Both BC-Box Motifs of Adenovirus Protein E4orf6 Are Required To Efficiently Assemble an E3 Ligase Complex That Degrades p53

Small DNA tumor viruses typically encode proteins that eitherinactivate or degrade p53. Human adenoviruses encode products,including E4orf6 and E1B55K, that do both. Each independentlybinds to p53 and inhibits its ability to activate gene expression;however, in combination they induce p53 degradation by the ubiquitinpathway. We have shown previously that p53 degradation relieson interactions of E4orf6 with the cellular proteins Cul5, Rbx1,and elongins B and C to form an E3 ligase similar to the SCFand VBC complexes. Here we show that, like other elongin BC-interactingproteins, including elongin A, von Hippel-Lindau protein, andMuf1, the interaction of E4orf6 is mediated by the BC-box motif;however, E4orf6 uniquely utilizes two BC-box motifs for degradationof p53 and another target, Mre11. In addition, our data suggestthat the interaction of E1B55K with E4orf6 depends on the abilityof E4orf6 to form the E3 ligase complex and that such complexformation may be required for all E4orf6-E1B55K functions.

INTRODUCTION

Top

Introduction

The tumor suppressor p53 plays a major regulatory role in cells(for review, see reference 53). Its activation by stress, includingDNA damage and expression of activated oncogenes, can induceeither cell cycle arrest or apoptosis. In most human tumors,p53 (or components of the p53 pathway) is inactivated, makingsuch cells resistant to growth arrest and cell death. Many smallDNA tumor viruses, including simian virus 40 (SV40), human papillomavirus(HPV), and human adenoviruses, encode proteins that target p53for inactivation, thus presumably enhancing viral replication(reviewed by Roulston et al. [41a]). SV40 large T antigen bindsto p53 (43) and inhibits its ability to bind to DNA and activatetranscription (2). The HPV E6 protein induces the ubiquitinationand degradation of p53 (45). Human adenoviruses produce twoearly proteins, E1B55K and E4orf6, that are capable independentlyof interacting with p53 and inhibiting transactivational activity(7, 11, 24, 30, 33, 54). In addition, they cooperate to causethe ubiquitination and degradation of p53 (7, 18, 37, 38, 41,47).

Inactivation of proteins by degradation commonly involves theubiquitin-dependent proteasome pathway. Target proteins arefirst conjugated to a chain of ubiquitin molecules through theaction of a series of enzymes termed E1 (ubiquitin activating),E2 (ubiquitin conjugating), and E3 (ubiquitin ligase). It isthe role of the E3 ligase, often a multiprotein complex, torecognize the substrates and bridge them with E2 for ubiquitinconjugation. The HPV E6 protein acts as an adapter to bringp53 to a cellular E3 ligase, termed E6AP (3, 40). E6AP—whichhas been shown in noninfected cells to ubiquitinate HHR23A,a human Rad23 homologue (28), Mcm7 (27), and Blk, a Src familymember (34)—is recruited by E6 to new substrates. In additionto p53, E6 redirects E6AP to ubiquitinate hDlg (15), hScrib(32), c-Myc (17), and Bak (51). Mutation of E6AP representsone cause of Angelman syndrome (26).

The adenovirus proteins E4orf6 and E1B55K also redirect a cellularE3 ligase to target p53 for degradation: in this case one thatcontains the cullin family member Cul5, elongins B and C, andthe RING protein Rbx1, which were shown to interact with E4orf6but not E1B55K (18, 37). Cullin-based E3 ligases are part ofthe RING-type group of E3 ligases, which unlike the HECT-typegroup do not form an E3-ubiquitin thioester intermediate (55).These ligases are composed of a cullin family member and theRING protein Rbx1 linked to a protein that acts as a substratespecificity factor. These complexes interact with an E2-conjugatingenzyme, often either Cdc34 or Ubc5, to conjugate ubiquitin chainsto its substrates. In the case of the SCF complex, for whicha crystal structure has been determined (55), Cul1 is linkedby Skp1 to one of many F-box proteins, which serve as the substraterecognition protein (for a review of SCF, see reference 20).In the VBC complex, the linker proteins elongins B and C linkCul2 to the von Hippel-Lindau (VHL) substrate specificity protein.Elongins B and C also serve as a linker for complexes of Cul5,which have been found to exist with presumed substrate specificityproteins Muf1, elongin A, WSB, and SOCS1 (21), although substratesfor these complexes have not yet been identified. Interestingly,VHL has been found to form complexes with both Cul2 and Cul5.Thus far, VHL is the only protein found to interact with morethan one cullin family member (21).

Like the HPV E6 protein, which was initially discovered to degradep53 but later found to induce the degradation of other substrates,the E4orf6 complex probably induces the degradation of othercellular proteins in addition to p53. It has recently been suggestedthat Rad50 and Mre11, components of the double-stranded breakrepair complex, are substrates of the E4orf6 ligase complex(48).

In addition to their function in degradation of p53, E4orf6and E1B55K form a complex that has been implicated in severallate viral functions. Both are required for efficient transportof late viral mRNA transcripts and the block of nuclear exportof cellular mRNAs (reviewed in references 12 and 14). Mutantviruses defective in either of these genes exhibit reduced replicationand progeny production.

Elongin C-interacting proteins, including elongin A, VHL, andSOCS1, have been shown to contain a conserved sequence, termedthe BC-box motif, which is the only region of significant homologybetween elongin A and VHL and which is required for interactionwith elongin C (21, 23). In the present studies on the E4orf6E3 ligase complex, we determined if E4orf6 contains such a motifand if it mediates interactions with elongins B and C in complexformation. We show that E4orf6 contains two functional near-consensusBC-box motifs and that both are needed for efficient E1B55K/E4orf6-induceddegradation of p53 and Mre11. In addition, our results suggestthat E1B55K does not interact directly with E4orf6 as previouslybelieved, but rather that it requires E4orf6 to form a complexwith Cul5 and elongins B and C to bind and to elicit p53 degradationand other functions involved in viral replication. These resultssuggest new functions for the E4orf6 E3 ligase activity relatedto control of mRNA transport and stability.

MATERIALS AND METHODS

Top

Materials and Methods

Cells and cell lines. Human small cell carcinoma H1299 cells (ATCC CRL-5803), carryinga homologous deletion of the p53 gene (31), were cultured inalpha minimal essential medium (Gibco) supplemented with 10%fetal calf serum (FCS; Gibco) containing 100-U/ml penicillinand streptomycin, 0.292-mg/ml L-glutamine (Gibco), and 10% FCS(Gibco). H1299-HACul5 stable cell lines were generated by transfectionwith plasmid DNAs pcDNA3-HACul5 and pcDNA3-puro at a ratio of10:1, followed by selection in medium containing 2-mg/literpuromycin. Individual colonies were picked and expanded, andthe level of expression of HA-Cul5 was verified by Western blottingusing antihemagglutinin (anti-HA) antibodies. A high-expressionclone was chosen for further experiments.

Adenovirus vectors and plasmids. All adenovirus vectors used in this study have been describedpreviously, including Adp53 expressing wild-type (wt) humanp53 under the cytomegalovirus promoter (37), AdHH55K expressingHMK- and histidine-tagged Ad5 E1B55K (38), and AdE4orf6 expressingAd5 E4orf6 (38). Plasmids pcDNA3-E1B55K wt and C184T were obtainedfrom Thomas Dobner (unpublished data), and HA-Cul5 was describedpreviously (37). Putative zinc domain mutants of E4orf6 weredescribed previously (5). BC-box E4orf6 mutants were generatedby PCR-based mutagenesis using the following oligonucleotideprimers: L47G forward, CTGGAGGATCATCCCGGGCTGCCCGAATGTAAC, andreverse GTTACATTCGGGCAGCCCGGGATGATCCTCCAG, with wt pcDNA3-E4orf6as template; L47G/C51 forward, CGGGCTGCCCGAAGTTAACACTTTGACAATG,and reverse, CATTGTCAAAGTGTTAACTTCGGGCAGCCCG, with L47G as template;L122S forward, CGAGTCCTGGGCTAGCCACTGTCATTGTTCC, and reverse,GGAACAATGACAGTGGCTAGCCCAGGACTCG, with wt pcDNA3-E4orf6 as template;and L122S/C126M forward, GCTAGCCACTGTCATATGTCCAGTCCCGGTTCC,and reverse, GGAACCGGGACTGGACATATGTCAGTGGCTAGC, with L122S astemplate. L47G/L122S was created by digesting single mutantsL47G and L122S with EcoRV and combining the mutants. A similarapproach was taken for the quadruple mutant L47G/C51V/L122S/C126M.p53-HA was generated by PCR with the following oligonucleotideprimers: forward, CCCGGATCCACCATGGAGGAGCCGCAGTCA, and reverse,CCCGAATTCGTCTGAGTCAGGCCCTTC. The resulting PCR product was thendigested with BamHI and EcoRI and cloned in frame into the pcDNA3HAtagvector.

Antisera. E4orf6-specific rabbit polyclonal antibody 1807 was describedin reference 4. Anti-p53 pAb1801 hybridoma supernatants wereprepared as described previously (39). E1B55K was detected withthe 2A6 monoclonal antibody (44), elongin C with mouse monoclonalantibody SIII p15 (Transduction Laboratories), Mre11 with rabbitpolyclonal antiserum NB 100-142D3 (NOVUS Biologicals), and HAepitopes with anti-HA mouse monoclonal HA.11 (BabCO).

DNA transfection. Cells were transfected in 60- or 100-mm-diameter dishes withthe liposome reagent DMRIE-C (Gibco-BRL), as described by themanufacturer. For p53 degradation assays, a plasmid DNA ratioof 2:1 was used with 0.75 µg of pcDNA3-p53, 1.5 µgof pcDNA3-E4orf6 (wt or mutants), and 1.5 µg of pcDNA3-E1B55Kin 60-mm-diameter dishes with 11.5 µl of reagent for 24h. When required, the total amount of DNA was made up to 3.75µg by addition of pcDNA3 empty vector DNA. For bindingassays, 2.5 µg of each of the plasmid DNAs was transfectedin 100-mm-diameter dishes using 15 µl of reagent.

Expression of recombinant proteins in Sf21 insect cells. PCR was used to amplify wt elongin C, and elongin C deletionand point mutants containing an HPC4 tag were amplified fromthe corresponding M13mpET-elongin C constructs (50). The resultingfragments were subcloned into pBacPAK8. Baculoviruses encodinghuman elongin B and VHL and adenovirus type 5 E4orf6 were describedpreviously (21, 37). Sf21 cells were cultured at 27°C inSf-900 II SFM (Gibco) with 5% fetal calf serum, penicillin (100U/ml), and streptomycin (100 µg/ml). Plates containing10⁶ Sf21 cells were infected with the recombinant baculovirusesindicated in the figures. Sixty hours after infection, cellswere collected and lysed in 1 ml of ice-cold buffer containing40 mM HEPES-NaOH (pH 7.9), 150 mM NaCl, 1 mM dithiothreitol(DTT), 0.5% (vol/vol) Triton X-100, 10% (vol/vol) glycerol,5-µg/ml leupeptin, 5-µg/ml antipain, 5-µg/mlpepstatin A, and 5-µg/ml aprotinin.

Immunoprecipitation and Western blotting. Cells were lysed for 20 min on ice with lysis buffer (20 mMTris-HCl, pH 7.5, containing 150 mM NaCl, 2 mM EDTA, 1% TritonX-100, 5% glycerol, 2 mM DTT, 4 mM NaF, 2 mM NaPP, 500 µMNa₃VO₄, 200-µg/ml PMSF, 2-µg/ml aprotinin, 5-µg/mlleupeptin). Aliquots of cell extract containing 30 µgof protein were loaded on sodium dodecyl sulfate (SDS)-polyacrylamidegels containing 10 or 15% polyacrylamide for Western blottinganalysis, or between 800 and 1,300 µg (constant withineach experiment), were used for immunoprecipitation using 5µl of rabbit anti-E4orf6 polyclonal antibody 1807 or 7µl of anti-E1B55K mouse monoclonal antibody 2A6, followedby incubation with protein G Sepharose (Amersham Bioscience).The beads were extensively washed in lysis buffer and examinedby SDS-polyacrylamide gel electrophoresis (PAGE), as describedpreviously (37, 39). For analysis of the interaction of elonginC mutants with elongin B and either VHL or E4orf6, approximately100 µg of Sf21 cell lysates were incubated for 2 h at4°C with 10 µl of protein G Sepharose and 2 µgof HPC4 monclonal antibody. Protein G Sepharose was washed threetimes in buffer containing 40 mM HEPES-NaOH (pH 7.9), 150 mMNaCl, 1 mM DTT, and 0.5% (vol/vol) Triton X-100. Immunoprecipitatedproteins were analyzed by SDS-PAGE (13% polyacrylamide) andtransferred to Hybond P membranes (Amersham-Pharmacia Biotech).Membranes were incubated with the indicated antibodies in TBSbuffer (40 mM Tris-HCl, pH 7.6, 100 mM NaCl) containing 3% nonfatdry milk overnight at 4°C, followed by incubation of appropriateperoxidase-conjugated secondary antibodies (Sigma). Membraneswere then visualized by Western blotting with Supersignal WestPico or Dura chemiluminescent reagent (Pierce) or were visualizedand quantitated with the Storm Gel and Blot Imaging System followingtreatment by enhanced chemiluminescence with ECL plus Westernblotting reagents (Amersham-Pharmacia Biotech).

Detection of in vivo ubiquitinated forms of p53. H1299 cells were infected with adenovirus vectors at a multiplicityof infection of 50 PFU per cell for 1 h in 1 ml of serum-freemedium (100-mm dishes) with occasional shaking before additionof normal medium. When indicated, proteasome inhibitor MG132was added at 18 h postinfection (p.i.) at a final concentrationof 20 µM. Cells were lysed at 24 h p.i., and extractswere immunoprecipitated with the 1807 (E4orf6) antibody.

RESULTS

Top

Results

Adenovirus E4orf6 and E1B55K proteins contain putative BC-boxes. We have shown previously that the early human adenovirus proteinE4orf6 associates with the cellular proteins Cul5, elonginsB and C, and Rbx1 to form a complex similar to the SCF-typeligase in the presence or absence of the viral protein E1B55K(37). The complex has even stronger similarity to the VBC complexin which Cul2 is linked to the substrate specificity proteinvia interactions with elongins B and C (19, 22, 29). Interactionof elongin C with VHL, elongin A, SOCS1, and other interactingproteins is mediated through a motif termed the BC-box, containinga consensus sequence (A,P,S,T)LxxxCxxx(A,I,L,V) in which theleucine and cysteine residues (boldface) are almost invariable(23). To determine if the E4orf6 complex has a similar architectureto the VBC complex, the presence of a functional BC-box motifin E4orf6 was investigated. The E4orf6 protein sequence containstwo near-consensus BC-box motifs, each containing both the highlyconserved leucine and cysteine residues (Fig. 1B). A putativeBC-box motif was also found in E1B55K (Fig. 1B). To determineif any of these motifs are functional in forming the E3 complex,site-specific mutations were generated in the leucine and cysteineresidues of each of these sequences, as shown in Fig. 1C. WithE4orf6, mutants were generated either individually in boxes1 (mutants 1 and 2) and 2 (mutants 3 and 4) or in combination(mutants 5 and 6).

View larger version (17K):
[in this window]
[in a new window]
FIG. 1. BC-box sequences and E4orf6 mutants. (A) Consensus BC-box sequence. (B) Putative BC-box sequences in E4orf6 and E1B55K. The sequences of two putative BC-boxes in E4orf6 and one in E1B55K have been presented with residue numbers within the proteins noted. (C) List of BC-box mutants created in E4orf6.

Both BC-box motifs of E4orf6 are functional and mediate interaction with elongin C. The effect of the E4orf6 BC-box mutations was first examinedon stable interactions of E4orf6 with elongin C. p53-null H1299cells were transfected with plasmid DNAs expressing wt or mutantforms of E4orf6 listed in Fig. 1C, and interactions of E4orf6species with elongin C were determined by coimmunoprecipitationusing anti-E4orf6 antibody followed by Western blotting usinganti-elongin C antibodies (Fig. 2A). As seen previously, immunoprecipitationof wt E4orf6 resulted in the coimmunoprecipitation of elonginC. All mutant forms of E4orf6 were expressed at high levels;however, with the exception of mutant 1 (L47G) in E4orf6 BC-box1, all failed to form stable interactions with elongin C. Wealso examined the ability of these E4orf6 proteins to associatewith another member of the complex, Cul5. Because high-qualityantibodies against Cul5 were not available, a stable H1299 cellline expressing HA-tagged Cul5 was generated and such cellswere transfected with plasmid DNAs expressing wt or mutant formsof E4orf6. Cell extracts were immunoprecipitated with anti-E4orf6antibody followed by Western blotting using anti-HA antibodies.Figure 2B shows that wt E4orf6 and E4orf6 mutant 1 (L47G) associatedwith high levels of HA-Cul5, whereas with the other mutantsbinding was greatly reduced or eliminated. Binding of E4orf6to elongin C was also studied in this cell line, and the resultswere identical to those shown in Fig. 2A (data not shown). Thus,although the invariant Leu47 residue in BC-box 1 was not essential,it appeared that high levels of binding of E4orf6 to elonginC and the formation of the E3 ligase complex containing Cul5require both E4orf6 BC-boxes 1 and 2.

View larger version (34K):
[in this window]
[in a new window]
FIG. 2. Effects of BC-box mutations on the activity of E4orf6. H1299 cells (A, C, and D) or H1299 cells stably expressing HA-tagged Cul5 (B) were transfected with plasmid DNAs encoding wt or mutant E4orf6. (A and B) Whole-cell lysates were immunoprecipitated (IP) with anti-E4orf6 antibody 1807 and then subjected to Western blotting analysis with anti-elongin C (ElonC) (A) or anti-HA (B) antibodies. The use of wt or mutant E4orf6 (mutants identified in Fig. 1C) or no E4orf6 (–) has been indicated at the top of each lane. The top two panels represent Western blotting analyses for elongin C or Cul5 (A and B, respectively), using shorter and longer exposures of the gel. The bottom two panels represent Western blotting analyses of whole-cell extracts for E4orf6 and elongin C levels, as indicated. (C and D) Whole-cell lysates were analyzed for p53 or Mre11 expression levels by Western blotting using anti-p53 (C) or anti-Mre11 (D) antibodies. The plasmid DNAs used to transfect cells have been indicated at the top of each figure, and Western blotting analyses have been indicated for each panel.

To examine the effect of putative BC-box mutations in E4orf6and E1B55K on the functionality of the E3 ligase complex inpromoting degradation of p53, a degradation assay was used inwhich H1299 cells were transiently transfected with plasmidDNAs encoding human wt p53 and wt E4orf6 and E1B55K or the mutantE4orf6 forms listed in Fig. 1C. Degradation of p53 was assessedat 24 h posttransfection by Western blotting using anti-p53antibodies. Complete degradation of p53 with wt viral proteinswas observed at a DNA transfection ratio of 2:2:1 (or higher)for E4orf6-E1B55K-p53 (data not shown), and thus this ratiowas used for further experiments. A representative result frommany p53 degradation assays is shown in Fig. 2C. As with thebinding assays, mutant 1, which contains a single L47G pointmutation in box 1, was found to be functionally wt in its abilityto degrade p53 (lane 4 versus 3); however, all other E4orf6mutants were to various degrees defective in promoting p53 degradation.Interestingly, mutations in both BC-boxes were required forcomplete loss of p53 degradation (mutants 5 and 6). (Note thatadditional studies [not shown] in which higher levels of mutant5 were expressed yielded a similar failure to support p53 degradation.)Mutation in only one of the boxes resulted in no effect (mutant1) or a partial effect (mutants 2 to 4).

In addition to p53, two other substrates of the adenoviral E4orf6protein have recently been identified, Rad50 and Mre11 (6, 48),which are subunits of a double-stranded DNA repair complex.We have been unable to demonstrate the E4orf6-E1B55K-dependentdegradation of Rad50 in our system (data not shown); however,Fig. 2D shows results obtained with Mre11. Again, degradationwas determined in extracts from cells expressing E1B55K andwt or mutant E4orf6 that were analyzed by Western blotting usinganti-Mre11 antibodies. The results showed a pattern similarto that obtained with p53 in that E4orf6-dependent degradationof Mre11 occurred at high levels with wt E4orf6 and mutant 1(L47G), but was severely reduced in mutants 5 and 6 in whichthe conserved leucines and cysteines in both BC-boxes 1 and2 were altered. Taken together, these results confirmed thefunctional importance of both E4orf6 BC-boxes.

To study the nature of the E4orf6-elongin C interaction, theability of a series of elongin C deletion mutants (see the listin Fig. 3A) to form complexes with BC-box proteins, includingE4orf6, was tested. Sf21 insect cells were coinfected with baculovirusesexpressing wt or mutant forms of HPC4-tagged elongin C, elonginB, and with BC-box protein VHL or E4orf6. Elongin C was immunoprecipitatedfrom whole-cell extracts with anti-HPC4 antibodies, and thecoprecipitation of the other proteins was analyzed by Westernblotting using appropriate antibodies. Figure 3 shows the resultsof this study. As shown previously (49), a region of elonginC near the amino terminus, between residues 15 and 30, appearsto be required for binding elongin B, as two deletion mutants,23-112 and ${Delta}$ 21-30 both failed to interact significantly withelongin B, whereas the other amino-terminal mutants, including15-112 and ${Delta}$ 31-40, retained the interaction. (Fig. 3B and C).In addition, elongin C mutants 23-112 and ${Delta}$ 21-30 interact withboth VHL and E4orf6 less efficiently than the wt, consistentwith previous observations that stable binding of elongin Cto VHL, elongin A, and other BC-box proteins depends on elonginB (1, 13, 23, 25). The region of elongin C deleted from thesemutants forms strands 1 and 2, which have been shown to participatein interactions with elongin B (46). While there are no directcontacts between strands 1 and 2 and VHL, loss of interactionwith elongin B could destabilize the structure of the regionthat interacts with VHL. The results obtained with VHL (Fig.3B) and E4orf6 (Fig. 3C) all indicated that the carboxy-terminalregion of elongin C appears to be required for interaction withBC-box motifs, as deletion mutants starting at residues 71 to80 resulted in the loss of stable interactions with both VHLand E4orf6. These results are consistent with published datafor VHL (50) and with the VHL-elongin BC crystal structure (46),which showed that the carboxy-terminal region of elongin C formshelices H3 and H4 and loop L5, which are critical for the interactionwith VHL. Taken together, our comparison of the abilities ofthe elongin C mutants to assemble into complexes with VHL andE4orf6 suggests that the interaction between E4orf6 and elonginC resembles that of VHL and that E4orf6 forms an E3 ligase complexin a manner similar to VHL in the VBC complex.

View larger version (33K):
[in this window]
[in a new window]
FIG. 3. Analysis of complex formation using elongin C mutants. (A) Representation of elongin C deletion mutants. (B and C) Sf21 insect cells were coinfected with baculovirus vectors encoding HPC4-tagged elongin C or elongin C mutants, elongin B (ElonB), and either VHL (B) or E4orf6 (C). Sf21 cell lysates were immunoprecipitated (IP) with HPC4 monoclonal antibody, which recognizes the epitope tag on elongin C, and analyzed by Western blotting against the indicated proteins.

E1B55K does not interact with elongin C in the absence of E4orf6. Because a putative BC-box motif was noted in the E1B55K, theability of E1B55K to bind elongin C and Cul5 in the absenceof E4orf6 was investigated in coimmunoprecipitation and Westernblotting studies similar to those in Fig. 2 and 3. Figure 4Ashows that, as shown before, E4orf6 interacts strongly withelongin C (lanes 1 and 5) and Cul5 (lane 5), whereas these specieswere only associated with E1B55K when E4orf6 was coexpressed(lane 3 versus 4 for elongin C and lane 7 versus 8 for Cul5).As in Fig. 2B, the Cul5 interaction was determined by usingH1299 cells that express HA-Cul5 (lanes 5 to 9). Figure 4B showsthat, as expected from the lack of interaction of wt E1B55Kwith elongin C, the presence of a mutation in the conservedCys residue within the putative BC-box motif (C184T) of E1B55Khad no effect on the interaction of E4orf6 or E4orf6 mutantL47G (m1) with either Cul5 or elongin C. In studies similarto those in Fig. 2D, E1B55K mutant C184T was also found to befully functional in the induction of Mre11 degradation (Fig.4C) and p53 (data not shown). These results suggested that onlyE4orf6 contributes to E3 ligase complex formation and that E1B55Kis present in the complex through its interaction with E4orf6.

View larger version (28K):
[in this window]
[in a new window]
FIG. 4. Requirement of E1B55K BC-box. (A) H1299 or H1299-HACul5 cells (lanes noted at bottom of the figure) were transfected with plasmid DNAs expressing E1B55K and/or E4orf6, as indicated at the top of the figure. Whole-cell lysates were either first immunoprecipitated (IP) (top two panels) using either 1807 anti-E4orf6 or anti-E1B55K antibodies as indicated on top of the figure or examined directly (bottom four panels) by Western blotting with antibodies against HA (for HA-Cul5), E1B55K, E4orf6, or elongin C (Elon C), as indicated in the figure. (B) H1299-HACul5 cells were transfected with combination of plasmid DNAs expressing wt or BC-box mutants of E1B55K (C184T) and E4orf6 (functional mutant 1, L47G), as indicated at the top of the figure. As in panel A, immunoprecipitates prepared using 1807 anti-E4orf6 antibodies or whole-cell extracts were examined by Western blotting using antibodies against HA (HA-Cul5), elongin C, E1B55K, or E4orf6, as indicated in the figure. (C) H1299 cells were transfected with the combination of plasmid DNAs expressing E4orf6 and the wt or BC-box mutant of E1B55K (C184T), as indicated at the top of the figure. Whole-cell lysates were analyzed for Mre11 expression levels by using anti-Mre11 antibodies.

Function of E1B55K in the ubiquitination of p53 and Mre11. To confirm that the degradation of p53 induced by E4orf6 andE1B55K was due to ubiquitin-dependent proteasomal degradation,the existence of ubiquitin chains on p53 was examined in thepresence of proteasome inhibitors. To detect only ubiquitinchains of p53 molecules produced due to the action of the E4orf6-E1B55Kcomplex, extracts from cells that had been coinfected with adenoviralvectors expressing p53 and E4orf6 and/or E1B55K were immunoprecipitatedwith anti-E4orf6 antibodies and the precipitates were immunoblottedfor p53 with anti-p53 antibodies. Figure 5A shows clearly thatunder conditions that result in significant degradation of p53(bottom panel without proteasome inhibitor), more p53 was presentin association with E4orf6 when E1B55K was also coexpressed(top panel). As the ratio of adenovirus vectors used for thisexperiment was a 1:1:1 ratio (compared to 1:2:2 in transfectionexperiments), complete degradation of p53 is not observed atthis 24-h time point. When this immunoblot was exposed for alonger period, the presence of ubiquitin chains on p53 becameevident through the appearance of heterogeneous material migratingmore slowly than p53. Although this ubiquitinated material wasmore evident when E1B55K was also coexpressed, it was neverthelessalso evident in extracts from cells expressing E4orf6 in theabsence of E1B55K. Moreover, the ratio of slower-migrating ubiquitinatedmaterial between samples with and without E1B55K was approximatelythe same as the ratio of p53 bound to E4orf6 in the presenceor absence of E1B55K. This observation may also provide an explanationto the question of what the role of E1B55K is in the degradationof p53, as E4orf6 can both bind to p53 and form the E3 ligasecomplex. Thus the function of E1B55K would be to enhance theintroduction of the p53 substrate into the E4orf6 complex forubiquitination and degradation. In the absence of E1B55K, p53was less efficiently recruited to the E3 ligase, but nevertheless,approximately the same fraction of those p53 molecules thatdid bind E4orf6 could be ubiquitinated.

View larger version (41K):
[in this window]
[in a new window]
FIG. 5. Role of E1B55K in the binding and ubiquitination of p53 and the binding of Mre11. (A) p53-H1299 cells were infected with combinations of adenoviral vectors expressing p53, E1B55K, or E4orf6, as indicated at the top of the figure. Half of the cultures were treated with proteasome inhibitor (prot. inh) MG132 at 50 nM from 18 to 24 h p.i. At 24 h p.i. whole-cell extracts were immunoprecipitated (IP) using 1807 anti-E4orf6 antibodies and the precipitates were analyzed by Western blotting using anti-p53 antibodies. The presence of slower-migrating ubiquitinated forms of p53 [(Ub)n-p53] has been noted. Shorter and longer exposures (exp.) of the gel have been included, as indicated. (B) H1299 cells were transfected with plasmid DNAs expressing E4orf6 and/or E1B55K, as indicated. Whole-cell extracts were immunoprecipitated with either anti-E4orf6 or anti-E1B55K antibodies followed by Western blotting analysis using anti-Mre11 antibodies.

This model for the function of E1B55K was then tested with theother known substrate of the E4orf6-E1B55K complex, Mre11. Figure5B shows that immunoprecipitation of E1B55K resulted in thecoimmunoprecipitation of Mre11. Figure 5B also shows that inthe case of E4orf6, Mre11 was coimmunoprecipitated in the presenceof anti-E4orf6 antibodies only when E1B55K was also expressed.Detection of Mre11 coprecipitating with E1B55K in the presenceof both viral proteins is possible due to the incomplete degradationof endogenous Mre11 at this time point of 24 h. Near-complete(since not all cells are transfected) degradation of Mre11 (asin Fig. 2D) is only seen at the 48-h time point. Thus with Mre11,which does not interact directly with E4orf6, E1B55K functionsto introduce the Mre11 substrate into the E4orf6 complex forubiquitination and degradation.

Stable binding of E1B55K to E4orf6 requires intact BC-box motifs in E4orf6. The BC-box mutants were also tested for their ability to interactstably with E1B55K and p53. H1299 cells were cotransfected withplasmid DNAs expressing mutant or wt E4orf6 and either E1B55Kor human wt p53. Following immunoprecipitation with anti-E4orf6antibodies, the presence of E1B55K and p53 was assessed by Westernblotting using the appropriate antibodies. Figure 6A shows that,somewhat surprisingly, all BC-box mutants except BC-box 1 mutant1 (L47G), which was shown to be wt for p53 degradation, lostthe ability to interact with E1B55K. This loss of interactioncould not simply be due to misfolding of these E4orf6 mutantproteins as Fig. 6B shows that all E4orf6 mutant proteins werestill able to bind to p53.

View larger version (44K):
[in this window]
[in a new window]
FIG. 6. E4orf6-E1B55K interactions correlate with elongin C-Cul5 complex formation. (A and B) Binding of E1B55K and p53 by E4orf6 mutants. H1299 cells were transfected with plasmid DNAs expressing wt or mutant (as identified in Fig. 1C) E4orf6 and E1B55K (A) or p53 (B). Whole-cell extracts were immunoprecipitated (IP) with 1807 anti-E4orf6 antibodies, and interactions with E1B55K (A) or p53 (B) were verified by Western blotting using appropriate antibodies.

The characteristics demonstrated for the E4orf6 BC-box mutants(specifically the loss of 55K binding, loss of the ability todegrade p53, and retention of p53 binding) were highly reminiscentof a set of E4orf6 mutants generated to disrupt a putative zinc-bindingdomain of E4orf6 (5), as summarized in Fig. 7A. Thus it waspossible that these mutants also had lost the ability to formstable complexes with elongin C and Cul5. This possibility wastested in coimmunoprecipitation experiments similar to thosein Fig. 2. Figure 7A shows that all such mutants that had lostthe ability to bind E1B55K and to degrade p53 had also lostthe ability to form stable interactions with elongin C. Theseresults further confirmed the importance of formation of theE3 ligase complex for the interaction of E4orf6 with E1B55K.As noted at the top of Fig. 7A, results from previous studies(5) indicated a correlation between the ability of E4orf6 toform the complex and to complement growth of a mutant adenovirusthat fails to express all E4 products. Complex formation wasalso examined with an extensive series of E4orf6 point mutantsin the amphipathic ${alpha}$ -helical region, for which similar viralgrowth complementation data had been obtained (36). The resultsof this experiment and the complementation data are summarizedin Table 1, with binding results presented with representativemutants shown in Fig. 7B. Table 1 shows that these mutants canbe separated into three groups. Group 1 consists of mutantsthat complement an E4 deletion for normal virus production andhave wt or nearly wt binding activities with both elongin Cand E1B55K. Group 2 mutants do not complement nor bind eitherE1B55K or elongin C. Group 3 mutants both complement and bindto elongin C; however, interaction with E1B55K was undetectable.These results demonstrate that the formation of E3 ligase complexfor functional activity of E4orf6 in the growth of the virusis paramount and perhaps even more important than its interactionwith E1B55K.

View larger version (33K):
[in this window]
[in a new window]
FIG. 7. Formation of the cullin complex correlates with E4orf6 functional activity in adenovirus-infected cells. (A) Binding to elongin C (Elon C) of E4orf6 mutants in the putative zinc-binding domain. The top panel shows a summary of results obtained by Boyer and Ketner (5) with putative zinc-binding domain E4orf6 mutants. The bottom two panels show results obtained with these mutants following Western blotting analysis using anti-elongin C antibodies of immunoprecipitates (IP) prepared using 1807 anti-E4orf6 antibodies (middle panel) or 1807 anti-E4orf6 antibodies using whole-cell extracts. (B) Binding to elongin C and E1B55K of representative members (with mutant group indicated in parentheses) of E4orf6 mutants in the amphipathic ${alpha}$ -helical region. H1299 cells were transfected with plasmid DNAs expressing wt or the indicated E4orf6 mutants and E1B55K. Whole-cell extracts were immunoprecipitated with 1807 antibodies, and interactions with E1B55K and elongin C were verified by Western blotting with appropriate antibodies.

View this table:
[in this window]
[in a new window]
TABLE 1. Analysis of the interaction of a series of E4orf6 mutants in the amphipathic ${alpha}$ -helix domain^a

DISCUSSION

Top

Discussion

The present results indicate that the adenovirus E4orf6 complexrepresents, both structurally and functionally, an E3 ubiquitinligase complex that greatly resembles the VBC complex. As withthe VHL tumor suppressor protein, the interaction of E4orf6with elongin C also appears to be mediated through a BC-boxmotif; however, E4orf6 is unusual in that it appears to possesstwo functional BC-box motifs. While it remains formally possiblethat only one of these BC-box motifs is functional, mutationof each box individually was found to be sufficient to greatlyreduce interactions with elongin C; some transient in vivo interactionsmust still exist with these single-motif mutants as full lossof function required mutation of both BC-boxes. Although datafrom the binding and activity assays of the different E4orf6mutants (Fig. 2) were not fully quantitative, it was clearlyapparent in these semiquantitative assays (Fig. 2C) that degradationactivity is significantly reduced when both BC-box motifs aremutated (mutants 5 and 6) as compared to single-motif mutants(mutants 1 to 4). The reason for the requirement for two BC-boxmotifs in E4orf6 is not clear. According to the crystal structurefrom Stebbins et al. (46), elongin C can interact with onlyone BC-box motif, leaving a distinct possibility that only oneof the E4orf6 motifs indeed interacts with elongin C, as inthe case of VHL, while mutation in the other presumptive BC-boxmay disrupt other aspects of E4orf6 structure that are importantfor its interaction with elongin C. It is also possible thatboth sequences are bona fide BC-box motifs. While only one maybe interacting with elongin C at any time, the presence of twomotifs in adenovirus E4orf6 may have evolved to better competewith cellular BC-box proteins for binding to elongin C. In whichcase, when dissociation of the interaction occurs, elongin Cwould be more likely to reassociate with E4orf6, through useof either of the motifs. The same carboxy-terminal region ofelongin C was shown to be involved in interactions with VHLand E4orf6, thus further demonstrating the similarity of theseE3 ligase complexes.

It has been recently shown that adenovirus infection inducesthe degradation of Mre11 and Rad50, two components of the double-strandbreak repair complex Mre11-Rad50-NBS1. Studies with virus mutantsimplicated both E1B55K and E4orf6 in this degradation processand furthermore suggested a role for the viral E4orf3 proteinin their relocalization from the viral inclusion bodies to PML-containingnuclear tracks (48). Using our degradation system involvingtransient coexpression of E4orf6 and E1B55K in the absence ofother adenovirus proteins, we were unable to confirm the degradationof Rad50 by E4orf6 and E1B55K; however, degradation of Mre11induced by these proteins was quite marked. It is possible thatone or more additional viral proteins are required for efficientdegradation of Rad50; however, it seems more likely that degradationof Rad50 is not a direct effect of the E4orf6/E1B55K E3 ligasecomplex, but rather results from a decrease in Rad50 due tothe disruption of the Mre11-Rad50-NBS1 complex when Mre11 isdegraded.

Unlike the BC-box motifs present in E4orf6, that present inE1B55K does not appear to be necessary for the function of theE3 ligase. Furthermore, it did not appear to be capable of interactingwith elongin C or recruiting Cul5 (Fig. 4A) (18). It is possiblethat this BC-box motif may not be exposed and thus is not accessibleto elongin C following formation of the final tertiary structureof E1B55K. In this regard, it is of interest to note that E1B55Kproteins containing two other mutations in this motif (L180A/C184Sand L180P/C184F) are highly unstable (data not shown).

In addition to forming the Cul5 complex, E4orf6 has been knownfor some time to bind to p53 in the absence of E1B55K. Thuswhat is the role of E1B55K in the degradation of p53 by theE4orf6 complex? Clearly E1B55K is required, as E4orf6 degradesp53 very poorly in its absence. Two explanations appear plausible.First, although p53 may bind to E4orf6 in the E3 ligase complex,E1B55K may be required to achieve an optimal orientation forthe ubiquitination reaction. And second, although E4orf6 bindsp53, much higher levels of p53 substrate may be introduced intothe E4orf6-E3 ligase complex when E1B55K is present. The resultspresented in Fig. 5A suggest that the second explanation isthe most likely. In the absence of E1B55K, only a small amountof p53 is associated with the E4orf6 complex. Thus the presenceof E1B55K greatly increases the levels of p53 available fordegradation; however, a similar fraction of the p53 associatedwith the E4orf6 complex was found to be ubiquitinated in thepresence and absence of E1B55K. Thus, E1B55K probably functionsto introduce high levels of p53 into the complex. Our favoredmodel is that E4orf6 forms the E3 ligase complex involved inubiquitination followed by proteasomal degradation and thatE1B55K introduces substrates for degradation, including p53,Mre11, and most likely additional as yet unidentified cellularor viral proteins. As shown in coimmunoprecipitation experiments,only E1B55K (and not E4orf6) binds Mre11. The ability of E4orf6to interact directly with p53 may be unique among targets ofthe E4orf6 degradation complex. Thus the ability of E4orf6 toblock the transactivational activity of p53 may serve some functionto the virus in addition to E3 ligase complex formation andubiquitination.

An unexpected result was the failure of E1B55K to interact withE4orf6 BC-box mutants that were defective in E3 ligase complexformation. We believed it likely that the E4orf6 BC-box mutationswould abolish complex formation with the cellular proteins elonginC and Cul5; however, the interaction between E4orf6 and E1B55Khas been known for some time and believed to be direct. Thislack of binding cannot simply be attributed to general misfoldingof the E4orf6 BC-box mutants, as all formed stable interactionswith p53. In explaining this effect, we propose that E1B55Kdoes not interact directly with E4orf6, but rather interactswith the E3 ligase complex that E4orf6 has assembled. In otherwords, E1B55K only associates with E4orf6 once it has assembledthe cellular E3 ligase complex, as shown in Fig. 8. Complexformation may alter the conformation of E4orf6 to expose theE1B55K binding site or stabilize the E4orf6-E1B55 interaction.It is also possible that E1B55K makes contact with both E4orf6and one or more members of the cellular Cul5-containing complex.Whatever the case, these results may explain some previous observationsabout E4orf6. It had been observed that newly synthesized E4orf6only associates with E1B55K 1 to 2 h following its synthesis(10). This effect might be explained by the time required forthe newly synthesized E4orf6 to be assembled into the E3 ligasecomplex. In addition, other groups have reported difficultyin detecting interactions between E1B55K and E4orf6 in vitro(24, 42). Further, E4orf6 and E1B55K were not found to interactin the yeast two-hybrid system (42). The last two observationswould make sense if cellular proteins were required for theinteraction. In addition, little interaction between E4orf6and E1B55K is evident in many rodent cell lines, suggestingthat a primate-specific factor may be required (16). This componentis probably not Cul5 or elongin B or C as (i) these proteinsare nearly identical in rodents and humans and (ii) the genesencoding these proteins are not localized on human chromosome21, to which the major primate-specific activity was mapped(8). These possibilities may explain some controversy aboutthe location of the E1B55K binding site on E4orf6. Some evidencehas suggested that the E1B55K binding site resides in the first55 amino-terminal residues of E4orf6 (39, 42), whereas othershave suggested that the amphipathic ${alpha}$ -helical region towardsthe carboxy terminus of E4orf6 plays a role (7, 35, 52). Futurestudies will be required to define such interactions further.

View larger version (21K):
[in this window]
[in a new window]
FIG. 8. Schematic representation of E4orf6-E1B55K-elongin-Cul5 complex formation. (A) Interaction of E4orf6 with elongin C (C) is predicted to occur via either one of the E4orf6 BC-boxes to form a complex also containing elongin B (B), Cul5 modified by addition of Nedd8, Rbx1, and an E2 ligase. (B) E1B55K interacts with substrates to be ubiquitinated and degraded, including p53, Mre11, and others, possibly those involved in mRNA export. (C) Formation of the entire complex and the positioning of the substrate for ubiquitination occur primarily through the interaction between E4orf6 and E1B55K. E4orf6 may not interact directly with Mre11 and other substrates, apart from p53. E1B55K may interact with one or more members of the elongin-Cul5 complex (denoted by ?).

Other published observations also support the present modelfor E4orf6-E1B55K interaction. Harada et al. (18) showed usinggel filtration of nuclear extracts that E1B55K and E4orf6 arepart of a very large complex of 800 to 900 kDa that includesCul5, elongin B, elongin C, Rbx1, and other proteins and thatthere was no E1B55K complex of the size expected for an E4orf6-E1B55Kdimer or tetramer. Thus these data support the contention thatE1B55K interacts with E4orf6 only after the formation of complexeswith cellular proteins, including Cul5 and elongins B and C.

Studies on the three sets of E4orf6 point mutants presentedherein have also led to additional insights about E4orf6-E1B55Kfunction and complex structure. From the combined data withthe three sets of E4orf6 mutants, it appears that in additionto the elongin C-BC-box interaction, other regions of E4orf6may form interactions with other members of the complex. Mostor all of these interactions would be required for a strongstable interaction detectable by coimmunoprecipitation, sincemutations in any of these domains result in a loss of detectablebinding. One of these additional interactions may be with Cul5as E4orf6 forms a complex only with Cul5 and not with Cul2 (37).As Cul2 is also known to interact with VHL through elonginsB and C, our results suggest that the specificity of E4orf6for Cul5 may be regulated through direct interactions with Cul5.Further studies will be required to confirm this possibility.A series of point mutations in a putative zinc finger domainyielded E4orf6 mutant proteins with properties similar to thoseof the BC-box mutants. These mutants exhibited loss of E1B55Kbinding and relocalization to the nucleus, and they were defectivefor p53 degradation. Like the E4orf6 BC-box mutants, they werestill able to bind p53. These similarities suggested that likethe BC-box mutants, the putative zinc-binding domain mutantsmay be unable to form the E3 ligase complex, a prediction thatwas largely confirmed in the present studies. These mutantshad also been shown previously to fail to complement an adenovirusdeletion mutant lacking the complete E4 region for expressionof high levels of late viral proteins. Also, a series of pointmutations in the amphipathic ${alpha}$ -helical region of E4orf6 yieldedthree mutant phenotypes (Table 1). Again a good correlationwas seen between complex formation and binding to E1B55K asgroup 2 mutants that failed to bind elongin C also failed tobind E1B55K. Thus E3 ligase complex formation may be requiredfor all functions requiring both E4orf6 and E1B55K, includingexport of late viral mRNA and inhibition of export of cellularmRNAs. This conclusion agrees well with the observations ofCorbin-Lickfett and Bridge (9), who conclude that active proteasomesare required for E4orf6 to promote late gene expression. Thispossibility suggests that degradation of as yet unidentifiedcellular proteins by the E3 ligase complex may function in thecontrol of mRNA metabolism. Lastly, it is worth noting thatgroup 3 mutants in the amphipathic ${alpha}$ -helical region (Table 1)complement the E4 adenovirus deletion mutant even though theydo not appear to interact with E1B55K. While it remains possiblethat E1B55K interacts transiently or at low undetectable levelswith these mutant species, it is also possible that the E4orf6E3 ligase complex in the absence of E1B55K can provide someof the functions required to support adenovirus replication.In fact, with all the mutants tested in this study, a perfectcorrelation was evident between E3 ligase complex formationand complementation of the E4 defect, whereas such was not withthe case with binding to E1B55K. Further studies are under wayto examine these possibilities using appropriate E4orf6 andE1B55K mutant viruses.

ACKNOWLEDGMENTS

This work was supported by grants from the Canadian Institutesof Health Research (P.E.B.), the National Cancer Institute ofCanada (P.E.B.), and the U.S. National Institute of GeneralMedicine (R.C.C.). Paola Blanchette had a Canderel Fellowshipfrom the McGill Cancer Centre.

FOOTNOTES

* Corresponding author. Mailing address: McGill University, McIntyre Medical Building, 3655 Promenade Sir William Osler, Montreal, Quebec, Canada H3G 1Y6. Phone: (514) 398-7263. Fax: (514) 398-8845. E-mail: philip.branton{at}mcgill.ca.

REFERENCES

Top