supplied with blood (Fig. 2B to E), and the bloodstream velocity was slower in living TrxR2^–/– embryos at E13.0 (data not shown). The anemic appearance of the TrxR2^–/– embryos and the comparable high expression of TrxR2 in embryonic heart and liver suggested a crucial role of TrxR2 in the respective organs.

View larger version (69K): [in this window] [in a new window]   FIG. 2. Anemic appearance of TrxR2TrxR2–/–minus;/TrxR2–/–minus; embryos. (A) TrxR2TrxR2–/–minus;/TrxR2–/–minus; embryos (right) are anemic and smaller than WT littermates (left) but do not display any gross developmental abnormalities. (B to E) The blood vessels of freshly prepared TrxR2TrxR2–/–minus;/TrxR2–/–minus; embryos (E13.5) (C and E) were less supplied with blood than TrxR2+/+ littermates (B and D) as best seen in the yolk sac (B and C) and developing brain (D and E). Placenta formation was not affected (B and E), as also confirmed by histological examination (data not shown).

View larger version (93K): [in this window] [in a new window]   FIG. 3. Histological examination of TrxR2-deficient embryos. (A and B) H&E staining of transversal sections through the heart region of TrxR2+/+ (A) and TrxR2TrxR2–/–minus;/TrxR2–/–minus; (B) embryos at E13.0. All basic structures of the heart are formed, but the ventricular chamber walls are thinned and the trabeculae are less prominent. The endocardial cushions and valves are not affected. BrdU incorporation (C and D) and nuclear PCNA staining (E and F) revealed reduced proliferation of myocardial cells in TrxR2TrxR2–/–minus;/TrxR2–/–minus; (D and F) versus TrxR2+/+ (C and E) embryos. Hematoxylin and eosin (G and H) and ISEL staining (I and K) of liver sections revealed pleiomorphic, spongiform-like structures (H) and increased apoptosis (K) in TrxR2TrxR2–/–minus;/TrxR2–/–minus; embryos. ISEL-(brown) and antibody (blue)-double staining of TrxR2TrxR2–/–minus;/TrxR2–/–minus; liver sections revealed that part of the apoptotic cells (brown) are of hematopoietic origin (CD45-positive, L), whereas the majority of nonhematopoietic keratin 8 (m)-, and keratin 18-positive cells (N) were negative for ISEL staining. Scale bars: A and B, 100 µm; C, D, I, and K, 25 µm; E to H, 20 µm.

TrxR2 is required for fetal blood cell formation. We examined whether the anemic phenotype in TrxR2^{TrxR2–/–minus;/TrxR2–/–minus;} embryos is due to reduced heart function or whether it is caused by perturbed hematopoiesis in the liver, the main site of fetal hematopoiesis after E11 (6). Noticeable was the pleiomorphic and spongiform appearance of liver tissue in TrxR2^{TrxR2–/–minus;/TrxR2–/–minus;} embryos, suggesting perturbed proliferation and/or increased apoptosis of hepatocytes and/or hematopoietic cells (Fig. 3G and H). BrdU and PCNA staining of embryonic liver sections did not reveal any major differences (data not shown), whereas ISEL staining showed augmented apoptosis in the liver of TrxR2^{TrxR2–/–minus;/TrxR2–/–minus;} embryos (Fig. 3I and K). Double staining, including ISEL, blood cell marker CD45, and hepatocyte markers keratins 8 and 18, revealed that mainly blood cells were affected by the loss of TrxR2 (Fig. 3L to N). CFU assays with liver cells isolated from E12.5 embryos were carried out to investigate whether hematopoietic differentiation is perturbed. In CFU assays, the composition of blood cell colonies was unaltered (Fig. 4A). However, TrxR2^{TrxR2–/–minus;/TrxR2–/–minus;} colonies were markedly smaller (Fig. 4B to E), indicating that reduced blood cell formation is the cause of the severe anemic phenotype of TrxR2^{TrxR2–/–minus;/TrxR2–/–minus;} embryos.

View larger version (57K): [in this window] [in a new window]   FIG.4. Hematopoietic colony formation (A to E), fibroblast proliferation (F) and removal of ROS (G to L) are severely affected in TrxR2TrxR2–/–minus;/TrxR2–/–minus; cells. (A to E) CFU assays were performed with isolated liver cells from E12.5 embryos. The liver cells were cultivated for 1 week. Colonies were classified as macrophages (group 1); burst-forming units (group 2); mixed colonies composed of macrophages, granulocytes, and burst-forming units (group 3); granulocytes and macrophages (group 4); and pure granulocyte colonies (group 5). (A) Differentiation into the different colony types was not altered in TrxR2+/– and TrxR2TrxR2–/–minus;/TrxR2–/–minus; cells. (B to E) The size of individual TrxR2TrxR2–/–minus;/TrxR2–/–minus; colonies (C and E) was, however, dramatically reduced compared to WT controls (B and D). (F) Decreased proliferation of MEFs of TrxR2TrxR2–/–minus;/TrxR2–/–minus; compared to TrxR2+/+ mice. (H) When GSH synthesis was inhibited in MEFs by 50 µM BSO, cell death was rapidly induced in TrxR2TrxR2–/–minus;/TrxR2–/–minus; but not in TrxR2+/+ cells. (G) The main cellular defense systems against ROS that may compensate for the loss of the TrxR2 are schematically depicted. (I to L) Triple staining with Hoechst 33342 (blue nuclear staining), MitoTracker Green FM (green mitochondrial staining), and RedoxSensor Red CC-1 (red) after 48 h of BSO treatment revealed predominant lysosomal localization of the RedoxSensor Red CC-1 in WT cells (I) and mitochondrial localization in TrxR2TrxR2–/–minus;/TrxR2–/–minus; cells (K). (L) The distribution of the dyes in the different cellular compartments is quantified. (M) NAC treatment (5 mM) rescued TrxR2TrxR2–/–minus;/TrxR2–/–minus; MEFs from BSO-induced apoptosis. A strongly increasing number of detaching and dying cells was apparent only in KO cells (days 3 and 5) without NAC treatment. Photographs were taken at days 1, 3, and 5 after BSO and NAC treatment. (H) Quantification of the results.

Heart-specific inactivation of TrxR2 leads to fatal dilated cardiomyopathy. Targeted disruption of genes such as retinoid X receptor (5) and the cytokine receptor gp130 (40) has suggested that these genes participate in heart and blood development. However, cardiomyocyte-specific inactivation of the respective genes did not support the conclusions drawn from the complete KO experiments (3, 10). To rule out the possibility that the failure in heart development is the consequence of a primary defect of TrxR2 deficiency in hematopoietic cells, TrxR2 was deleted specifically in cardiomyocytes by using the MLC2a-Cre transgenic mouse line (38). TrxR2^+/– mice were first crossed with MLC2a-Cre mice and, subsequently, TrxR2^{+/–,Tg[MLC2a-Cre]} and TrxR2^fl/fl mice were mated to obtain TrxR2^{fl/–,Tg[MLC2a-Cre]} mice. Mice that had both copies of the TrxR2 gene deleted in a cardiac tissue-specific manner showed clinical features of congestive heart failure, including generalized edema, liver congestion, globular heart shape, and atrial dilatation, and died within several hours after birth (data not shown). Histological examination revealed dilated heart cavities and thinning of the ventricular myocardium (Fig. 5B and C). We observed, at higher magnifications, severe distortion in the morphology of myocardial cells, such as pycnotic nuclei, cytoplasmic vacuolization, and reduced cross-striation (Fig. 5D to G). Electron microscopic analyses of neonatal hearts showed severe swelling and destruction of mitochondrial cristae in cardiomyocytes of cardiac tissue-restricted TrxR2-deficient mice (Fig. 5H to L). Vessel formation of yolk sac and placenta, as well as development of coronary arteries, as assessed by histological and immunohistochemical examination (vWF staining), was not affected by heart-specific inactivation of TrxR2 (data not shown). This demonstrates that TrxR2 is not only essential for normal embryonic hematopoiesis but also plays a crucial role in the maintenance of mitochondrial integrity in cardiomyocytes and is therefore indispensable for proper heart function of newborn mice.

View larger version (127K): [in this window] [in a new window]   FIG. 5. Dilated congestive cardiomyopathy in heart-specific TrxR2 KO mice. (A) Southern blot analysis revealed a decrease of the floxed allele (arrow) relative to the KO band in heart (lane H) compared to brain tissue (lane B). (B and C) Myocardial thinning and dilatation in cardiac tissue-specific TrxR2TrxR2–/–minus;/TrxR2–/–minus; mice (C). The ventricles and lung vessels were dilated and congested with blood cells. (D and E) Higher magnification of ventricular myocard (boxed in panels B and C) revealed nuclei of various sizes, massive vacuolization and perturbed directional arrangement of TrxR2TrxR2–/–minus;/TrxR2–/–minus; cardiomyocytes. (F and G) Phase-contrast imaging demonstrated strong reduction of cross-striation in KO cardiomyocytes (G) compared to control tissue (arrow in panel F). (H to L) Transmission electron microscopy revealed severe mitochondrial malformation and swelling with destruction or loss of cristae in KO myocardial (I and L) versus WT (H and K) cells at low (H and I) and high (K and L) magnifications. Scale bars: B and C, 250 µm; D to G, 10 µm.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Anticipating that loss of TrxR2 might be associated with embryonic death, we used the cre/loxP technology for the generation of TrxR2 KO mice. Cre-mediated excision of the last four exons leads to the removal of the final 100 amino acids including the C terminally located redox-center consisting of Cys-SeCys-Gly. Mutational and biochemical studies have previously shown that SeCys is essential for the enzymatic function of TrxRs (9, 17, 41). Also, this approach deemed necessary because the 5' region of TrxR2 overlaps with the first exon of the catechol-o-methyltransferase gene, and there is also alternative first exon usage in the TrxR2 gene (22, 34).

We found that during development TrxR2 is mainly expressed in the embryonic heart and liver, reflecting the adult situation (22). This expression profile associates TrxR2 function with organs characterized by high metabolic activity and further corroborates a crucial role for TrxR2 in the control of harmful intracellular ROS.

Ubiquitous deletion of the TrxR2 gene leads to embryonic lethality at E13. The phenotypic characteristics of TrxR2^{TrxR2–/–minus;/TrxR2–/–minus;} embryos reflected the expression pattern of TrxR2 in normal development. TrxR2-null embryos were highly anemic and smaller compared to WT littermates. Histological examination of the heart revealed that the ventricular walls and the trabeculae were thinner in KO mice than in WT and TrxR2^+/– mice. The number of ISEL-positive cells was increased in the liver but not in the heart. In CFU assays established from fetal liver at E13, the size of all types of hematopoietic colonies was dramatically reduced, whereas hematopoietic differentiation was not affected by TrxR2 deficiency.

Outgrowth of TrxR2^{TrxR2–/–minus;/TrxR2–/–minus;} MEFs in tissue culture was also impaired but not to the same extent as observed for hematopoietic cells. TrxR2^{TrxR2–/–minus;/TrxR2–/–minus;} fibroblasts could be propagated in vitro; they were, however, much more sensitive to oxidative stress imposed to the cells by GSH depletion than TrxR2^+/+ and TrxR2^+/– cells. These data indicate that under standard cell culture conditions hematopoietic cells are more dependent on TrxR2 than fibroblasts. Several mechanisms, either alone or in combination, may account for the proposed hierarchy in TrxR2 dependence. Cells may differ in their ability to cope with oxygen radicals due to different degrees of pathway redundancy and/or overall antioxidant capacity. Alternatively, oxygen radical production of different cell types may vary greatly due to differences in their cellular metabolism. Finally, different cell types may differ widely in their intrinsic susceptibility versus resistance to oxygen radical-induced apoptosis due to different expression patterns of pro- and antiapoptotic proteins. The hematopoietic system is well known for its selective sensitivity to ionizing irradiation. Our finding that TrxR2 KO mice die of anemia at day 13 of embryonic development may thus emphasize the particular susceptibility of hematopoietic cells to oxygen radical-induced apoptosis. This interpretation is in line with the fact that deletion of Trx2 in the chicken B-cell line DT40 leads to oxygen-radical induced apoptosis mediated by cytochrome c release and caspase-3 activation (37).

The TrxR2 inactivation phenotype is less severe than the one observed in the KO mice of Trx2, the main substrate of TrxR2. Trx2^–/– mice die at E10.5 due to massive apoptosis (26). This suggests that other enzymes, such as, for example, TrxR1 or the GSH-dependent redox system, can partially substitute for the TrxR2 deficiency.

Besides the defect in hematopoiesis, TrxR2 KO mice exhibited morphological changes in the heart. To discriminate whether TrxR2 plays an intrinsic role in heart development and function or whether the defect in heart morphology is a consequence of the defect in hematopoiesis, we bypassed the hematopoietic phenotype and established cardiac tissue-restricted TrxR2-deficient mice. These mice died shortly after birth from dilated cardiomyopathy and congestive heart failure. High-magnification and ultrastructural examination revealed severe distortion in the morphology of cardiomyocytes, i.e., pycnotic nuclei, partial loss of cross-striation, swelling of the mitochondria, and destruction of mitochondrial cristae. In contrast to the severe changes in morphology, no signs of apoptosis were detected in the myocardium by ISEL staining. Difficulties in detecting apoptotic cells in morphologically severely perturbed heart tissue have also been noted by others. Narula et al. found that cardiomyocytes of patients with idiopathic dilated or ischemic cardiomyopathy exhibit severe mitochondrial swelling and accumulation of cytochrome c in the cytosol in the absence of apoptotic changes (24). Likewise, the apoptotic index as defined by the TUNEL (terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling) assay was found to be very low in models of chronic heart failure (12, 18). We suggest that cardiac tissue-restricted TrxR2 KO mice die of congestive heart failure due to mitochondrial dysfunction of cardiomyocytes before DNA degradation and cell death of cardiomyocytes can be detected to a significant extent.

The fact that mice with cardiac tissue-specific deletion of TrxR2 die shortly after birth has two implications. First, it indicates that the defect in heart morphology observed in TrxR2^{TrxR2–/–minus;/TrxR2–/–minus;} mice at E13 is not only a consequence of the hematopoietic defect. It demonstrates for the first time that loss of one member of the Trx/TrxR system is indispensable for normal heart development and function. Second, lethality in complete TrxR2^{TrxR2–/–minus;/TrxR2–/–minus;} embryos is delayed from E13 until birth in mice with a cardiac tissue-specific deletion of TrxR2. This suggests that the heart-specific defect observed in TrxR2^{TrxR2–/–minus;/TrxR2–/–minus;} mice at E13 is not limiting on its own for survival during embryonic development. However, TrxR2 deficiency in cardiomyocytes becomes fatal when an entirely self-sustaining circulatory system has to be maintained by the heart. It is conceivable that in mice with ubiquitous deletion of TrxR2, anemia and the heart-specific defect enhance each other and, thus, may lead to an earlier lethal compound phenotype compared to the respective tissue specific deletions. To clarify this issue, it would be necessary to generate a hematopoiesis-specific KO of TrxR2.

Using transgenic approaches, Yamamoto et al. demonstrated that Trx1 is involved in cardiac myocyte growth of mice (39). Heart-specific overexpression of a dominant-negative form of Trx1 led to increased oxidative stress in cardiomyocytes associated with cardiac hypertrophy, whereas overexpression of WT Trx1 reduced the extent of ROS-induced hypertrophy in response to pressure overload. Since the dominant-negative Trx1 may impair Trx2 activity as well, a putative contribution of Trx2 in protection of cardiomyocytes in this model seems likely. The perinatal lethality in our heart-specific TrxR2 KO model precludes at present a detailed study of heart function parameters. Crossing the conditional TrxR2 KO mice with the inducible heart-specific MERCreMER mice might generate a valuable tool for studying the impact of TrxR2 deficiency on adult heart physiology (32).

A first indication that selenium is essential for heart function came from patients suffering from Keshan disease, a selenium deficiency disease endemic in China. Severely selenium-depleted humans show dilated congestive cardiomyopathy resembling the histopathologic phenotype of Friedreich's cardiomyopathy (28) and the phenotype observed in the TrxR2^{TrxR2–/–minus;/TrxR2–/–minus;} mice. It is plausible that TrxR2 is the most likely candidate whose function is impaired in Keshan disease due to selenium deficiency. Whether functional impairment of other selenoproteins also contributes to the pathophysiology of this disease remains an open question. It is also noteworthy that TrxR2 is localized to chromosome 22q11, a region deleted in the human haploinsufficiency velo-cardio-facial/DiGeorge Syndrome (VCS/DGS) (13, 19, 20). Hallmarks of VCS/DGS have not been noticed in hemizygous/homozygous or in cardiac tissue-restricted TrxR2 KO mice (data not shown). Further studies will address the question whether loss of one TrxR2 allele may contribute to the compound VCS/DGS phenotype.

	ACKNOWLEDGMENTS

 
We are grateful to C. Neumüller and J. Plitzko for help with the heart ultrastructure analysis, A. Geishauser and M. Semisch for excellent technical work, and the personnel of the animal facility and blastocyst injection unit at GSF for excellent assistance and support.

This study was supported by the DFG-Priority Programme SPP1087, by Fonds der Chemischen Industrie, and a fellowship from the Humboldt-Stiftung to S.G.M.; by the DFG Priority Programme 1069 "Angiogenesis" (HA 2983/1-2) and the German Human Genome Project (DHGP 9907) to A.K.H.; and by the BMBF to W.W.

	FOOTNOTES

 
* Corresponding author. Mailing address: Institute of Clinical Molecular Biology and Tumour Genetics, GSF Research Centre for Environment and Health, Marchioninistr. 25, D-81377 Munich, Germany. Phone: 49-89-7099525. Fax: 49-89-7099500. E-mail: marcus.conrad{at}gsf.de.

M.C., C.J., G.W.B., and M.B. contributed equally to this study.

	REFERENCES

Top Abstract Introduction Materials and Methods Results Discussion References

 
1. Arner, E. S., and A. Holmgren. 2000. Physiological functions of thioredoxin and thioredoxin reductase. Eur. J. Biochem. 267:6102-6109.[Medline]

2. Chen, C. S., and K. R. Gee. 2000. Redox-dependent trafficking of 2,3,4,5,6-pentafluorodihydrotetramethylrosamine, a novel fluorogenic indicator of cellular oxidative activity. Free Radic. Biol. Med. 28:1266-1278.[CrossRef][Medline]

3. Chen, J., S. W. Kubalak, and K. R. Chien. 1998. Ventricular muscle-restricted targeting of the RXR gene reveals a non-cell-autonomous requirement in cardiac chamber morphogenesis. Development 125:1943-1949.[Abstract]

4. Conrad, M., M. Brielmeier, W. Wurst, and G. W. Bornkamm. 2003. Optimized vector for conditional gene targeting in mouse embryonic stem cells. BioTechniques 34:1136-1140.[Medline]

5. Dyson, E., H. M. Sucov, S. W. Kubalak, G. W. Schmid-Schonbein, F. A. DeLano, R. M. Evans, J. Ross, Jr., and K. R. Chien. 1995. Atrial-like phenotype is associated with embryonic ventricular failure in retinoid X receptor alpha^–/– mice. Proc. Natl. Acad. Sci. USA 92:7386-7390.[Abstract/Free Full Text]

6. Dzierzak, E., and A. Medvinsky. 1995. Mouse embryonic hematopoiesis. Trends Genet. 11:359-366.[CrossRef][Medline]

7. Gasdaska, P. Y., M. M. Berggren, M. J. Berry, and G. Powis. 1999. Cloning, sequencing and functional expression of a novel human thioredoxin reductase. FEBS Lett. 442:105-111.[CrossRef][Medline]

8. Gasdaska, P. Y., J. R. Gasdaska, S. Cochran, and G. Powis. 1995. Cloning and sequencing of a human thioredoxin reductase. FEBS Lett. 373:5-9.[CrossRef][Medline]

9. Gorlatov, S. N., and T. C. Stadtman. 1998. Human thioredoxin reductase from HeLa cells: selective alkylation of selenocysteine in the protein inhibits enzyme activity and reduction with NADPH influences affinity to heparin. Proc. Natl. Acad. Sci. USA 95:8520-8525.[Abstract/Free Full Text]

10. Hirota, H., J. Chen, U. A. Betz, K. Rajewsky, Y. Gu, J. Ross, Jr., W. Muller, and K. R. Chien. 1999. Loss of a gp130 cardiac muscle cell survival pathway is a critical event in the onset of heart failure during biomechanical stress. Cell 97:189-198.[CrossRef][Medline]

11. Hogan, B., R. Beddington, F. Costantini, and E. Lacy. 1994. Manipulating the mouse embryo: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

12. Hughes, S. E. 2003. Detection of apoptosis using in situ markers for DNA strand breaks in the failing human heart: fact or epiphenomenon? J. Pathol. 201:181-186.[CrossRef][Medline]

13. Jerome, L. A., and V. E. Papaioannou. 2001. DiGeorge syndrome phenotype in mice mutant for the T-box gene, Tbx1. Nat. Genet. 27:286-291.[CrossRef][Medline]

14. Joyner, A. L. 2000. Gene targeting: a practical approach, 2nd ed. Oxford University Press, New York, N.Y.

15. Kim, M. R., H. S. Chang, B. H. Kim, S. Kim, S. H. Baek, J. H. Kim, S. R. Lee, and J. R. Kim. 2003. Involvements of mitochondrial thioredoxin reductase (TrxR2) in cell proliferation. Biochem. Biophys. Res. Commun. 304:119-124.[CrossRef][Medline]

16. Kryukov, G. V., S. Castellano, S. V. Novoselov, A. V. Lobanov, O. Zehtab, R. Guigo, and V. N. Gladyshev. 2003. Characterization of mammalian selenoproteomes. Science 300:1439-1443.[Abstract/Free Full Text]

17. Lee, S. R., S. Bar-Noy, J. Kwon, R. L. Levine, T. C. Stadtman, and S. G. Rhee. 2000. Mammalian thioredoxin reductase: oxidation of the C-terminal cysteine/selenocysteine active site forms a thioselenide, and replacement of selenium with sulfur markedly reduces catalytic activity. Proc. Natl. Acad. Sci. USA 97:2521-2526.[Abstract/Free Full Text]

18. Li, Z., O. H. Bing, X. Long, K. G. Robinson, and E. G. Lakatta. 1997. Increased cardiomyocyte apoptosis during the transition to heart failure in the spontaneously hypertensive rat. Am. J. Physiol. 272:H2313-H2319.

19. Lindsay, E. A., F. Vitelli, H. Su, M. Morishima, T. Huynh, T. Pramparo, V. Jurecic, G. Ogunrinu, H. F. Sutherland, P. J. Scambler, A. Bradley, and A. Baldini. 2001. Tbx1 haploinsufficiency in the DiGeorge syndrome region causes aortic arch defects in mice. Nature 410:97-101.[CrossRef][Medline]

20. Merscher, S., B. Funke, J. A. Epstein, J. Heyer, A. Puech, M. M. Lu, R. J. Xavier, M. B. Demay, R. G. Russell, S. Factor, K. Tokooya, B. S. Jore, M. Lopez, R. K. Pandita, M. Lia, D. Carrion, H. Xu, H. Schorle, J. B. Kobler, P. Scambler, A. Wynshaw-Boris, A. I. Skoultchi, B. E. Morrow, and R. Kucherlapati. 2001. TBX1 is responsible for cardiovascular defects in velo-cardio-facial/DiGeorge syndrome. Cell 104:619-629.[CrossRef][Medline]

21. Miranda-Vizuete, A., A. E. Damdimopoulos, and G. Spyrou. 1999. cDNA cloning, expression, and chromosomal localization of the mouse mitochondrial thioredoxin reductase gene. Biochim. Biophys. Acta 1447:113-118.[Medline]

22. Miranda-Vizuete, A., and G. Spyrou. 2002. Genomic organization and identification of a novel alternative splicing variant of mouse mitochondrial thioredoxin reductase (TrxR2) gene. Mol. Cells 13:488-492.[Medline]

23. Mustacich, D., and G. Powis. 2000. Thioredoxin reductase. Biochem. J. 346(Pt. 1):1-8.

24. Narula, J., P. Pandey, E. Arbustini, N. Haider, N. Narula, F. D. Kolodgie, B. Dal Bello, M. J. Semigran, A. Bielsa-Masdeu, G. W. Dec, S. Israels, M. Ballester, R. Virmani, S. Saxena, and S. Kharbanda. 1999. Apoptosis in heart failure: release of cytochrome c from mitochondria and activation of caspase-3 in human cardiomyopathy. Proc. Natl. Acad. Sci. USA 96:8144-8149.[Abstract/Free Full Text]

25. Neumann, C. A., D. S. Krause, C. V. Carman, S. Das, D. P. Dubey, J. L. Abraham, R. T. Bronson, Y. Fujiwara, S. H. Orkin, and R. A. Van Etten. 2003. Essential role for the peroxiredoxin Prdx1 in erythrocyte antioxidant defense and tumour suppression. Nature 424:561-565.[CrossRef][Medline]

26. Nonn, L., R. R. Williams, R. P. Erickson, and G. Powis. 2003. The absence of mitochondrial thioredoxin 2 causes massive apoptosis, exencephaly, and early embryonic lethality in homozygous mice. Mol. Cell. Biol. 23:916-922.[Abstract/Free Full Text]

27. Nordberg, J., and E. S. Arner. 2001. Reactive oxygen species, antioxidants, and the mammalian thioredoxin system. Free Radic. Biol. Med. 31:1287-1312.[CrossRef][Medline]

28. Puccio, H., D. Simon, M. Cossee, P. Criqui-Filipe, F. Tiziano, J. Melki, C. Hindelang, R. Matyas, P. Rustin, and M. Koenig. 2001. Mouse models for Friedreich ataxia exhibit cardiomyopathy, sensory nerve defect and Fe-S enzyme deficiency followed by intramitochondrial iron deposits. Nat. Genet. 27:181-186.[CrossRef][Medline]

29. Schaft, J., R. Ashery-Padan, F. van der Hoeven, P. Gruss, and A. F. Stewart. 2001. Efficient FLP recombination in mouse ES cells and oocytes. Genesis 31:6-10.[CrossRef][Medline]

30. Schroeder, T., S. T. Fraser, M. Ogawa, S. Nishikawa, C. Oka, G. W. Bornkamm, T. Honjo, and U. Just. 2003. Recombination signal sequence-binding protein J alters mesodermal cell fate decisions by suppressing cardiomyogenesis. Proc. Natl. Acad. Sci. USA 100:4018-4023.[Abstract/Free Full Text]

31. Schwenk, F., U. Baron, and K. Rajewsky. 1995. A cre-transgenic mouse strain for the ubiquitous deletion of loxP-flanked gene segments including deletion in germ cells. Nucleic Acids Res. 23:5080-5081.[Free Full Text]

32. Sohal, D. S., M. Nghiem, M. A. Crackower, S. A. Witt, T. R. Kimball, K. M. Tymitz, J. M. Penninger, and J. D. Molkentin. 2001. Temporally regulated and tissue-specific gene manipulations in the adult and embryonic heart using a tamoxifen-inducible Cre protein. Circ. Res. 89:20-25.[Abstract/Free Full Text]

33. Sun, Q. A., L. Kirnarsky, S. Sherman, and V. N. Gladyshev. 2001. Selenoprotein oxidoreductase with specificity for thioredoxin and glutathione systems. Proc. Natl. Acad. Sci. USA 98:3673-3678.[Abstract/Free Full Text]

34. Sun, Q. A., F. Zappacosta, V. M. Factor, P. J. Wirth, D. L. Hatfield, and V. N. Gladyshev. 2001. Heterogeneity within animal thioredoxin reductases: evidence for alternative first exon splicing. J. Biol. Chem. 276:3106-3114.[Abstract/Free Full Text]

35. Suppmann, S., B. C. Persson, and A. Bock. 1999. Dynamics and efficiency in vivo of UGA-directed selenocysteine insertion at the ribosome. EMBO J. 18:2284-2293.[CrossRef][Medline]

36. Tanaka, H., I. Matsumura, S. Ezoe, Y. Satoh, T. Sakamaki, C. Albanese, T. Machii, R. G. Pestell, and Y. Kanakura. 2002. E2F1 and c-Myc potentiate apoptosis through inhibition of NF-B activity that facilitates MnSOD-mediated ROS elimination. Mol. Cell 9:1017-1029.[CrossRef][Medline]

37. Tanaka, T., F. Hosoi, Y. Yamaguchi-Iwai, H. Nakamura, H. Masutani, S. Ueda, A. Nishiyama, S. Takeda, H. Wada, G. Spyrou, and J. Yodoi. 2002. Thioredoxin-2 (TRX-2) is an essential gene regulating mitochondrion-dependent apoptosis. EMBO J. 21:1695-1703.[CrossRef][Medline]

38. Wettschureck, N., H. Rutten, A. Zywietz, D. Gehring, T. M. Wilkie, J. Chen, K. R. Chien, and S. Offermanns. 2001. Absence of pressure overload induced myocardial hypertrophy after conditional inactivation of Gq/G11 in cardiomyocytes. Nat. Med. 7:1236-1240.[CrossRef][Medline]

39. Yamamoto, M., G. Yang, C. Hong, J. Liu, E. Holle, X. Yu, T. Wagner, S. F. Vatner, and J. Sadoshima. 2003. Inhibition of endogenous thioredoxin in the heart increases oxidative stress and cardiac hypertrophy. J. Clin. Investig. 112:1395-1406.[CrossRef][Medline]

40. Yoshida, K., T. Taga, M. Saito, S. Suematsu, A. Kumanogoh, T. Tanaka, H. Fujiwara, M. Hirata, T. Yamagami, T. Nakahata, T. Hirabayashi, Y. Yoneda, K. Tanaka, W. Z. Wang, C. Mori, K. Shiota, N. Yoshida, and T. Kishimoto. 1996. Targeted disruption of gp130, a common signal transducer for the interleukin 6 family of cytokines, leads to myocardial and hematological disorders. Proc. Natl. Acad. Sci. USA 93:407-411.[Abstract/Free Full Text]

41. Zhong, L., and A. Holmgren. 2000. Essential role of selenium in the catalytic activities of mammalian thioredoxin reductase revealed by characterization of recombinant enzymes with selenocysteine mutations. J. Biol. Chem. 275:18121-18128.[Abstract/Free Full Text]

This article has been cited by other articles:

• Chew, E.-H., Lu, J., Bradshaw, T. D., Holmgren, A. (2008). Thioredoxin reductase inhibition by antitumor quinols: a quinol pharmacophore effect correlating to antiproliferative activity. FASEB J. 22: 2072-2083 [Abstract] [Full Text]  
• Carlson, B. A., Moustafa, M. E., Sengupta, A., Schweizer, U., Shrimali, R., Rao, M., Zhong, N., Wang, S., Feigenbaum, L., Lee, B. J., Gladyshev, V. N., Hatfield, D. L. (2007). Selective Restoration of the Selenoprotein Population in a Mouse Hepatocyte Selenoproteinless Background with Different Mutant Selenocysteine tRNAs Lacking Um34. J. Biol. Chem. 282: 32591-32602 [Abstract] [Full Text]  
• Aichler, M., Algul, H., Behne, D., Holzlwimmer, G., Michalke, B., Quintanilla-Martinez, L., Schmidt, J., Schmid, R. M., Brielmeier, M. (2007). Selenium status alters tumour differentiation but not incidence or latency of pancreatic adenocarcinomas in Ela-TGF-{alpha} p53+/ mice. Carcinogenesis 28: 2002-2007 [Abstract] [Full Text]  
• Kobayashi-Miura, M., Shioji, K., Hoshino, Y., Masutani, H., Nakamura, H., Yodoi, J. (2007). Oxygen sensing and redox signaling: the role of thioredoxin in embryonic development and cardiac diseases. Am. J. Physiol. Heart Circ. Physiol. 292: H2040-H2050 [Abstract] [Full Text]  
• Berndt, C., Lillig, C. H., Holmgren, A. (2007). Thiol-based mechanisms of the thioredoxin and glutaredoxin systems: implications for diseases in the cardiovascular system. Am. J. Physiol. Heart Circ. Physiol. 292: H1227-H1236 [Abstract] [Full Text]  
• Moghadaszadeh, B., Beggs, A. H. (2006). Selenoproteins and Their Impact on Human Health Through Diverse Physiological Pathways.. Physiology 21: 307-315 [Abstract] [Full Text]  
• Rohrbach, S., Gruenler, S., Teschner, M., Holtz, J. (2006). The thioredoxin system in aging muscle: key role of mitochondrial thioredoxin reductase in the protective effects of caloric restriction?. Am. J. Physiol. Regul. Integr. Comp. Physiol. 291: R927-R935 [Abstract] [Full Text]  
• Borniquel, S., Valle, I., Cadenas, S., Lamas, S., Monsalve, M. (2006). Nitric oxide regulates mitochondrial oxidative stress protection via the transcriptional coactivator PGC-1{alpha}. FASEB J. 20: 1889-1891 [Abstract] [Full Text]  
• Turanov, A. A., Su, D., Gladyshev, V. N. (2006). Characterization of Alternative Cytosolic Forms and Cellular Targets of Mouse Mitochondrial Thioredoxin Reductase. J. Biol. Chem. 281: 22953-22963 [Abstract] [Full Text]  
• Yoo, M.-H., Xu, X.-M., Carlson, B. A., Gladyshev, V. N., Hatfield, D. L. (2006). Thioredoxin Reductase 1 Deficiency Reverses Tumor Phenotype and Tumorigenicity of Lung Carcinoma Cells. J. Biol. Chem. 281: 13005-13008 [Abstract] [Full Text]  
• Wang, D., Masutani, H., Oka, S.-i., Tanaka, T., Yamaguchi-Iwai, Y., Nakamura, H., Yodoi, J. (2006). Control of Mitochondrial Outer Membrane Permeabilization and Bcl-xL Levels by Thioredoxin 2 in DT40 Cells. J. Biol. Chem. 281: 7384-7391 [Abstract] [Full Text]  
• Cenas, N., Prast, S., Nivinskas, H., Sarlauskas, J., Arner, E. S. J. (2006). Interactions of Nitroaromatic Compounds with the Mammalian Selenoprotein Thioredoxin Reductase and the Relation to Induction of Apoptosis in Human Cancer Cells. J. Biol. Chem. 281: 5593-5603 [Abstract] [Full Text]  
• Kohrle, J., Jakob, F., Contempre, B., Dumont, J. E. (2005). Selenium, the Thyroid, and the Endocrine System. Endocr. Rev. 26: 944-984 [Abstract] [Full Text]  
• Biterova, E. I., Turanov, A. A., Gladyshev, V. N., Barycki, J. J. (2005). Crystal structures of oxidized and reduced mitochondrial thioredoxin reductase provide molecular details of the reaction mechanism. Proc. Natl. Acad. Sci. USA 102: 15018-15023 [Abstract] [Full Text]  
• Conrad, M., Moreno, S. G., Sinowatz, F., Ursini, F., Kolle, S., Roveri, A., Brielmeier, M., Wurst, W., Maiorino, M., Bornkamm, G. W. (2005). The Nuclear Form of Phospholipid Hydroperoxide Glutathione Peroxidase Is a Protein Thiol Peroxidase Contributing to Sperm Chromatin Stability. Mol. Cell. Biol. 25: 7637-7644 [Abstract] [Full Text]  
• Su, D., Novoselov, S. V., Sun, Q.-A., Moustafa, M. E., Zhou, Y., Oko, R., Hatfield, D. L., Gladyshev, V. N. (2005). Mammalian Selenoprotein Thioredoxin-glutathione Reductase: ROLES IN DISULFIDE BOND FORMATION AND SPERM MATURATION. J. Biol. Chem. 280: 26491-26498 [Abstract] [Full Text]  
• Fang, J., Lu, J., Holmgren, A. (2005). Thioredoxin Reductase Is Irreversibly Modified by Curcumin: A NOVEL MOLECULAR MECHANISM FOR ITS ANTICANCER ACTIVITY. J. Biol. Chem. 280: 25284-25290 [Abstract] [Full Text]  
• Jakupoglu, C., Przemeck, G. K. H., Schneider, M., Moreno, S. G., Mayr, N., Hatzopoulos, A. K., de Angelis, M. H., Wurst, W., Bornkamm, G. W., Brielmeier, M., Conrad, M. (2005). Cytoplasmic Thioredoxin Reductase Is Essential for Embryogenesis but Dispensable for Cardiac Development. Mol. Cell. Biol. 25: 1980-1988 [Abstract] [Full Text]  
• Carlson, B. A., Xu, X.-M., Gladyshev, V. N., Hatfield, D. L. (2005). Selective Rescue of Selenoprotein Expression in Mice Lacking a Highly Specialized Methyl Group in Selenocysteine tRNA. J. Biol. Chem. 280: 5542-5548 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Conrad, M. Articles by Brielmeier, M. Search for Related Content PubMed PubMed Citation Articles by Conrad, M. Articles by Brielmeier, M.