Department of Neurobiology, Pharmacology, and Physiology,1 Committee on Neurobiology, The University of Chicago, Chicago, Illinois,4 Genomics Institute of the Novartis Research Foundation, San Diego, California,2 Neuroscience Research Program, Ottawa Health Research Institute, University of Ottawa, Ottawa, Ontario, Canada3
Received 17 March 2004/ Returned for modification 20 April 2004/ Accepted 10 August 2004
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
and ß), PERK, and ATF6function as proximal stress sensors and share a common pathway of activation (38). The lumenal stress-sensing domain of each of these proteins is normally bound to BiP/GRP78 (an ER protein chaperone), which keeps them in an inactive form. BiP/GRP78 dissociates from IRE, PERK, and ATF6 when the levels of unfolded proteins exceed a certain threshold under conditions of ER stress. Release from BiP/GRP78 leads to oligomerization, transautophosphorylation, and activation of IRE1 and PERK, whereas ATF6 translocates to the Golgi apparatus (38, 55, 62). IRE1 is a type I membrane protein with cytoplasmic serine/threonine kinase and endoribonuclease domains. The endoribonuclease activity of activated IRE1 splices a small intron from the XBP-1 mRNA, allowing the synthesis and accumulation of a larger XBP-1 protein, which functions as a transcription factor (4, 56, 69). PERK is a serine/threonine kinase that, when activated, phosphorylates eukaryotic translation initiation factor 2
(eIF2
), causing transient translational attenuation in an attempt to alleviate ER overload (16). The transmembrane ATF6 undergoes proteolytic processing upon reaching the Golgi, and the released cytoplasmic transcription factor domain translocates to the nucleus, where it activates transcription of a set of genes, including XBP-1 (19, 34, 69). Accumulation of phosphorylated eIF2
allows for enhanced translation of the transcription factor ATF4, which has an important role in activating a transcriptional cascade involving transcription factors ATF3 and CHOP (15, 17, 27). Expression profiling has identified several classes of UPR-related genes in yeast and mammals, which coordinate protein folding and maturation, secretory trafficking, amino acid metabolism, protein translation, mitochondrial function, ER-associated degradation of misfolded proteins, etc. (5, 47, 60). Thus, in concert with translational attenuation, UPR induces the expression of genes that function specifically in mitigating ER stress and enhancing cell survival. Nevertheless, cells subjected to ER stress also upregulate the expression of the proapoptotic transcription factor CHOP, stimulate proapoptotic JNK signaling pathway, and activate caspase-12 (45, 46, 62). Thus, apoptosis ensues if the burden of misfolded protein accumulation cannot be relieved by the UPR.
UPR is activated in cultured cells by exposure to xenotoxic agents that affect ER homeostasis, such as tunicamycin, thapsigargin, Ca2+ ionophores, and reducing agents. However, it is becoming clear that certain cells and tissue specialized in protein secretion upregulate aspects of the UPR under physiological conditions in vivo. For example, IRE1 and XBP-1 are activated during the terminal differentiation of B cells to antibody-secreting plasma cells (51). Another example is the case of insulin-producing cells of the islets of Langerhans in pancreas, where PERK appears to modulate protein biosynthesis under physiological conditions (14). On the other hand, mounting evidence also implicates UPR in the development of diabetes and in the pathogenesis of neurodegenerative diseases such as Alzheimer's disease, polyglutamine disease, and Parkinson's disease (11, 13, 49, 57). In addition, several studies have also shown that UPR is rapidly activated in ischemic neurons, suggesting close association between ER dysfunction and ischemic neuronal damage (25, 32, 48).
Here, we describe the gene encoding stanniocalcin 2 (STC2) as a novel target of the mammalian UPR. STC2 shares limited sequence similarity with an antihypercalcemic hormone first discovered in fish (3, 65). Fish STC is secreted by corpuscles of Stannius, a small endocrine gland found on the ventral surface of the kidney. Two widely expressed STC-related proteins, STC1 and STC2, have been identified in mammals, but their physiological functions have not been clearly elucidated (8, 9, 21, 22). As in fish, elevated Ca2+ levels induce STC1 expression and stimulate phosphate uptake in the neural crest-derived Paju cell line, suggesting functional conservation for mammalian STC1 in mineral metabolism (33, 70). Interestingly, STC1 expression is upregulated in neurons after ischemic insult in human and mouse brain, and overexpression of STC1 increased cell viability in Paju cells when exposed to thapsigargin or hypoxia (70). There has been only limited information available on STC2 expression and function. We show here that STC2 expression is induced in cultured cells by ER stress agents, hypoxia, and oxidative stress, downstream of PERK activation. In addition, rat cortical neurons rapidly upregulate STC2 expression after cerebral ischemia. Short interfering RNA (siRNA)-mediated attenuation of STC2 expression during the UPR renders mouse N2a neuroblastoma cells and HeLa cells extremely vulnerable to cell death elicited by thapsigargin, whereas overexpression of STC2 protected cells against thapsigargin-induced apoptotic cell death. Thus, STC2 carries out distinct function in mammals as a critical survival component of the UPR.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Microarray hybridization studies. Total RNA was isolated from HEK293 cells treated with tunicamycin (2 µg/ml) or thapsigargin (300 nM) for 5 or 10 h by using the TRIzol reagent (Invitrogen) and purified by using an RNeasy minikit (Qiagen). Microarray analyses were performed essentially as described by Lockhart et al. (40). HG_U95Av1 Affymetrix arrays containing oligonucleotide probes representing 11,879 human genes were used in our studies. Each sample was profiled in duplicate, with cRNA prepared separately from total RNA, and all chips were scaled to a target intensity of 200. Filters used to select UPR genes were as follows: a minimum twofold change in expression levels, a minimum mean expression value of 100 for at least one of the two groups compared, a "present" score required for at least half of the chips compared, and an "increase" or "decrease" call.
cDNAs and antibodies. Mouse STC2 cDNA was amplified by PCR with the primer pair 5'-GTCGGTACCACCATGTGTGCGGAGCGGCTG-3' and 5'-GACGGATCCTCACCTCCGGATGTCGGAATACTCAGAC-3' by using N2a cell cDNA as the template and then cloned into pBluescript. After sequence verification, the cDNA was subcloned into pGEX-4T and pAG3Zeo vectors for expression in bacteria and mammalian cells, respectively. Myc epitope-tagged IRE1ß and PERK expression plasmids were kind gifts from David Ron. ATF6 plasmid was kindly provided by Jian Ma. Polyclonal STC2 antisera were raised in rabbits against a glutathione S-transferase-mouse STC2 fusion protein expressed in bacteria. Two anti-STC2 antisera (STC260 and STC261) were characterized to be specific for STC2 by Western blotting, immunoprecipitation, and immunohistochemical analyses. Other antibodies were purchased from commercial sources as follows: anti-KDEL (Stressgen); CHOP and anti-myc 9E10 (Santa Cruz Biotechnology); ß-actin, Golgi58K protein, and AP1/AP2 (Sigma); syntaxin 6 (BD Transduction Laboratories); and cytochrome c oxidase IV (COX-IV; Molecular Probes).
Analysis of mRNA levels. Total RNA was prepared from cells subject to various stresses as described above, and 1-µg aliquots were reverse transcribed into cDNA by using random hexamers. Aliquots corresponding to 1/25 of the resulting cDNA were incubated in PCR with the following primer pairs: BiP (sense [5'-CTGGGTACATTTGATCTGACTGG-3'] and antisense [5'-GCATCCTGGTGGCTTTCCAGCCATTC-3']), CHOP (sense [5'-GTCCAGCTGGGAGCTGGAAG-3'] and antisense [5'-CTGGTCAGGCGCTCGATTTCC-3']), GADD45 (sense [5'-GAGCAGAAGACCGAAAGGATG-3'] and antisense [5'-CTTCAGTGCAATTTGGTTCAG-3']), Mif 1 (sense [5'-GTCCAGAGGACCAGAGGTTA-3'] and antisense [5'-GTATCTCTTGTGCACTTGGTG-3']), NUCB2 (sense [5'-GGAAGAGACTGATGGATTGGA-3'] and antisense [5'-CATCCTCTTCATTTTTAGGGTCA-3' for human or 5'-CACTTTCTCCAACTCTCTTGTGAA-3' for mouse]), ATP2A2 (sense [5'-ATGAGCAAGATGTTTGTGAAGG-3'] and antisense [5'-CAGTGGGTTGTCATGAGTGG-3']), human CGRP2 (sense [5'-AGCCCTGCTGACACCTAGAG-3'] and antisense [5'-CTCCAAGGCATTTACCCAAA-3']), mouse CGRP2 (sense [5'-CCGTGTGTGTGTGCTCTTCT-3'] and antisense [5'-GGTCTAGGCTGCTCTCCAAA-3']), ATF6 (sense [5'-GCCTTTATTGCTTCCAGCAG-3'] and antisense [5'-TGAGACAGCAAAACCGTCTG-3']), human STC2 (sense [5'-GGGAATGCTACCTCAAGCAC-3'] and antisense [5'-CACAGGTCAGCAGCAAGTTC-3']), mouse STC2 (sense [5'-AGGAGAACGTCGGTGTGATT-3'] and antisense [5'-CTGTTCACACTGAGCCTGGA-3']), STC1 (sense [5'-CCCAATCACTTCTCCAACAGA-3'] and antisense [5'-GAAGAGGCTGGCCATGTTAG-3'] for human or 5'-GAAGAGGCTGGCCATGTTG-3' for mouse), and ß-actin (sense [5'-GGCTACAGCTTCACCACCAC-3'] and antisense 5'-GTCAGGCAGCTCGTAGCTCT-3' for human or 5'-TCTCCAGGGAGGAAGAGGAT-3' for mouse). For the negative control, reverse transcription-PCR (RT-PCR) was performed in the absence of reverse transcriptase. The PCR products were separated by electrophoresis through 5 or 8% polyacrylamide gels, stained with ethidium bromide, and visualized by using Typhoon 8600 variable mode imager (Amersham Biosciences). The validity of ß-actin as an internal control gene was confirmed by no significant changes in its expression under our experimental conditions. For quantitative analysis of mRNA levels, amplification and detection of STC2 and ß-actin mRNA were performed in the same reaction with the iCycle iQ Multi-Color Real Time PCR detection system (Bio-Rad) with specific primers (above) and the following fluorescent oligonucleotides (Integrated DNA Technologies): STC2 (5'-/FAM/TTCAAGGATCTCCTGCTGC/BHQ-1/-3' for mouse and 5'-/FAM/CAGAGACAGCCTGATGGAGA/BHQ-1/-3' for human) and ß-actin (5'-/HEX/GGAAATCGTGCGTGACAT/BHQ-1/-3'). STC2 signals were normalized to ß-actin signals. RNA was isolated from three independent experiments, assayed by real-time quantitative PCR, and results are expressed as means ± the standard errors (SE). Statistically significant differences compared to basal levels were determined by one-way analysis of variance with Fisher protected least-squares difference test by using Statview 5.0 software.
Protein analysis and subcellular fractionation. Cells were lysed in lysis buffer containing 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 0.5% NP-40, 0.5% sodium deoxycholate, 0.25% sodium dodecyl sulfate, 5 mM EDTA, and a mixture of protease inhibitors (Sigma). Lysates were briefly sonicated and fractionated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. To immunoprecipitate secreted STC2, aliquots of conditioned medium were incubated overnight with STC2 antiserum, followed by binding to protein A-agarose beads (Pierce). For subcellular fractionation, cell pellet from two 100-mm dishes were homogenized in 0.5 ml of ice-cold sucrose buffer (0.25 M Sucrose, 10 mM Tris-HCl [pH 7.4], 1 mM magnesium acetate, and a mixture of protease inhibitors) by 10 passages through a prechilled ball bearing homogenizer with 16-µm clearance. Homogenates were centrifuged at 800 x g for 10 min at 4°C, and postnuclear supernatants were loaded on sucrose step gradients consisted of (from top to bottom) 0.25 M (1 ml), 0.5 M (2 ml), 0.8 M (2 ml), 1.16 M (2.5 ml), 1.3 M (2.5 ml), and 2 M (1.5 ml) sucrose in 10 mM Tris-HCl (pH 7.4)-1 mM magnesium acetate. The gradients were centrifuged at 39,000 rpm for 2.5 h at 4°C in an SW41Ti rotor (Beckman Instruments), and 1-ml fractions were collected from the top by using an Autodensiflow fractionator (Labconco). Aliquots of each fraction (60 µl) were analyzed by Western blotting with STC2, anti-KDEL, and syntaxin 6 antibodies.
Mitochondria were isolated by using a differential centrifugation method (58). Cells from one 100-mm dish were incubated for 5 min in 700 µl of ice-cold hypotonic buffer (10 mM NaCl, 1.5 mM MgCl2, 10 mM Tris-HCl [pH 7.4]) and lysed by 10 passes through a prechilled ball bearing homogenizer with 12-µm clearance. Then, 233 µl of 4x mannitol-sucrose buffer (840 mM mannitol, 280 mM sucrose, 20 mM Tris-HCl [pH 7.4], 4 mM EDTA) was added, and the lysates were spun at 830 x g for 10 min at 4°C to remove nuclei. Supernatants were then briefly sonicated (30 s at 2 W by using GE130 Ultrasonic Processor with a microtip) to disperse large membrane fragments, and mitochondria were sedimented by centrifugation at 10,000 x g for 20 min at 4°C. Aliquots of each fraction (60 µl) were analyzed by Western blotting with STC2, anti-KDEL, and COX-IV antibodies.
Immunofluorescence labeling. COS cells grown on coated coverslips were transfected with pAG3Zeo-STC2 plasmid. At 48 h after transfection, cells were fixed in 4% paraformaldehyde at room temperature for 10 min and then permeabilized in 0.2% Triton X-100 for 5 min. After nonspecific binding was blocked, coverslips were incubated with polyclonal STC2 antiserum (1:500) and monoclonal organelle marker antibodies diluted in phosphate-buffered saline (PBS) containing 0.2% Tween 20 and 3% bovine serum albumin (anti-KDEL, 1:250; Golgi58K, 1:1,000; AP-1/AP-2, 1:200). To label mitochondria, cells were incubated with 50 nM Mitotracker red (Molecular Probes) for 30 min before fixing. After three washes, coverslips were incubated with fluorescein isothiocyanate-conjugated anti-rabbit and Cy3-conjugated anti-mouse secondary antibodies and then mounted. Immunofluorescence staining was examined by confocal microscopy (LSM 5 Pascal; Carl Zeiss) by using a x63 oil immersion objective lens, and images were processed by using Metamorph software (Universal Imaging Corp.).
MCA occlusion studies. All animal procedures were done according to the guidelines of the National Institutes of Health Guide for the Care and Use of Laboratory Animals and the guidelines endorsed by the Canadian Council for Animal Care. Middle cerebral artery (MCA) occlusion was induced by using the intraluminal filament technique (24, 41) as modified below. Adult male Sprague-Dawley rats were anesthetized in a chamber by using 5% isoflurane in 30% oxygen-70% nitrous oxide. A surgical depth of anesthesia was maintained throughout the operation, with 2.5% isoflurane delivered through a nose mask. Under the operating microscope, the left common carotid artery (CCA) was exposed through a midline cervical incision and gently separated from the adjacent nerves. Microvascular clips were placed around the left CCA, the external carotid artery, and the internal carotid artery (ICA) to prevent bleeding during the insertion of the filament. A heat-blunted nylon filament (0.45-mm rounded tip) was inserted into the ICA lumen through a puncture made in the CCA and was advanced 1.8 to 2.1 cm, or until resistance was felt, to occlude the blood flow to the MCA territory. The filament was held in place by tightening the suture around the CCA. Body temperature was monitored and maintained at 37°C by using a heating pad connected to a rectal probe (Harvard Homeothermic blanket control unit). After 90 or 120 min of MCA occlusion, the filament was removed, the CCA was permanently ligated with a 3-0 silk suture, and the neck incision was closed with a 5-0 silk suture. Supplementary 0.9% NaCl solution was administered to the animals, along with rectal Tylenol. The animals were given free access to food and water between procedures and allowed to survive for 3.5, 6, 12, 24, or 48 h (n = at least 4 for each time point). At the end of the recirculation period, the rats were fixed by perfusion with PBS containing 4% paraformaldehyde. The brains were subsequently removed, and immunohistochemistry was performed on 16-µm sections essentially as described previously (23-25) with anti-STC2 antisera or the respective preimmune serum (1:1,000). For mRNA analysis, ischemic and contralateral brain tissue were dissected, and total RNA was isolated by using the acid guanidinium thiocyanate-chloroform-phenol extraction technique as previously described (25). RT-PCRs were performed as described above.
siRNA inhibition, STC2 overexpression, and cell viability assays. To suppress STC2 expression in N2a cells, complementary oligonucleotides corresponding to nucleotides 153 to 171 (GGAGATCCAGCACTGTTTG) of mouse STC2 cDNA separated by a nine-nucleotide noncomplementary spacer (TTCAAGAGA) were synthesized and cloned into pSUPER plasmid (2). N2a cells were cotransfected with 1.5 µg of pSUPER or pSUPER-STC2 plasmids, along with 0.5 µg of pEYFP-C1 (Clontech). After 48 h, cells were treated or not treated with thapsigargin (150 nM), tunicamycin (2 µg/ml), H2O2 (100 µM), or STS (250 nM) for 16 h, and stained with ethidium homodimer 1 (EthD-1) (Molecular Probes). Fluorescent images of three random fields were acquired by using Zeiss Axioplan2 inverted microscope with a x2.5 objective lens, and yellow fluorescent protein (YFP)-positive EthD-1-negative live cells were counted by using MetaMorph software. The data from four independent experiments were statistically examined by paired Student t test expressed as means ± the SE.
Synthetic siRNA duplexes containing the sequences 5'-CAGCGGAGAUCCAGCACUGdTdT-3' (sense) and 5'-CAGUGCUGGAUCUCCGCUGdTdT-3' (antisense) (Dharmacon) were used to suppress STC2 expression in HeLa cells. Mismatch STC2 siRNA (6 bp changes in the STC2 siRNA), with no significant sequence homology to mammalian genes by NCBI BLAST search, was used as the control in these experiments (mismatch STC2 siRNA: 5'-CUGCAGAGCUCGACCACUCdTdT-3', sense; 5'-GAGUGGUCGAGCUCUGCAGdTdT-3', antisense). HeLa cells were transfected in 12-well plates with 0.1 nmol of each siRNA by using Oligofectamine (Invitrogen). After 24 h, cells were treated or not treated with thapsigargin (500 nM) or tunicamycin (2 µg/ml) for 40 h. In some experiments, cells were treated with STS (250 nM) for 9 h. After treatment, cells were stained with 1.5 µg of Hoechst 33342 (Molecular Probes)/ml and a 1:40 dilution of Annexin-V-Alexa 568 (Molecular Probes). Fluorescent images of three random fields per coverslip were acquired on Zeiss Axioplan2 microscope with a x5 objective lens, and morphologically distinct apoptotic cells with condensed nuclei or Annexin-V positive cells were counted by using MetaMorph software. The data from three independent experiments were statistically examined by paired t test and are expressed as means ± the SE. For overexpression studies, HeLa cells were transfected in 12-well plates with 0.6 µg of STC2 expression plasmid by using Lipofectamine (Invitrogen). After 24 h, cells were treated or not treated with thapsigargin (500 nM) or tunicamycin (2 µg/ml) for 40 h and then stained with Hoechst 33342 and Annexin-V-Alexa 568, and apoptotic cell death was estimated as described above.
| RESULTS |
|---|
|
|
|---|
|
|
|
|
|
|
, and the UPR (30), also induced expression of STC2 mRNA (Fig. 6). In contrast, we observed no change or reduction in STC2 mRNA levels in cells subject to diverse stress treatments with no association to the UPR, including high extracellular Ca2+ (5.4 mM), high osmolarity (0.3 M NaCl), short-wavelength UV light exposure (40 J/m2), apoptosis-inducible agent, staurosporine (500 nM), and heat shock (42°C, 1 h) (Fig. 6A). Interestingly, unlike STC2, STC1 expression was selectively induced by exposure of cells to hypoxia and not by other treatments that successfully induced the UPR or by unrelated stress conditions (Fig. 6A). Collectively, these results suggest that upregulation of STC2 expression is tightly associated with the induction of the UPR, whereas STC1 expression is limited to hypoxia.
|
|
and facilitates enhanced translation of the transcription factor ATF4 (15, 17, 27). To determine whether activation of PERK alters STC2 expression via ATF4, we performed a set of experiments in ATF4/ fibroblasts. Exposure of ATF4/ fibroblasts to tunicamycin or thapsigargin fails to upregulate STC2 expression, providing a mechanistic insight into STC2 expression by ER stress downstream of PERK activation (Fig. 7B). To further confirm these findings, we examined STC2 expression in cells lacking the active transcription factors XBP-1 and ATF6. We found that XBP-1/ and wild-type control fibroblasts upregulate STC2 expression to comparable levels upon ER stress (Fig. 7B). Next, we tested the requirement for ATF6 in STC2 induction by using M19 mutant CHO cells, which fail to process ATF6 due to a deficiency in Site-2 protease (34, 68). M19 cells induce STC2 expression after ER stress to levels similar to that of parental CHO cells, whereas as reported previously, we observe attenuated induction of BiP expression in M19 cells (Fig. 7C). These results are in agreement with a major role for ATF4 in STC2 upregulation during the UPR independent of XBP-1 and ATF6. Since STC1 expression is not associated with the UPR, we reasoned it is highly unlikely that PERK-ATF4 pathway contributes to STC1 induction during hypoxia. Consistent with this notion, STC1 expression was upregulated by hypoxia in PERK/ and ATF4/ fibroblasts (Fig. 7B). Similarly, XBP-1 expression was also not required for hypoxia-mediated induction of STC1 expression.
STC2 expression in ischemic rat brain. For in vivo analysis of induced STC2 expression we chose to focus on the rat MCA occlusion model because it is known that PERK is activated in the brain after transient cerebral ischemia (31, 32). RT-PCR analysis of cortex excised from the ischemic side shows marked induction of STC2 expression in ischemic cortex after 3.5 to 24 h of reperfusion after 90 min of MCA occlusion (Fig. 8B). Expression of STC2 was extremely low in the contralateral cortex or sham-operated animals. Consistent with a previous report (70) STC1 mRNA is also detectable at higher levels in the ischemic cortex compared to contralateral cortex.
|
STC2 contributes to cell survival during thapsigargin- and H2O2-induced stress.
As mentioned above, PERK is one of the most proximal ER stress sensors that is activated by accumulation of misfolded proteins within the ER. Upon activation, PERK rapidly phosphorylates eIF2
and causes translational arrest, which is a protective measure as it attenuates ER overload. However, the accumulation of phosphorylated eIF2
leads to selective translation of ATF4, a transcription factor that upregulates the expression of ER chaperones, XBP-1, and also the proapoptotic transcription factor CHOP. Thus, PERK activation regulates both prosurvival and proapoptotic signaling during ER stress (12, 38). Since STC2 upregulation was mediated by PERK/ATF4 pathway, we sought to determine whether STC2 contributes to cytoprotection or facilitates apoptotic signaling. To address this issue, we decided to attenuate STC2 expression by using siRNA strategy (2) and assess the extent of stress-induced cell death in neuronal cells. In these experiments, mouse N2a neuroblastoma cells were transfected with pSUPER vector or pSUPER STC2 siRNA plasmid, along with small amounts of a plasmid encoding YFP. After cells were exposed to ER and oxidative stresses, we stained the cells with EthD-1 (dead cells stain red); YFP-positive EthD-negative cells were counted as surviving cells. In parallel, we performed Western blots to monitor the efficiency of siRNA inhibition of STC2 upregulation. Transient transfection of STC2 siRNA plasmid effectively attenuated induced expression of STC2 after treatment with thapsigargin. Expression of STC2 siRNA did not affect upregulation of BiP in cells exposed to thapsigargin (Fig. 9A). As shown in Fig. 9B, there was no difference in the number of average YFP-positive EthD-negative cells per field when cultures were transfected with either empty vector or STC2 siRNA plasmid, suggesting that expression of siRNA per se did not adversely affect cell survival. Approximately 60% of N2a cells transfected with empty vector survived when cultures were treated with thapsigargin or H2O2. On the other hand, only 30 and 40% of STC2 siRNA-treated cells survived exposure to thapsigargin and H2O2, respectively, indicating that STC2 siRNA-transfected cells were significantly more vulnerable to cell death (P < 0.03 [versus control cells]) (Fig. 9B). In contrast, no differences were observed among the percentages of dead cells in control or STC2 siRNA-transfected cells after exposure to tunicamycin or staurosporine. These results suggest that survival adaptation of cells to thapsigargin-induced ER stress and oxidative stress requires upregulation of STC2 expression.
|
In addition to the STC2 knock-down experiments described above, we performed a set of studies to determine whether overexpression of STC2 will offer protection against ER stress-induced cell death. To this end, we overexpressed STC2 by transient transfection in HeLa cells (Fig. 10A). Transfected cells not exposed to ER stressors exhibited only minimal cell death, and there was no significant difference between transfection with control vector or STC2 expression plasmid. However, upon treatment with thapsigargin, there were significantly fewer dead cells staining positive with Hoechst or Annexin-V in STC2 transfected cultures compared to cultures transfected with control vector (Fig. 10B and C). On the other hand, no significant difference was observed in the percentage of cell death between the two groups when cells were exposed to tunicamycin. Thus, overexpression of STC2 significantly increased the resistance to apoptotic death after treatment with thapsigargin but not after treatment with tunicamycin (Fig. 10).
|
| DISCUSSION |
|---|
|
|
|---|
In HEK293 and mouse N2a neuroblastoma cells, exposure to tunicamycin or thapsigargin upregulates four genes involved in regulating Ca2+ homeostasis (Table 1 and Fig. 1); three of these genes, namely, NUCB2, CGRP2, and STC2, are novel targets of the UPR. During the course of our investigation, NUCB2 and STC2 were also found to be induced by tunicamycin treatment in SH-SY5Y neuroblastoma cells (6, 50). Previous studies have identified ATP2A2, which encodes a SERCA2b isoform, as a gene inducible by ER stress (6, 47, 57). SERCA2b is expressed ubiquitously and plays a critical role in Ca2+ signaling and homeostasis in all cells by translocating Ca2+ from the cytosol to the ER lumen. Genetic mutations in ATP2A2 cause an autosomal-dominant skin disorder termed Darier-White disease and are associated with an increased prevalence of neuropsychiatric disorders, including bipolar disorders, schizophrenia, epilepsy, and mental retardation (OMIM no. 124200 [http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=124200]). NUCB2 encodes a ubiquitous protein with two EF-hand motifs, termed nucleobindin 2 (also referred to as Calnuc), which is the major Ca2+-binding protein in the Golgi apparatus (36). Nucleobindin 2 is thought to establish an agonist-mobilizable Ca2+ store within the Golgi lumen (37). CGRP2 encodes a 127-amino-acid protein that gets processed into 37-amino-acid CGRP-II, which is nearly identical to neuropeptide CGRP-I (with three amino acid differences in human). CGRP-II is expressed in central and peripheral nervous system pituitary, the thyroid, and medullary thyroid carcinoma. Biological functions of CGRPs include vasodilation, nociception, glucose and calcium metabolism, etc. (63). STC2 encodes a secreted phosphoprotein related to calcium- and phosphate-regulating glycoprotein hormone first described in fish (21).
The function of STC in fish is to prevent hypercalcemia by targeting gill (reduces Ca2+ influx), gut (inhibits Ca2+ reabsorption), and kidney (increased PO4 reabsorption) (59, 64). Of the two mammalian STC homologues, STC1 shares greater sequence similarity with fish STC. In contrast to the restricted expression documented for fish STC, mouse STC1 is widely expressed in brain and several peripheral tissues, including the kidney, prostate, thyroid gland, and ovary (21). Nevertheless, STC function appears to be retained during evolution, because, as in fish, mammalian STC1 also stimulates phosphate absorption in the kidney and intestine and regulates calcium homeostasis (53, 66). STC2 is also widely expressed in mammals, but its physiological role(s) has not been fully understood. Since STC2 shares much lower identity (
35%) with STC1 and fish STC, it is possible that STC2 is functionally divergent from STC1 and fish STC (21). This notion is supported by the differential activation of STC2 expression by ER stress agents in neuronal and nonneuronal cells (Fig. 2 and 4). Interestingly, expression of both mammalian STC appear to correlate with the levels of estrogen receptor, and STC2 expression is induced by estrogen, indicating a link between STC expression and human cancer (7).
Despite the differential UPR induction of STC genes, the available evidence suggests that both STC1 and STC2 share cytoprotective functions. Previously, it was reported that overexpression of STC1 in Paju cells increased the viability of cells exposed to thapsigargin (70). The siRNA and overexpression studies reported here indicate that STC2 function is required for cell survival during exposure to thapsigargin and oxidative stress. Thapsigargin, an inhibitor of Ca2+ ATPase in the ER, rapidly mobilizes the intracellular calcium store and leads to increased levels of intracellular cytosolic Ca2+. Similarly, oxidative stress also elevates cytosolic Ca2+ levels by stimulating Ca2+ influx from the extracellular environment and ER and by inhibiting ER Ca2+ ATPase (10). Given the negative regulation of Ca2+ influx by fish STC and mammalian STC1 (53), it is very likely that STC2 also functions in a similar manner by regulating Ca2+ homeostasis in cells subject to ER stress, thus promoting cell survival. Finally, although STC2 expression is induced by treatment of cells with tunicamycin, siRNA and overexpression experiments showed no correlation between STC2 expression and cell viability in the presence of tunicamycin, suggesting that protein N glycosylation of STC2 or other protein(s) is critical for cytoprotective properties of STC2 during ER stress.
The manner in which STC2 expression is induced indicates that STC2 function is specifically required during the cellular response to challenge with ER stress agents, oxidative stress, and hypoxia (Fig. 6). We did not observe changes in STC2 expression when cells were exposed to several other xenotoxic stresses that would indicate a more generalized response to cytotoxicity. Hence, it is not surprising that STC2 is a downstream target of signaling activated by the proximal ER stress-sensing transmembrane protein kinase PERK and its downstream transcription factor, ATF4. Recent evidence suggests that activation of PERK pathway is not unique to ER stress response. For example, Koumenis et al. (30) reported that PERK is hyperphosphorylated upon hypoxic stress and is required for adaptation and survival of cells exposed to hypoxia. Recently, Harding et al. (17) demonstrated that PERK/ cells show impaired expression of genes involved in antioxidative stress response and accumulate endogenous peroxides during ER stress. Thus, the cellular adaptive response to ER stress and oxidative stress share a common mechanism involving the early activation of PERK pathway. Based on these findings, we speculate that STC2 function may be associated with the ability of cells to adapt to not only UPR but also oxidative stress and hypoxia. Indeed, we find rapid induction of STC2 expression in cortical neurons reacting to ischemia within 3.5 h of reperfusion after transient MCA occlusion. Cerebral ischemia is a well-known pathophysiological condition in which aspects of UPR are activated (25, 32, 48). Strong STC2 immunoreactivity is observed in the ischemic cortex 6 h after reperfusion and persisted even after 48 h of reperfusion (Fig. 8). Our in vitro findings, together with marked induction of STC2 in neurons within the ischemic core and penumbra, suggest that STC2 upregulation might have a nonredundant physiological role in the survival of ischemic neuronal cells.
Interestingly, induced STC1 expression appears to be limited to hypoxia and not associated with ER stress or other xenotoxic stresses examined in the present study. The only exception we noted was thapsigargin-induced transient upregulation of STC1 in primary cortical astrocytes (Fig. 2 and 6). Thus, STC1 may have a restricted role during hypoxia compared to a more general role of STC2 during UPR and hypoxia. While the present study was being prepared, Leonard et al. (35) reported STC2 as one of the genes induced by hypoxia in a kidney cell line and dependent on hypoxia-inducible factor 1 (HIF-1). Furthermore, it was observed that STC1 is among the genes induced by vascular endothelial growth factor, a HIF-1-dependent gene (39, 67). Our results from analysis of mouse embryonic fibroblasts are consistent with both of these findings. In agreement with a central role of HIF, hypoxia-mediated upregulation of STC1 in fibroblasts occurs under conditions when hallmarks of the UPR (BiP and CHOP) are not activated and in the absence of PERK, ATF4, or XBP-1 expression (Fig. 7B).
Recent evidence suggests that >90% of STC1 is concentrated in the mitochondria of the kidney, liver, spleen, and lung. It was proposed that STC1 is internalized from the plasma membrane by binding to an unidentified receptor, and internalized STC1 is shuttled to the mitochondria (44). Our confocal microscopy analyses and subcellular fractionation studies reveal that STC2 is localized mainly in the ER and Golgi apparatus, with no overlap with mitochondrial markers. Purified mitochondrial fractions were also devoid of STC2 (Fig. 5). One possibility that might explain this apparent discrepancy is that cultured cells used in our study do not express high levels of the putative STC receptor(s). The molecular details of STC function in neuronal cells still need to be elucidated. In the future it will be important to determine whether STC1 and STC2 have different subcellular sites of action in regulating cellular mineral metabolism under physiological conditions and under conditions of stress.
| ACKNOWLEDGMENTS |
|---|
We are grateful to David Ron (Skirball Institute, New York University) for providing IRE1ß and PERK cDNAs and PERK/ fibroblasts, Linda M. Hendershot (St. Jude Children's Research Hospital, Memphis, Tenn.) for providing ATF4/ fibroblasts, Laurie H. Glimcher (Harvard School of Public Health, Boston, Mass.) for providing XBP-1/ fibroblasts, and T. Y. Chang (Dartmouth Medical School, Hanover, N.H.) for providing the S2P-deficient CHO cells. We thank Manuel F. Utset (University of Chicago) for discussions and advice on histology.
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
2. Brummelkamp, T. R., R. Bernards, and R. Agami. 2002. A system for stable expression of short interfering RNAs in mammalian cells. Science 296:550-553.
3. Butkus, A., P. J. Roche, R. T. Fernley, J. Haralambidis, J. D. Penschow, G. B. Ryan, J. F. Trahair, G. W. Tregear, and J. P. Coghlan. 1987. Purification and cloning of a corpuscles of Stannius protein from Anguilla australis. Mol. Cell Endocrinol. 54:123-133.[CrossRef][Medline]
4. Calfon, M., H. Zeng, F. Urano, J. H. Till, S. R. Hubbard, H. P. Harding, S. G. Clark, and D. Ron. 2002. IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature 415:92-96.[CrossRef][Medline]
5. Casagrande, R., P. Stern, M. Diehn, C. Shamu, M. Osario, M. Zuniga, P. O. Brown, and H. Ploegh. 2000. Degradation of proteins from the ER of Saccharomyces cerevisiae requires an intact unfolded protein response pathway. Mol. Cell 5:729-735.[CrossRef][Medline]
6. Caspersen, C., P. S. Pedersen, and M. Treiman. 2000. The sarco/endoplasmic reticulum calcium-ATPase 2b is an endoplasmic reticulum stress-inducible protein. J. Biol. Chem. 275:22363-22372.
7. Chang, A. C., D. A. Jellinek, and R. R. Reddel. 2003. Mammalian stanniocalcins and cancer. Endocrinol. Relat. Cancer 10:359-373.
8. Chang, A. C., and R. R. Reddel. 1998. Identification of a second stanniocalcin cDNA in mouse and human: stanniocalcin 2. Mol. Cell Endocrinol. 141:95-99.[CrossRef][Medline]
9. DiMattia, G. E., R. Varghese, and G. F. Wagner. 1998. Molecular cloning and characterization of stanniocalcin-related protein. Mol. Cell Endocrinol. 146:137-140.[CrossRef][Medline]
10. Ermak, G., and K. J. Davies. 2002. Calcium and oxidative stress: from cell signaling to cell death. Mol. Immunol. 38:713-721.[CrossRef][Medline]
11. Forman, M. S., V. M. Lee, and J. Q. Trojanowski. 2003. 'Unfolding' pathways in neurodegenerative disease. Trends Neurosci. 26:407-410.[CrossRef][Medline]
12. Harding, H. P., M. Calfon, F. Urano, I. Novoa, and D. Ron. 2002. Transcriptional and translational control in the mammalian unfolded protein response. Annu. Rev. Cell Dev. Biol. 18:575-599.[CrossRef][Medline]
13. Harding, H. P., and D. Ron. 2002. Endoplasmic reticulum stress and the development of diabetes: a review. Diabetes 51(Suppl. 3):S455-S461.
14. Harding, H. P., H. Zeng, Y. Zhang, R. Jungries, P. Chung, H. Plesken, D. D. Sabatini, and D. Ron. 2001. Diabetes mellitus and exocrine pancreatic dysfunction in perk/ mice reveals a role for translational control in secretory cell survival. Mol. Cell 7:1153-1163.[CrossRef][Medline]
15. Harding, H. P., Y. Zhang, A. Bertolotti, H. Zeng, and D. Ron. 2000. Perk is essential for translational regulation and cell survival during the unfolded protein response. Mol. Cell 5:897-904.[CrossRef][Medline]
16. Harding, H. P., Y. Zhang, and D. Ron. 1999. Protein translation and folding are coupled by an endoplasmic-reticulum-resident kinase. Nature 397:271-274.[CrossRef][Medline]
17. Harding, H. P., Y. Zhang, H. Zeng, I. Novoa, P. D. Lu, M. Calfon, N. Sadri, C. Yun, B. Popko, R. Paules, D. F. Stojdl, J. C. Bell, T. Hettmann, J. M. Leiden, and D. Ron. 2003. An integrated stress response regulates amino acid metabolism and resistance to oxidative stress. Mol. Cell 11:619-633.[CrossRef][Medline]
18. Hasan, M. T., C. C. Chang, and T. Y. Chang. 1994. Somatic cell genetic and biochemical characterization of cell lines resulting from human genomic DNA transfections of Chinese hamster ovary cell mutants defective in sterol-dependent activation of sterol synthesis and LDL receptor expression. Somat. Cell Mol. Genet. 20:183-194.[CrossRef][Medline]
19. Haze, K., H. Yoshida, H. Yanagi, T. Yura, and K. Mori. 1999. Mammalian transcription factor ATF6 is synthesized as a transmembrane protein and activated by proteolysis in response to endoplasmic reticulum stress. Mol. Biol. Cell 10:3787-3799.
20. Holtz, W. A., and K. L. O'Malley. 2003. Parkinsonian mimetics induce aspects of unfolded protein response in death of dopaminergic neurons. J. Biol. Chem. 278:19367-19377.
21. Ishibashi, K., and M. Imai. 2002. Prospect of a stanniocalcin endocrine/paracrine system in mammals. Am. J. Physiol. Renal Physiol. 282:F367-F375.
22. Ishibashi, K., K. Miyamoto, Y. Taketani, K. Morita, E. Takeda, S. Sasaki, and M. Imai. 1998. Molecular cloning of a second human stanniocalcin homologue (STC2). Biochem. Biophys. Res. Commun. 250:252-258.[CrossRef][Medline]
23. Ito, D., Y. Imai, K. Ohsawa, K. Nakajima, Y. Fukuuchi, and S. Kohsaka. 1998. Microglia-specific localization of a novel calcium binding protein, Iba1. Brain Res. Mol. Brain Res. 57:1-9.[Medline]
24. Ito, D., K. Tanaka, S. Suzuki, T. Dembo, and Y. Fukuuchi. 2001. Enhanced expression of Iba1, ionized calcium-binding adapter molecule 1, after transient focal cerebral ischemia in rat brain. Stroke 32:1208-1215.
25. Ito, D., K. Tanaka, S. Suzuki, T. Dembo, A. Kosakai, and Y. Fukuuchi. 2001. Upregulation of the Ire1-mediated signaling molecule, Bip, in ischemic rat brain. Neuroreport 12:4023-4028.[CrossRef][Medline]
26. Jellinek, D. A., A. C. Chang, M. R. Larsen, X. Wang, P. J. Robinson, and R. R. Reddel. 2000. Stanniocalcin 1 and 2 are secreted as phosphoproteins from human fibrosarcoma cells. Biochem. J. 350(Pt. 2):453-461.
27. Jiang, H. Y., S. A. Wek, B. C. McGrath, D. Lu, T. Hai, H. P. Harding, X. Wang, D. Ron, D. R. Cavener, and R. C. Wek. 2004. Activating transcription factor 3 is integral to the eukaryotic initiation factor 2 kinase stress response. Mol. Cell. Biol. 24:1365-1377.
28. Jonas, V., C. R. Lin, E. Kawashima, D. Semon, L. W. Swans