![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Departments of Biochemistry,1 Oncology,8 McGill Cancer Centre, McGill University, Montreal, Quebec, Canada,9 Stowers Institute for Medical Research, Kansas City, Missouri,2 Department of Biochemistry and Molecular Biology, University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma,3 Department of Biochemistry and Molecular Biology, University of Kansas Medical Center, Kansas City, Kansas,7 Department of Molecular Microbiology and Immunology, Johns Hopkins University School of Public Health, Baltimore, Maryland,4 Department of Microbiology and Immunology, School of Medicine, Wake Forest University, Winston-Salem, North Carolina,5 Institut für Medizinische Mikrobiologie und Hygiene, Universität Regensburg, Regensburg, Germany6
Received 12 May 2004/ Returned for modification 15 June 2004/ Accepted 22 July 2004
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Inactivation of proteins by degradation commonly involves the ubiquitin-dependent proteasome pathway. Target proteins are first conjugated to a chain of ubiquitin molecules through the action of a series of enzymes termed E1 (ubiquitin activating), E2 (ubiquitin conjugating), and E3 (ubiquitin ligase). It is the role of the E3 ligase, often a multiprotein complex, to recognize the substrates and bridge them with E2 for ubiquitin conjugation. The HPV E6 protein acts as an adapter to bring p53 to a cellular E3 ligase, termed E6AP (3, 40). E6AP—which has been shown in noninfected cells to ubiquitinate HHR23A, a human Rad23 homologue (28), Mcm7 (27), and Blk, a Src family member (34)—is recruited by E6 to new substrates. In addition to p53, E6 redirects E6AP to ubiquitinate hDlg (15), hScrib (32), c-Myc (17), and Bak (51). Mutation of E6AP represents one cause of Angelman syndrome (26).
The adenovirus proteins E4orf6 and E1B55K also redirect a cellular E3 ligase to target p53 for degradation: in this case one that contains the cullin family member Cul5, elongins B and C, and the RING protein Rbx1, which were shown to interact with E4orf6 but not E1B55K (18, 37). Cullin-based E3 ligases are part of the RING-type group of E3 ligases, which unlike the HECT-type group do not form an E3-ubiquitin thioester intermediate (55). These ligases are composed of a cullin family member and the RING protein Rbx1 linked to a protein that acts as a substrate specificity factor. These complexes interact with an E2-conjugating enzyme, often either Cdc34 or Ubc5, to conjugate ubiquitin chains to its substrates. In the case of the SCF complex, for which a crystal structure has been determined (55), Cul1 is linked by Skp1 to one of many F-box proteins, which serve as the substrate recognition protein (for a review of SCF, see reference 20). In the VBC complex, the linker proteins elongins B and C link Cul2 to the von Hippel-Lindau (VHL) substrate specificity protein. Elongins B and C also serve as a linker for complexes of Cul5, which have been found to exist with presumed substrate specificity proteins Muf1, elongin A, WSB, and SOCS1 (21), although substrates for these complexes have not yet been identified. Interestingly, VHL has been found to form complexes with both Cul2 and Cul5. Thus far, VHL is the only protein found to interact with more than one cullin family member (21).
Like the HPV E6 protein, which was initially discovered to degrade p53 but later found to induce the degradation of other substrates, the E4orf6 complex probably induces the degradation of other cellular proteins in addition to p53. It has recently been suggested that Rad50 and Mre11, components of the double-stranded break repair complex, are substrates of the E4orf6 ligase complex (48).
In addition to their function in degradation of p53, E4orf6 and E1B55K form a complex that has been implicated in several late viral functions. Both are required for efficient transport of late viral mRNA transcripts and the block of nuclear export of cellular mRNAs (reviewed in references 12 and 14). Mutant viruses defective in either of these genes exhibit reduced replication and progeny production.
Elongin C-interacting proteins, including elongin A, VHL, and SOCS1, have been shown to contain a conserved sequence, termed the BC-box motif, which is the only region of significant homology between elongin A and VHL and which is required for interaction with elongin C (21, 23). In the present studies on the E4orf6 E3 ligase complex, we determined if E4orf6 contains such a motif and if it mediates interactions with elongins B and C in complex formation. We show that E4orf6 contains two functional near-consensus BC-box motifs and that both are needed for efficient E1B55K/E4orf6-induced degradation of p53 and Mre11. In addition, our results suggest that E1B55K does not interact directly with E4orf6 as previously believed, but rather that it requires E4orf6 to form a complex with Cul5 and elongins B and C to bind and to elicit p53 degradation and other functions involved in viral replication. These results suggest new functions for the E4orf6 E3 ligase activity related to control of mRNA transport and stability.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Adenovirus vectors and plasmids. All adenovirus vectors used in this study have been described previously, including Adp53 expressing wild-type (wt) human p53 under the cytomegalovirus promoter (37), AdHH55K expressing HMK- and histidine-tagged Ad5 E1B55K (38), and AdE4orf6 expressing Ad5 E4orf6 (38). Plasmids pcDNA3-E1B55K wt and C184T were obtained from Thomas Dobner (unpublished data), and HA-Cul5 was described previously (37). Putative zinc domain mutants of E4orf6 were described previously (5). BC-box E4orf6 mutants were generated by PCR-based mutagenesis using the following oligonucleotide primers: L47G forward, CTGGAGGATCATCCCGGGCTGCCCGAATGTAAC, and reverse GTTACATTCGGGCAGCCCGGGATGATCCTCCAG, with wt pcDNA3-E4orf6 as template; L47G/C51 forward, CGGGCTGCCCGAAGTTAACACTTTGACAATG, and reverse, CATTGTCAAAGTGTTAACTTCGGGCAGCCCG, with L47G as template; L122S forward, CGAGTCCTGGGCTAGCCACTGTCATTGTTCC, and reverse, GGAACAATGACAGTGGCTAGCCCAGGACTCG, with wt pcDNA3-E4orf6 as template; and L122S/C126M forward, GCTAGCCACTGTCATATGTCCAGTCCCGGTTCC, and reverse, GGAACCGGGACTGGACATATGTCAGTGGCTAGC, with L122S as template. L47G/L122S was created by digesting single mutants L47G and L122S with EcoRV and combining the mutants. A similar approach was taken for the quadruple mutant L47G/C51V/L122S/C126M. p53-HA was generated by PCR with the following oligonucleotide primers: forward, CCCGGATCCACCATGGAGGAGCCGCAGTCA, and reverse, CCCGAATTCGTCTGAGTCAGGCCCTTC. The resulting PCR product was then digested with BamHI and EcoRI and cloned in frame into the pcDNA3HAtag vector.
Antisera. E4orf6-specific rabbit polyclonal antibody 1807 was described in reference 4. Anti-p53 pAb1801 hybridoma supernatants were prepared as described previously (39). E1B55K was detected with the 2A6 monoclonal antibody (44), elongin C with mouse monoclonal antibody SIII p15 (Transduction Laboratories), Mre11 with rabbit polyclonal antiserum NB 100-142D3 (NOVUS Biologicals), and HA epitopes with anti-HA mouse monoclonal HA.11 (BabCO).
DNA transfection. Cells were transfected in 60- or 100-mm-diameter dishes with the liposome reagent DMRIE-C (Gibco-BRL), as described by the manufacturer. For p53 degradation assays, a plasmid DNA ratio of 2:1 was used with 0.75 µg of pcDNA3-p53, 1.5 µg of pcDNA3-E4orf6 (wt or mutants), and 1.5 µg of pcDNA3-E1B55K in 60-mm-diameter dishes with 11.5 µl of reagent for 24 h. When required, the total amount of DNA was made up to 3.75 µg by addition of pcDNA3 empty vector DNA. For binding assays, 2.5 µg of each of the plasmid DNAs was transfected in 100-mm-diameter dishes using 15 µl of reagent.
Expression of recombinant proteins in Sf21 insect cells. PCR was used to amplify wt elongin C, and elongin C deletion and point mutants containing an HPC4 tag were amplified from the corresponding M13mpET-elongin C constructs (50). The resulting fragments were subcloned into pBacPAK8. Baculoviruses encoding human elongin B and VHL and adenovirus type 5 E4orf6 were described previously (21, 37). Sf21 cells were cultured at 27°C in Sf-900 II SFM (Gibco) with 5% fetal calf serum, penicillin (100 U/ml), and streptomycin (100 µg/ml). Plates containing 106 Sf21 cells were infected with the recombinant baculoviruses indicated in the figures. Sixty hours after infection, cells were collected and lysed in 1 ml of ice-cold buffer containing 40 mM HEPES-NaOH (pH 7.9), 150 mM NaCl, 1 mM dithiothreitol (DTT), 0.5% (vol/vol) Triton X-100, 10% (vol/vol) glycerol, 5-µg/ml leupeptin, 5-µg/ml antipain, 5-µg/ml pepstatin A, and 5-µg/ml aprotinin.
Immunoprecipitation and Western blotting. Cells were lysed for 20 min on ice with lysis buffer (20 mM Tris-HCl, pH 7.5, containing 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, 5% glycerol, 2 mM DTT, 4 mM NaF, 2 mM NaPP, 500 µM Na3VO4, 200-µg/ml PMSF, 2-µg/ml aprotinin, 5-µg/ml leupeptin). Aliquots of cell extract containing 30 µg of protein were loaded on sodium dodecyl sulfate (SDS)-polyacrylamide gels containing 10 or 15% polyacrylamide for Western blotting analysis, or between 800 and 1,300 µg (constant within each experiment), were used for immunoprecipitation using 5 µl of rabbit anti-E4orf6 polyclonal antibody 1807 or 7 µl of anti-E1B55K mouse monoclonal antibody 2A6, followed by incubation with protein G Sepharose (Amersham Bioscience). The beads were extensively washed in lysis buffer and examined by SDS-polyacrylamide gel electrophoresis (PAGE), as described previously (37, 39). For analysis of the interaction of elongin C mutants with elongin B and either VHL or E4orf6, approximately 100 µg of Sf21 cell lysates were incubated for 2 h at 4°C with 10 µl of protein G Sepharose and 2 µg of HPC4 monclonal antibody. Protein G Sepharose was washed three times in buffer containing 40 mM HEPES-NaOH (pH 7.9), 150 mM NaCl, 1 mM DTT, and 0.5% (vol/vol) Triton X-100. Immunoprecipitated proteins were analyzed by SDS-PAGE (13% polyacrylamide) and transferred to Hybond P membranes (Amersham-Pharmacia Biotech). Membranes were incubated with the indicated antibodies in TBS buffer (40 mM Tris-HCl, pH 7.6, 100 mM NaCl) containing 3% nonfat dry milk overnight at 4°C, followed by incubation of appropriate peroxidase-conjugated secondary antibodies (Sigma). Membranes were then visualized by Western blotting with Supersignal West Pico or Dura chemiluminescent reagent (Pierce) or were visualized and quantitated with the Storm Gel and Blot Imaging System following treatment by enhanced chemiluminescence with ECL plus Western blotting reagents (Amersham-Pharmacia Biotech).
Detection of in vivo ubiquitinated forms of p53. H1299 cells were infected with adenovirus vectors at a multiplicity of infection of 50 PFU per cell for 1 h in 1 ml of serum-free medium (100-mm dishes) with occasional shaking before addition of normal medium. When indicated, proteasome inhibitor MG132 was added at 18 h postinfection (p.i.) at a final concentration of 20 µM. Cells were lysed at 24 h p.i., and extracts were immunoprecipitated with the 1807 (E4orf6) antibody.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
|
In addition to p53, two other substrates of the adenoviral E4orf6 protein have recently been identified, Rad50 and Mre11 (6, 48), which are subunits of a double-stranded DNA repair complex. We have been unable to demonstrate the E4orf6-E1B55K-dependent degradation of Rad50 in our system (data not shown); however, Fig. 2D shows results obtained with Mre11. Again, degradation was determined in extracts from cells expressing E1B55K and wt or mutant E4orf6 that were analyzed by Western blotting using anti-Mre11 antibodies. The results showed a pattern similar to that obtained with p53 in that E4orf6-dependent degradation of Mre11 occurred at high levels with wt E4orf6 and mutant 1 (L47G), but was severely reduced in mutants 5 and 6 in which the conserved leucines and cysteines in both BC-boxes 1 and 2 were altered. Taken together, these results confirmed the functional importance of both E4orf6 BC-boxes.
To study the nature of the E4orf6-elongin C interaction, the ability of a series of elongin C deletion mutants (see the list in Fig. 3A) to form complexes with BC-box proteins, including E4orf6, was tested. Sf21 insect cells were coinfected with baculoviruses expressing wt or mutant forms of HPC4-tagged elongin C, elongin B, and with BC-box protein VHL or E4orf6. Elongin C was immunoprecipitated from whole-cell extracts with anti-HPC4 antibodies, and the coprecipitation of the other proteins was analyzed by Western blotting using appropriate antibodies. Figure 3 shows the results of this study. As shown previously (49), a region of elongin C near the amino terminus, between residues 15 and 30, appears to be required for binding elongin B, as two deletion mutants, 23-112 and 
21-30 both failed to interact significantly with elongin B, whereas the other amino-terminal mutants, including 15-112 and 31-40, retained the interaction. (Fig. 3B and C). In addition, elongin C mutants 23-112 and 21-30 interact with both VHL and E4orf6 less efficiently than the wt, consistent with previous observations that stable binding of elongin C to VHL, elongin A, and other BC-box proteins depends on elongin B (1, 13, 23, 25). The region of elongin C deleted from these mutants forms strands 1 and 2, which have been shown to participate in interactions with elongin B (46). While there are no direct contacts between strands 1 and 2 and VHL, loss of interaction with elongin B could destabilize the structure of the region that interacts with VHL. The results obtained with VHL (Fig. 3B) and E4orf6 (Fig. 3C) all indicated that the carboxy-terminal region of elongin C appears to be required for interaction with BC-box motifs, as deletion mutants starting at residues 71 to 80 resulted in the loss of stable interactions with both VHL and E4orf6. These results are consistent with published data for VHL (50) and with the VHL-elongin BC crystal structure (46), which showed that the carboxy-terminal region of elongin C forms helices H3 and H4 and loop L5, which are critical for the interaction with VHL. Taken together, our comparison of the abilities of the elongin C mutants to assemble into complexes with VHL and E4orf6 suggests that the interaction between E4orf6 and elongin C resembles that of VHL and that E4orf6 forms an E3 ligase complex in a manner similar to VHL in the VBC complex.
|
|
|
Stable binding of E1B55K to E4orf6 requires intact BC-box motifs in E4orf6. The BC-box mutants were also tested for their ability to interact stably with E1B55K and p53. H1299 cells were cotransfected with plasmid DNAs expressing mutant or wt E4orf6 and either E1B55K or human wt p53. Following immunoprecipitation with anti-E4orf6 antibodies, the presence of E1B55K and p53 was assessed by Western blotting using the appropriate antibodies. Figure 6A shows that, somewhat surprisingly, all BC-box mutants except BC-box 1 mutant 1 (L47G), which was shown to be wt for p53 degradation, lost the ability to interact with E1B55K. This loss of interaction could not simply be due to misfolding of these E4orf6 mutant proteins as Fig. 6B shows that all E4orf6 mutant proteins were still able to bind to p53.
|
-helical region, for which similar viral growth complementation data had been obtained (36). The results of this experiment and the complementation data are summarized in Table 1, with binding results presented with representative mutants shown in Fig. 7B. Table 1 shows that these mutants can be separated into three groups. Group 1 consists of mutants that complement an E4 deletion for normal virus production and have wt or nearly wt binding activities with both elongin C and E1B55K. Group 2 mutants do not complement nor bind either E1B55K or elongin C. Group 3 mutants both complement and bind to elongin C; however, interaction with E1B55K was undetectable. These results demonstrate that the formation of E3 ligase complex for functional activity of E4orf6 in the growth of the virus is paramount and perhaps even more important than its interaction with E1B55K.
|
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
It has been recently shown that adenovirus infection induces the degradation of Mre11 and Rad50, two components of the double-strand break repair complex Mre11-Rad50-NBS1. Studies with virus mutants implicated both E1B55K and E4orf6 in this degradation process and furthermore suggested a role for the viral E4orf3 protein in their relocalization from the viral inclusion bodies to PML-containing nuclear tracks (48). Using our degradation system involving transient coexpression of E4orf6 and E1B55K in the absence of other adenovirus proteins, we were unable to confirm the degradation of Rad50 by E4orf6 and E1B55K; however, degradation of Mre11 induced by these proteins was quite marked. It is possible that one or more additional viral proteins are required for efficient degradation of Rad50; however, it seems more likely that degradation of Rad50 is not a direct effect of the E4orf6/E1B55K E3 ligase complex, but rather results from a decrease in Rad50 due to the disruption of the Mre11-Rad50-NBS1 complex when Mre11 is degraded.
Unlike the BC-box motifs present in E4orf6, that present in E1B55K does not appear to be necessary for the function of the E3 ligase. Furthermore, it did not appear to be capable of interacting with elongin C or recruiting Cul5 (Fig. 4A) (18). It is possible that this BC-box motif may not be exposed and thus is not accessible to elongin C following formation of the final tertiary structure of E1B55K. In this regard, it is of interest to note that E1B55K proteins containing two other mutations in this motif (L180A/C184S and L180P/C184F) are highly unstable (data not shown).
In addition to forming the Cul5 complex, E4orf6 has been known for some time to bind to p53 in the absence of E1B55K. Thus what is the role of E1B55K in the degradation of p53 by the E4orf6 complex? Clearly E1B55K is required, as E4orf6 degrades p53 very poorly in its absence. Two explanations appear plausible. First, although p53 may bind to E4orf6 in the E3 ligase complex, E1B55K may be required to achieve an optimal orientation for the ubiquitination reaction. And second, although E4orf6 binds p53, much higher levels of p53 substrate may be introduced into the E4orf6-E3 ligase complex when E1B55K is present. The results presented in Fig. 5A suggest that the second explanation is the most likely. In the absence of E1B55K, only a small amount of p53 is associated with the E4orf6 complex. Thus the presence of E1B55K greatly increases the levels of p53 available for degradation; however, a similar fraction of the p53 associated with the E4orf6 complex was found to be ubiquitinated in the presence and absence of E1B55K. Thus, E1B55K probably functions to introduce high levels of p53 into the complex. Our favored model is that E4orf6 forms the E3 ligase complex involved in ubiquitination followed by proteasomal degradation and that E1B55K introduces substrates for degradation, including p53, Mre11, and most likely additional as yet unidentified cellular or viral proteins. As shown in coimmunoprecipitation experiments, only E1B55K (and not E4orf6) binds Mre11. The ability of E4orf6 to interact directly with p53 may be unique among targets of the E4orf6 degradation complex. Thus the ability of E4orf6 to block the transactivational activity of p53 may serve some function to the virus in addition to E3 ligase complex formation and ubiquitination.
An unexpected result was the failure of E1B55K to interact with E4orf6 BC-box mutants that were defective in E3 ligase complex formation. We believed it likely that the E4orf6 BC-box mutations would abolish complex formation with the cellular proteins elongin C and Cul5; however, the interaction between E4orf6 and E1B55K has been known for some time and believed to be direct. This lack of binding cannot simply be attributed to general misfolding of the E4orf6 BC-box mutants, as all formed stable interactions with p53. In explaining this effect, we propose that E1B55K does not interact directly with E4orf6, but rather interacts with the E3 ligase complex that E4orf6 has assembled. In other words, E1B55K only associates with E4orf6 once it has assembled the cellular E3 ligase complex, as shown in Fig. 8. Complex formation may alter the conformation of E4orf6 to expose the E1B55K binding site or stabilize the E4orf6-E1B55 interaction. It is also possible that E1B55K makes contact with both E4orf6 and one or more members of the cellular Cul5-containing complex. Whatever the case, these results may explain some previous observations about E4orf6. It had been observed that newly synthesized E4orf6 only associates with E1B55K 1 to 2 h following its synthesis (10). This effect might be explained by the time required for the newly synthesized E4orf6 to be assembled into the E3 ligase complex. In addition, other groups have reported difficulty in detecting interactions between E1B55K and E4orf6 in vitro (24, 42). Further, E4orf6 and E1B55K were not found to interact in the yeast two-hybrid system (42). The last two observations would make sense if cellular proteins were required for the interaction. In addition, little interaction between E4orf6 and E1B55K is evident in many rodent cell lines, suggesting that a primate-specific factor may be required (16). This component is probably not Cul5 or elongin B or C as (i) these proteins are nearly identical in rodents and humans and (ii) the genes encoding these proteins are not localized on human chromosome 21, to which the major primate-specific activity was mapped (8). These possibilities may explain some controversy about the location of the E1B55K binding site on E4orf6. Some evidence has suggested that the E1B55K binding site resides in the first 55 amino-terminal residues of E4orf6 (39, 42), whereas others have suggested that the amphipathic -helical region towards the carboxy terminus of E4orf6 plays a role (7, 35, 52). Future studies will be required to define such interactions further.
|
Studies on the three sets of E4orf6 point mutants presented herein have also led to additional insights about E4orf6-E1B55K function and complex structure. From the combined data with the three sets of E4orf6 mutants, it appears that in addition to the elongin C-BC-box interaction, other regions of E4orf6 may form interactions with other members of the complex. Most or all of these interactions would be required for a strong stable interaction detectable by coimmunoprecipitation, since mutations in any of these domains result in a loss of detectable binding. One of these additional interactions may be with Cul5 as E4orf6 forms a complex only with Cul5 and not with Cul2 (37). As Cul2 is also known to interact with VHL through elongins B and C, our results suggest that the specificity of E4orf6 for Cul5 may be regulated through direct interactions with Cul5. Further studies will be required to confirm this possibility. A series of point mutations in a putative zinc finger domain yielded E4orf6 mutant proteins with properties similar to those of the BC-box mutants. These mutants exhibited loss of E1B55K binding and relocalization to the nucleus, and they were defective for p53 degradation. Like the E4orf6 BC-box mutants, they were still able to bind p53. These similarities suggested that like the BC-box mutants, the putative zinc-binding domain mutants may be unable to form the E3 ligase complex, a prediction that was largely confirmed in the present studies. These mutants had also been shown previously to fail to complement an adenovirus deletion mutant lacking the complete E4 region for expression of high levels of late viral proteins. Also, a series of point mutations in the amphipathic -helical region of E4orf6 yielded three mutant phenotypes (Table 1). Again a good correlation was seen between complex formation and binding to E1B55K as group 2 mutants that failed to bind elongin C also failed to bind E1B55K. Thus E3 ligase complex formation may be required for all functions requiring both E4orf6 and E1B55K, including export of late viral mRNA and inhibition of export of cellular mRNAs. This conclusion agrees well with the observations of Corbin-Lickfett and Bridge (9), who conclude that active proteasomes are required for E4orf6 to promote late gene expression. This possibility suggests that degradation of as yet unidentified cellular proteins by the E3 ligase complex may function in the control of mRNA metabolism. Lastly, it is worth noting that group 3 mutants in the amphipathic -helical region (Table 1) complement the E4 adenovirus deletion mutant even though they do not appear to interact with E1B55K. While it remains possible that E1B55K interacts transiently or at low undetectable levels with these mutant species, it is also possible that the E4orf6 E3 ligase complex in the absence of E1B55K can provide some of the functions required to support adenovirus replication. In fact, with all the mutants tested in this study, a perfect correlation was evident between E3 ligase complex formation and complementation of the E4 defect, whereas such was not with the case with binding to E1B55K. Further studies are under way to examine these possibilities using appropriate E4orf6 and E1B55K mutant viruses.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Bargonetti, J., I. Reynisdottir, P. N. Friedman, and C. Prives. 1992. Site-specific binding of wild-type p53 to cellular DNA is inhibited by SV40 T antigen and mutant p53. Genes Dev. 6:1886-1898.
3. Beer-Romero, P., S. Glass, and M. Rolfe. 1997. Antisense targeting of E6AP elevates p53 in HPV-infected cells but not in normal cells. Oncogene 14:595-602.[CrossRef][Medline]
4. Boivin, D., M. R. Morison, R. C. Marcellus, E. Querido, and P. E. Branton. 1999. Analysis of synthesis, stability, phosphorylation, and interacting polypeptides of the 34-kilodalton product of open reading frame 6 of the early region 4 protein of human adenovirus type 5. J. Virol. 73:1245-1253.
5. Boyer, J. L., and G. Ketner. 2000. Genetic analysis of a potential zinc-binding domain of the adenovirus E4 34k protein. J. Biol. Chem. 275:14969-14978.
6. Carson, C. T., R. A. Schwartz, T. H. Stracker, C. E. Lilley, D. V. Lee, and M. D. Weitzman. 2003. The Mre11 complex is required for ATM activation and the G2/M checkpoint. EMBO J. 22:6610-6620.[CrossRef][Medline]
7. Cathomen, T., and M. D. Weitzman. 2000. A functional complex of adenovirus proteins E1B-55kDa and E4orf6 is necessary to modulate the expression level of p53 but not its transcriptional activity. J. Virol. 74:11407-11412.
8. Chastain-Moore, A. M., T. Roberts, D. A. Trott, R. F. Newbold, and D. A. Ornelles. 2003. An activity associated with human chromosome 21 permits nuclear colocalization of the adenovirus E1B-55K and E4orf6 proteins and promotes viral late gene expression. J. Virol. 77:8087-8098.
9. Corbin-Lickfett, K. A., and E. Bridge. 2003. Adenovirus E4-34kDa requires active proteasomes to promote late gene expression. Virology 315:234-244.[CrossRef][Medline]
10. Cutt, J. R., T. Shenk, and P. Hearing. 1987. Analysis of adenovirus early region 4-encoded polypeptides synthesized in productively infected cells. J. Virol. 61:543-552.
11. Dobner, T., N. Horikoshi, S. Rubenwolf, and T. Shenk. 1996. Blockage by adenovirus E4orf6 of transcriptional activation by the p53 tumor suppressor. Science 272:1470-1473.[Abstract]
12. Dobner, T., and J. Kzhyshkowska. 2001. Nuclear export of adenovirus RNA. Curr. Top. Microbiol. Immunol. 259:25-54.[Medline]
13. Duan, D. R., A. Pause, W. H. Burgess, T. Aso, D. Y. Chen, K. P. Garrett, R. C. Conaway, J. W. Conaway, W. M. Linehan, and R. D. Klausner. 1995. Inhibition of transcription elongation by the VHL tumor suppressor protein. Science 269:1402-1406.
14. Flint, S. J., and R. A. Gonzalez. 2003. Regulation of mRNA production by the adenoviral E1B 55-kDa and E4 Orf6 proteins. Curr. Top. Microbiol. Immunol. 272:287-330.[Medline]
15. Gardiol, D., C. Kuhne, B. Glaunsinger, S. S. Lee, R. Javier, and L. Banks. 1999. Oncogenic human papillomavirus E6 proteins target the discs large tumour suppressor for proteasome-mediated degradation. Oncogene 18:5487-5496.[CrossRef][Medline]
16. Goodrum, F. D., T. Shenk, and D. A. Ornelles. 1996. Adenovirus early region 4 34-kilodalton protein directs the nuclear localization of the early region 1B 55-kilodalton protein in primate cells. J. Virol. 70:6323-6335.[Abstract]
17. Gross-Mesilaty, S., E. Reinstein, B. Bercovich, K. E. Tobias, A. L. Schwartz, C. Kahana, and A. Ciechanover. 1998. Basal and human papillomavirus E6 oncoprotein-induced degradation of Myc proteins by the ubiquitin pathway. Proc. Natl. Acad. Sci. USA 95:8058-8063.
18. Harada, J. N., A. Shevchenko, D. C. Pallas, and A. J. Berk. 2002. Analysis of the adenovirus E1B-55K-anchored proteome reveals its link to ubiquitination machinery. J. Virol. 76:9194-9206.
19. Iwai, K., K. Yamanaka, T. Kamura, N. Minato, R. C. Conaway, J. W. Conaway, R. D. Klausner, and A. Pause. 1999. Identification of the von Hippel-Lindau tumor-suppressor protein as part of an active E3 ubiquitin ligase complex. Proc. Natl. Acad. Sci. USA 96:12436-12441.
20. Jackson, P. K., A. G. Eldridge, E. Freed, L. Furstenthal, J. Y. Hsu, B. K. Kaiser, and J. D. Reimann. 2000. The lore of the RINGs: substrate recognition and catalysis by ubiquitin ligases. Trends Cell Biol. 10:429-439.[CrossRef][Medline]
21. Kamura, T., D. Burian, Q. Yan, S. L. Schmidt, W. S. Lane, E. Querido, P. E. Branton, A. Shilatifard, R. C. Conaway, and J. W. Conaway. 2001. Muf1, a novel Elongin BC-interacting leucine-rich repeat protein that can assemble with Cul5 and Rbx1 to reconstitute a ubiquitin ligase. J. Biol. Chem. 276:29748-29753.
22. Kamura, T., D. M. Koepp, M. N. Conrad, D. Skowyra, R. J. Moreland, O. Iliopoulos, W. S. Lane, W. G. Kaelin, Jr., S. J. Elledge, R. C. Conaway, J. W. Harper, and J. W. Conaway. 1999. Rbx1, a component of the VHL tumor suppressor complex and SCF ubiquitin ligase. Science 284:657-661.
23. Kamura, T., S. Sato, D. Haque, L. Liu, W. G. Kaelin, Jr., R. C. Conaway, and J. W. Conaway. 1998. The Elongin BC complex interacts with the conserved SOCS-box motif present in members of the SOCS, ras, WD-40 repeat, and ankyrin repeat families. Genes Dev. 12:3872-3881.
24. Kao, C. C., P. R. Yew, and A. J. Berk. 1990. Domains required for in vitro association between the cellular p53 and the adenovirus 2 E1B 55K proteins. Virology 179:806-814.[CrossRef][Medline]
25. Kibel, A., O. Iliopoulos, J. A. DeCaprio, and W. G. Kaelin, Jr. 1995. Binding of the von Hippel-Lindau tumor suppressor protein to Elongin B and C. Science 269:1444-1446.
26. Kishino, T., M. Lalande, and J. Wagstaff. 1997. UBE3A/E6-AP mutations cause Angelman syndrome. Nat. Genet. 15:70-73.[CrossRef][Medline]
27. Kuhne, C., and L. Banks. 1998. E3-ubiquitin ligase/E6-AP links multicopy maintenance protein 7 to the ubiquitination pathway by a novel motif, the L2G box. J. Biol. Chem. 273:34302-34309.
28. Kumar, S., A. L. Talis, and P. M. Howley. 1999. Identification of HHR23A as a substrate for E6-associated protein-mediated ubiquitination. J. Biol. Chem. 274:18785-18792.
29. Lisztwan, J., G. Imbert, C. Wirbelauer, M. Gstaiger, and W. Krek. 1999. The von Hippel-Lindau tumor suppressor protein is a component of an E3 ubiquitin-protein ligase activity. Genes Dev. 13:1822-1833.
30. Martin, M. E. D., and A. J. Berk. 1998. Adenovirus E1B 55K represses p53 activation in vitro. J. Virol. 72:3146-3154.
31. Mitsudomi, T., S. M. Steinberg, M. M. Nau, D. Carbone, D. D'Amico, S. Bodner, H. K. Oie, R. I. Linnoila, J. L. Mulshine, J. D. Minna, et al. 1992. p53 gene mutations in non-small-cell lung cancer cell lines and their correlation with the presence of ras mutations and clinical features. Oncogene 7:171-180.[Medline]
32. Nakagawa, S., and J. M. Huibregtse. 2000. Human Scribble (Vartul) is targeted for ubiquitin-mediated degradation by the high-risk papillomavirus E6 proteins and the E6AP ubiquitin-protein ligase. Mol. Cell. Biol. 20:8244-8253.
33. Nevels, M., S. Rubenwolf, T. Spruss, H. Wolf, and T. Dobner. 1997. The adenovirus E4orf6 protein can promote E1A/E1B-induced focus formation by interfering with p53 tumor suppressor function. Proc. Natl. Acad. Sci. USA 94:1206-1211.
34. Oda, H., S. Kumar, and P. M. Howley. 1999. Regulation of the Src family tyrosine kinase Blk through E6AP-mediated ubiquitination. Proc. Natl. Acad. Sci. USA 96:9557-9562.
35. Orlando, J. S., and D. A. Ornelles. 1999. An arginine-faced amphipathic alpha helix is required for adenovirus type 5 E4orf6 protein function. J. Virol. 73:4600-4610.
36. Orlando, J. S., and D. A. Ornelles. 2002. E4orf6 variants with separate abilities to augment adenovirus replication and direct nuclear localization of the E1B 55-kilodalton protein. J. Virol. 76:1475-1487.
37. Querido, E., P. Blanchette, Q. Yan, T. Kamura, M. Morrison, D. Boivin, W. G. Kaelin, R. C. Conaway, J. W. Conaway, and P. E. Branton. 2001. Degradation of p53 by adenovirus E4orf6 and E1B55K proteins occurs via a novel mechanism involving a Cullin-containing complex. Genes Dev. 15:3104-3117.
38. Querido, E., R. C. Marcellus, A. Lai, R. Charbonneau, J. G. Teodoro, G. Ketner, and P. E. Branton. 1997. Regulation of p53 levels by the E1B 55-kilodalton protein and E4orf6 in adenovirus-infected cells. J. Virol. 71:3788-3798.[Abstract]
39. Querido, E., M. R. Morison, H. Chu-Pham-Dang, S. W.-L. Thirlwell, D. Boivin, and P. E. Branton. 2001. Identification of three functions of the adenovirus E4orf6 protein that mediate p53 degradation by the E4orf6-E1B55K complex. J. Virol. 75:699-709.
40. Rolfe, M., P. Beer-Romero, S. Glass, J. Eckstein, I. Berdo, A. Theodoras, M. Pagano, and G. Draetta. 1995. Reconstitution of p53-ubiquitinylation reactions from purified components: the role of human ubiquitin-conjugating enzyme UBC4 and E6-associated protein (E6AP). Proc. Natl. Acad. Sci. USA 92:3264-3268.
41. Roth, J., C. König, S. Wienzek, S. Weigel, S. Ristea, and M. Dobbelstein. 1998. Inactivation of p53 but not p73 by adenovirus type 5 E1B 55-kilodalton and E4 34-kilodalton oncoproteins. J. Virol. 72:8510-8516.
41. Roulston, A., R. C. Marcellus, and P. E. Branton. 1999. Viruses and apoplosis. Annu. Rev. Microbiol. 53:577-628.[CrossRef][Medline]
42. Rubenwolf, S., H. Schutt, M. Nevels, H. Wolf, and T. Dobner. 1997. Structural analysis of the adenovirus type 5 E1B 55-kilodalton-E4orf6 protein complex. J. Virol. 71:1115-1123.[Abstract]
43. Ruppert, J. M., and B. Stillman. 1993. Analysis of a protein-binding domain of p53. Mol. Cell. Biol. 13:3811-3820.
44. Sarnow, P., C. A. Sullivan, and A. J. Levine. 1982. A monoclonal antibody detecting the adenovirus type 5-E1b-58Kd tumor antigen: characterization of the E1b-58Kd tumor antigen in adenovirus-infected and -transformed cells. Virology 120:510-517.[CrossRef][Medline]
45. Scheffner, M., B. A. Werness, J. M. Huibregtse, A. J. Levine, and P. M. Howley. 1990. The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53. Cell 63:1129-1136.[CrossRef][Medline]
46. Stebbins, C. E., W. G. Kaelin, Jr., and N. P. Pavletich. 1999. Structure of the VHL-ElonginC-ElonginB complex: implications for VHL tumor suppressor function. Science 284:455-461.
47. Steegenga, W. T., N. Riteco, A. G. Jochemsen, F. J. Fallaux, and J. L. Bos. 1998. The large E1B protein together with the E4orf6 protein target p53 for active degradation in adenovirus infected cells. Oncogene 16:349-357.[CrossRef][Medline]
48. Stracker, T. H., C. T. Carson, and M. D. Weitzman. 2002. Adenovirus oncoproteins inactivate the Mre11-Rad50-NBS1 DNA repair complex. Nature 418:348-352.[CrossRef][Medline]
49. Takagi, Y., R. C. Conaway, and J. W. Conaway. 1996. Characterization of elongin C functional domains required for interaction with elongin B and activation of elongin A. J. Biol. Chem. 271:25562-25568.
50. Takagi, Y., A. Pause, R. C. Conaway, and J. W. Conaway. 1997. Identification of elongin C sequences required for interaction with the von Hippel-Lindau tumor suppressor protein. J. Biol. Chem. 272:27444-27449.
51. Thomas, M., and L. Banks. 1998. Inhibition of Bak-induced apoptosis by HPV-18 E6. Oncogene 17:2943-2954.[CrossRef][Medline]
52. Weigel, S., and M. Dobbelstein. 2000. The nuclear export signal within the E4orf6 protein of adenovirus type 5 supports virus replication and cytoplasmic accumulation of viral mRNA. J. Virol. 74:764-772.
53. Woods, D. B., and K. H. Vousden. 2001. Regulation of p53 function. Exp. Cell Res. 264:56-66.[CrossRef][Medline]
54. Yew, P. R., X. Liu, and A. J. Berk. 1994. Adenovirus E1B oncoprotein tethers a transcriptional repression domain to p53. Genes Dev. 8:190-202.
55. Zheng, N., B. A. Schulman, L. Song, J. J. Miller, P. D. Jeffrey, P. Wang, C. Chu, D. M. Koepp, S. J. Elledge, M. Pagano, R. C. Conaway, J. W. Conaway, J. W. Harper, and N. P. Pavletich. 2002. Structure of the Cul1-Rbx1-Skp1-F boxSkp2 SCF ubiquitin ligase complex. Nature 416:703-709.[CrossRef][Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||
