This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An erratum has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ghosh, M.
Right arrow Articles by Leffak, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ghosh, M.
Right arrow Articles by Leffak, M.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, December 2004, p. 10193-10207, Vol. 24, No. 23
0270-7306/04/$08.00+0     DOI: 10.1128/MCB.24.23.10193-10207.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Transcription Factor Binding and Induced Transcription Alter Chromosomal c-myc Replicator Activity

M. Ghosh, G. Liu, G. Randall, J. Bevington, and M. Leffak*

Department of Biochemistry and Molecular Biology, Wright State University School of Medicine, Dayton, Ohio

Received 12 May 2004/ Returned for modification 17 June 2004/ Accepted 7 September 2004


arrow
ABSTRACT
 
The observation that transcriptionally active genes generally replicate early in S phase and observations of the interaction between transcription factors and replication proteins support the thesis that promoter elements may have a role in DNA replication. To test the relationship between transcription and replication we constructed HeLa cell lines in which inducible green fluorescent protein (GFP)-encoding genes replaced the proximal ~820-bp promoter region of the c-myc gene. Without the presence of an inducer, basal expression occurred from the GFP gene in either orientation and origin activity was restored to the mutant c-myc replicator. In contrast, replication initiation was repressed upon induction of transcription. When basal or induced transcription complexes were slowed by the presence of {alpha}-amanitin, origin activity depended on the orientation of the transcription unit. To test mechanistically whether basal transcription or transcription factor binding was sufficient for replication rescue by the uninduced GFP genes, a GAL4p binding cassette was used to replace all regulatory sequences within ~1,400 bp 5' to the c-myc gene. In these cells, expression of a CREB-GAL4 fusion protein restored replication origin activity. These results suggest that transcription factor binding can enhance replication origin activity and that high levels of expression or the persistence of transcription complexes can repress it.


arrow
INTRODUCTION
 
Models for DNA replication in eukaryotes derive significantly from studies of Saccharomyces cerevisiae and Xenopus laevis systems, in which prereplication complexes (pre-RCs) containing the hexameric origin recognition complex ORC, Cdc6, and the minichromosome maintenance proteins are activated by the cell cycle-regulated kinases Cdc7/Dbf4 and cyclin-dependent kinases to unwind DNA and load DNA polymerases for the initiation of DNA synthesis (reviewed in reference 8). Although replication origins in higher organisms do not generally display the conserved size, sequence, or structure of replicators in S. cerevisiae, this overall series of events appears to be conserved in fission yeast and metazoan somatic cells, and the demonstration that chromosomal regions involved in the initiation of replication can promote replication when transferred to ectopic chromosomal sites provides genetic evidence for the existence of defined replicator elements that can control replication initiation in the chromosomes of multicellular organisms (1, 2, 4, 51, 52).

Replication origins are frequently found upstream of eucaryotic transcription units (reviewed in reference 57), consistent with the suggestion that transcription and replication may be oriented to coordinate transcription and replication fork movement (13, 27, 50). Transcribed sequences are generally replicated earlier in S phase in the cells where they are expressed than in cells where they are not (22, 76), possibly as a result of the modification of chromatin structure by transcription factors (48). However, several investigators report positive (11, 19, 21, 25, 34, 36, 47, 53, 66, 86) or negative (11, 43, 53) effects of transcription factors on DNA replication, either directly through the binding of replication proteins or indirectly via modulation of chromatin structure. Alternatively, it has been suggested that cells may replicate active sequences prior to gene expression as a mechanism to avoid disruption of pre-RCs by the passage of the transcriptional machinery (12, 28, 57).

Multiple transcription factor binding sites and transcription regulatory elements are located in the 2.4-kb region upstream of the human c-myc gene (32, 33, 58). Our laboratory initially reported that replication initiates in this region (46, 54, 55), and Vassilev and Johnson first used quantitative PCR (Q-PCR) to define the replication initiation zone (83). Subsequent reports have confirmed these observations (21, 80, 82, 84) and shown that plasmids containing the 2.4-kb fragment of the c-myc 5' flanking DNA replicate autonomously in vivo and in vitro (10, 38, 54-56, 64, 82). In Xenopus and mouse cells, replication initiates at the corresponding locations relative to the c-myc genes (29). When moved to an ectopic site in the HeLa genome, the 2.4-kb human c-myc core origin fragment promotes replication initiation in the sequences flanking its insertion site, providing genetic evidence for its function as a chromosomal replicator (51, 52). The 2.4-kb core origin fragment harbors an in vivo DNA unwinding element (DUE) (7, 23, 58) flanked by three matches to the S. cerevisiae 11-bp autonomously replicating sequence consensus sequence. Deletion of the DUE or of fragments comprising putative transcription factor binding sites eliminates chromosomal replicator activity (51).

In a direct test of the effect of transcription on the activity of the c-myc replicator in a chromosomal environment we used a genomic integration approach to analyze replicator constructs in which inducible green fluorescent protein (GFP) genes replaced the c-myc promoter and transcription factor binding site region. To avoid variable chromosomal position effects, clonal cell lines were constructed that contained each c-myc replicator integrant at the same genomic location (51, 52). In stably transfected cells the chromatin of the ectopic c-myc integrants was hyperacetylated. While deletion of the transcription factor binding region eliminated origin activity, fusion of the inactive c-myc replicator upstream region to the GFP transcription unit restored replicator activity to levels above those of the wild-type c-myc sequence. Upon the induction of transcription no large-scale changes in chromatin structure were detected, but origin activity was repressed back to roughly the level of the wild-type replicator. These observations indicate that the structure of the replicator upon transcription factor binding or basal expression is qualitatively different than that seen following induction. When a CREB-GAL4 fusion protein was targeted to an integrated c-myc replicator construct from which all promoter elements within ~1,400 bp 5' of the c-myc gene had been deleted, origin activity was strongly enhanced. Mechanistically, these results imply that transcription factor binding can enhance replication initiation independently of its effect on transcription.


arrow
MATERIALS AND METHODS
 
Cell culture and DNA isolation. HeLa cells were maintained in Dulbecco's modified Eagle medium (DMEM) with 10% newborn calf serum (Invitrogen) and 10 µg of gentamicin/ml in a humidified 5% CO2 atmosphere at 37°C. GFP expression was induced with doxycycline (1 µM) for 6 or 24 h. To arrest transcription, uninduced cells or cells treated 6 h earlier with doxycycline were treated with 50 µg of {alpha}-amanitin/ml for 1 h.

Plasmid constructs and transfections. Construction of the pHyg.FRT.TK acceptor site plasmid containing the 48-bp FLP recombinase target (FRT) sequence, generation of the acceptor cell line HeLa/406, and targeted integration with FLP recombinase have been described previously (51, 52). The 1.7-kb enhanced GFP (EGFP) transcription unit containing the tetracycline response element (TRE), miniCMV promoter, EGFP open reading frame, and simian virus 40 polyadenylation sequence was amplified from pBI-EGFP (Clontech) (nucleotides [nt] 3882 to 459) by use of primers with ApaI restriction sites. The 426-bp TRE promoter contains seven tetO 18-mers fused to a mini-cytomegalovirus (mini-CMV) promoter. The mini-CMV promoter TATA box is located 33 bp 3' to the TRE. The 3' ApaI-ApaI fragment (nt 1542 to 2367; nt 1 = HindIII cleavage site) of the 2.4 kb c-myc sequence was replaced with a TRE-GFP transcription unit in either orientation. In the TRE-GFP forward orientation, this places the mini-CMV promoter in the same position relative to the 5' c-myc sequences as the endogenous c-myc P0 promoter. The pFRT.TRE-GFP plasmid was derived from pFRT.myc.TRE-GFP by partial digestion with ApaI and complete digestion with Pin1 to remove all but the most 5' 79 bp of the c-myc replicator. The ends were filled by T4 DNA polymerase and blunt-end ligated. The construct with the inducible transcription units transcribed in the same direction as the endogenous c-myc gene is referred to as exhibiting forward orientation. To develop the doxycycline-inducible cell lines the forward and reverse clonal cell lines were stably transfected with the pTet-ON plasmid expressing the tetracycline-controlled transactivator and the pTet-tTs suppressor plasmid (Clontech). Cells that were transiently transfected with pFRT.myc.TRE-GFP plasmids had stably integrated pTet-ON and pTet-tTs.

To construct the pFRT.myc.3'{Delta}1420-GAL4 cell line the following sequence was cloned between Spe1 (nt 929) and ApaI (nt 2367) restriction sites: GCTGAGCGGAAGACTCTCCTCCGAATTCCGGAAGACTCTCCTCCGCGGGGAAGACTCTCCTCCGGAGCGGCCGCCATCGGAGCACTGTCCTCCGAACTTCCATCGGAGCACTGTCCTCCGAACTT. All constructs were verified by DNA sequencing.

The CREB-GAL4 fusion protein was expressed from pCRG4-11, a most generous gift of Patrick Quinn (Pennsylvania State University). In pCRG4-11, CREB amino acids 1 to 277 are fused to GAL4p amino acids 4 to 147. Replacement of the CREB DNA binding and dimerization domain with the GAL4p DNA binding domain maintains the CREB activation domain in its native conformation (69). GAL4p was expressed using the same vector from which the CREB cDNA had been deleted. Expression of CREB-GAL4p and GAL4p was confirmed by Western blotting using anti-GAL4 antibody (Abcam). The efficiency of transient transfections was normalized by cotransfection with a ß-galactosidase expression plasmid or by immunostaining with anti-GAL4 antibody and quantitation by flow cytometry (CREB-GAL4, GAL4).

RNA isolation and cDNA preparation. Total RNA was isolated using an RNeasy kit (QIAGEN). Reverse transcriptase reactions were performed using 1 µg of total RNA, random hexamers, and a Thermoscript RT-PCR system (Gibco-BRL). Prior to reverse transcription, RNA preparations were treated with RNase-free DNase (Ambion) to remove DNA, as assessed by real-time PCR. After reverse transcription, cDNA was quantitated by real-time PCR. For each cDNA preparation the amplification values were normalized to the abundance of GAPDH (glyceraldehyde-3-phosphate dehydrogenase) cDNA. In control reactions using cDNA from HeLa cells, the PCR signal from GFP was undetectable. At least six to eight PCR quantitations were performed on each of multiple RNA preparations.

Southern blot hybridization and diagnostic PCR. A total of 10 µg of genomic DNA was digested with either HindIII or EcoRI (Gibco-BRL) overnight, electrophoresed in 0.8% agarose gels in 1x Tris-acetate-EDTA, and blot transferred to Hybond N+ membranes (Amersham) following standard protocols (73). After blotting, the filters were UV cross-linked (Stratalinker) and prehybridized for 2 h at 42°C in 50% formamide-10% dextran sulfate-0.5% sodium dodecyl sulfate-1 M NaCl-1 mM EDTA (pH 8.0)-50 µg of denatured salmon sperm DNA/ml. Hybridization was performed with the prehybridization solution without salmon sperm DNA overnight at 42°C by use of the 407-bp NcoI-SmaI fragment from pFRT.myc (Neo probe), the 1.5-kb EcoRI-XbaI fragment from pHyg.FRT.TK (thymidine kinase [TK] probe), or the 756-bp EcoRI-XbaI fragment from pHyg.FRT.TK (hygromycin resistance gene [Hyg] probe). For Northern blot hybridizations, 20 µg of total RNA was used. RNA was electrophoresed and blotted to Hybond N+ membrane (Amersham) following standard protocols (5). A segment of the human ß-actin gene (nt 3200 to 3320) and the 750-bp BamHI fragment from pFRT.myc.TET-GFP were gel purified and used as probes with the actin and EGFP genes, respectively. A total of 50 ng of genomic DNA was used for PCR with primer sets specific for either the unoccupied acceptor construct (primers 1 and 2) or the acceptor construct after integration of the donor plasmids (primers 1 and 3) as described previously (51, 52).

Chromatin immunoprecipitation (ChIP). Cells were cross-linked according to the protocol of Ritzi et al. (70) with minor modifications. Cross-linked chromatin was resuspended in TE buffer (10 mM Tris-Cl, 1 mM EDTA) and sonicated (Branson sonifier cell disrupter 200) (50% duty cycle; 10-s pulses; 7 pulses with 1-min intervals). Chromatin was digested with 0.1 U of micrococcal nuclease (Sigma) per 100 µg of nucleoprotein at 37°C for 5 min to yield fragments of 150 to 400 bp. Nucleoprotein (250 µg) was diluted with 11x NET (550 mM Tris-Cl [pH 7.4], 1.65 M NaCl, 5.5 mM EDTA, 5.5% NP-40) to a final concentration of 1x NET. Anti-acetyl histone H4 antibody (Upstate Biotechnology) or anti-RNA polymerase II (Pol II) antibody (N-20; Santa Cruz Biotechnology) was used for immunoprecipitation. Washing of the antibody complex and purification of the precipitated DNA was carried out according to the method of Schepers et al. (75), and immunoprecipitated DNA was quantitated by real-time PCR.

PCR and analysis of nascent DNA. Asynchronous populations of cells were used for nascent DNA isolation as described previously (41). Nascent DNA was size fractionated in 1.25% alkaline agarose gels and neutralized, and fragments of 1 to 2 kb were extracted using a QIAquick gel extraction kit (QIAGEN). Nascent DNA abundance was measured by real-time Q-PCR using SYBR Green in an Applied Biosystems 5700 or 7000 instrument. Primers specific for the FRT acceptor site did not amplify HeLa DNA. Q-PCR data were normalized against the signal from the low-nascent-strand-abundance site STS-54.8 in the human ß-globin locus (21, 41) amplified from an equal amount of the same nascent DNA in the same 96-well tray by use of the same reagents. Standard curves were developed individually for each primer set using known amounts of the same preparation of 406/pFRT.myc (c-myc wild-type) cell genomic DNA. The data were compiled from at least three separate nascent DNA preparations for each cell line and three or more independent PCR amplifications of each nascent DNA preparation. Under the conditions of our experiments, >95% of the measurements are expected to fall within 30% of the indicated mean (61). The primers shown in Table 1 and other primers described previously (51) were used for PCR amplification.


View this table:
[in this window]
[in a new window]
 
TABLE 1. PCR primers

Chromatin structure analysis. Micrococcal nuclease digestion assays of the ectopic c-myc locus in HeLa cells were performed as described previously (44). Nuclei were mildly digested (0.06 U/A260 or 0.1 U/A260) with MNase (Sigma) at room temperature for 4 min. DNA was isolated and digested to completion with NcoI. Electrophoresis, blotting, and Southern hybridization of the digested DNA were done as described above.


arrow
RESULTS
 
Generation of stable cell lines. A 2.4-kb HindIII-XhoI fragment upstream of the human c-myc gene contains multiple replication initiation sites and acts as a chromosomal replicator when transferred to an ectopic genomic target site (51, 52) (Fig. 1A). This fragment contains the c-myc P0 and P1 promoters, several transcription factor consensus binding sites, and an organized nucleosome array stable with respect to chromosomal translocation (20, 35, 37, 44, 45, 67, 71, 78, 87). To analyze the effect of transcription on replicator activity, clonal cell lines were constructed using the yeast FLP recombinase to integrate donor plasmids containing wild-type or mutated versions of the c-myc core replicator in the FRT site in the HeLa/406 acceptor cell line (Fig. 1B to F) (51, 52). For pFRT.myc.TRE-GFP cell lines, the c-myc promoter elements contained in the c-myc ApaI-ApaI fragment (nt 1539 to 2367) were replaced with a GFP transcription unit cloned in either orientation. The forward orientation is defined as the placement of the GFP gene in the same transcriptional sense as that of the endogenous c-myc gene downstream of the c-myc replicator sequences (Fig. 1D).



View larger version (20K):
[in this window]
[in a new window]
 
FIG.1. Maps of DNA sequences used in this study. (A) HindIII-EcoRV fragment of the human c-myc locus. The first c-myc exon and the 5' part of the second exon are indicated by open boxes. The HindIII-XhoI fragment contains the wild-type c-myc replicator core. (A, ApaI; Ev, EcoRv; H, HindIII; S, SpeI; N, NotI; Xh, XhoI). Downward-pointing arrowheads represent replication initiation sites previously mapped in vivo (6, 44, 45, 67, 78). The in vivo DNA unwinding element (DUE) (7, 23, 58) is indicated. P0, P1, P2, P3, c-myc promoters. A TATA box is located 28 bp 5' to the P1 promoter. (B) Left, the clonal acceptor cell line HeLa/406 was generated through single-copy insertion of the plasmid pHyg.FRT.TK, containing an FLP recombinase target site (FRT), into the HeLa genome. Hyg, hygromycin resistance gene; TK, herpes simplex virus thymidine kinase gene (shaded rectangles). STS, sequence-tagged sites (Q-PCR primers); numbered arrows, analytical PCR primers (cf. Fig. 2). Unfilled rectangles are vector sequences. The acceptor cell line is hygromycin resistant and ganciclovir sensitive. Right, the donor plasmid pFRT.myc containing a promoterless neomycin resistance gene (Neo) and the 2.4-kb HindIII-XhoI fragment of the c-myc replicator (solid black box) was integrated at the acceptor site by the FLP recombinase expressed from pOG44. (C) The resulting pFRT.myc cell line is resistant to hygromycin, neomycin, and ganciclovir. PCR primers 1, 2, and 3 (horizontal arrowheads) gave diagnostic PCR products for the empty acceptor site (primers 1 and 2) or after FLP-mediated integration of the donor plasmids (primers 1 and 3). Sequence-tagged sites for Q-PCR are indicated as STS-Hyg, STS-UV, STS-DV, and STS-TK. The positions of restriction sites (E, EcoRI; H, HindIII) and probes relevant to the Southern analysis are shown. Bars below each map correspond to diagnostic restriction fragments detected by Southern blotting. (D) The pFRT.myc.TET-GFP cell lines were generated by deleting the 3' ApaI-ApaI c-myc sequence (pFRT.myc.3'{Delta}820, dashed lines) and replacing it with a GFP transcription unit under control of the tetracycline-inducible TRE promoter. The GFP genes were cloned in both orientations (indicated by thick arrows) relative to the c-myc sequences. All c-myc sequences except the 5' HindIII-PinI fragment (79 bp) had been deleted from the pFRT.TRE-GFP cells. (E) The 3' 1,420 bp of the c-myc core origin sequence was deleted from the donor plasmid pFRT.myc to construct the cell line pFRT.myc.3'{Delta}1420. (F) pFRT.myc.3'{Delta}1420-GAL4 was constructed by fusing four GAL4p binding sites to the 3' end of the c-myc sequences in pFRT.myc.3'{Delta}1420.

In pFRT.myc.TRE-GFP, the tetracycline-controlled transcriptional silencer tTS binds the tetO sequence of the tetracycline response element (TRE). In the presence of the doxycycline ligand, tTS is released and the reverse tetracycline repressor (rTetR-VP16) binds the TRE to activate transcription (26, 30). Additional cell lines were constructed containing inactive c-myc replicator deletion mutants pFRT.myc.3'{Delta}820, missing the Apa1-Apa1 c-myc DNA fragment (Fig. 1D), pFRT.myc.3'{Delta}1420, missing the c-myc Spe1-Not1 c-myc DNA fragment (Fig. 1E), and pFRT.myc.3'{Delta}1420-GAL4, in which the 1,420-bp Spe1-Not1 fragment was replaced by a 125-bp oligonucleotide containing four binding sites for the S. cerevisiae GAL4 protein (Fig. 1F).

Targeted integration was accomplished by FLP recombinase-mediated recombination between FRT sites in the c-myc donor plasmids and the acceptor site located at chromosome position 18p11.22 (nt 8,947,503; G. Liu, unpublished data) (Fig. 1B). The acceptor site FRT is positioned within the Hyg-TK gene without disrupting the reading frame of the fusion protein. FLP-mediated integration of the pFRT.myc donor plasmid or its derivatives displaces the TK part of the gene with a neomycin phosphotransferase coding sequence, rendering correctly targeted cells resistant to G418 and ganciclovir. Accurate integration of all constructs was confirmed by analytical PCR using primers that generated diagnostic products from the empty or occupied acceptor sites and by Southern blot hybridization using probes complementary to the acceptor site (Hyg probe, TK probe) or origin donor plasmid (Neo probe). As seen in Fig. 2, diagnostic primers 1 and 2 yielded amplified product only with HeLa/406 cell DNA containing the unoccupied acceptor site but not from cells with the acceptor site occupied by any of the donor plasmids (Fig. 2A). Conversely, primers 1 and 3 yielded the expected amplified product only with DNA from cells with an occupied acceptor site. Hybridization with the Hyg (Fig. 2B and E) or TK (Fig. 2D) probes confirmed that integration occurred at the intended chromosomal location, and hybridization with the Neo probe yielded a single hybridizing band, excluding the possibility that integration may also have taken place at a location other than the acceptor FRT site (Fig. 2B, C, and E). In cells containing integrated pFRT.TRE-GFP, targeting to the acceptor site was confirmed by single-copy hybridization of the Neo probe to an internal EcoRI fragment and to a single HindIII junction fragment spanning the acceptor and donor DNAs (Fig. 2C).



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 2. Structural confirmation of ectopic c-myc cell lines. (A) Genomic DNA was isolated from the cell lines whose results are shown in Fig. 1 and amplified by PCR with primers yielding products diagnostic for the unoccupied acceptor site (primers 1 and 2) or the occupied acceptor site (primers 1 and 3). A, acceptor HeLa/406 cells; WT, {Delta}, F, and R, TRE-GFP cells in forward orientation (F), in reverse orientation (R), with pFRT.myc integrated (WT), and with pFRT.myc.3'{Delta}1420 integrated ({Delta}). (B) Hybridization to DNA from acceptor cells or cells transfected with pFRT constructs. Left, hybridization of the Neo probe internal to the pFRT donor plasmids to HindIII junction fragments between the acceptor site and chromosomal DNA. Right, hybridization of the acceptor site Hyg probe to EcoRI junction fragments. (C) Hybridization of the Neo probe to EcoRI-digested junction fragments (left) or HindIII junction fragments (right) from cells with integrated with pFRT.TRE-GFP. (D) Hybridization of the TK probe to HindIII-digested junction fragments from cells with integrated pFRT.myc or pFRT.myc.3'{Delta}820. (E) Hybridization of the Hyg probe (left) or the Neo probe (right) to EcoRI junction fragments from cells with integrated pFRT.myc.3'{Delta}1420-GAL4. Size markers are in kilobase pairs. The pFRT.myc.3'{Delta}1420 integrant has previously been characterized (51).

Analysis of gene expression. Clonal pFRT.myc.TRE-GFP cell lines were stably transfected to express both the rtTA transcriptional activator and the tTS transcriptional repressor, and derivative clonal lines were selected in which GFP expression was regulated by doxycycline. pFRT.TRE-GFP, an additional plasmid containing a doxycycline-inducible GFP gene, was used to construct a control cell line with the TRE-GFP construct from which all but the 5' 79 bp of c-myc sequence had been removed.

Q-PCR of cDNAs from transiently transfected cells verified the inducible GFP expression from these plasmids. Thus, doxycycline increased expression from pFRT.myc.TRE-GFP or pFRT.TRE-GFP by ~6- to 10-fold or ~15-fold, respectively (Fig. 3A). In the stable cell lines, microscopic observation revealed GFP expression in the pFRT.myc.TRE-GFP (forward) cell line 24 h after doxycycline induction (Fig. 3B) and in the pFRT.TRE-GFP line (data not shown) but not in the pFRT.myc.TRE-GFP reverse cell line. Northern blot analysis confirmed that GFP expression was significantly lower in the pFRT.myc.TRE-GFP reverse cell line than in the forward cell line (Fig. 3C). Therefore, chromosomal integration of the reporter genes at the ectopic site slightly decreased the degree to which the forward-orientation reporter genes could be induced but significantly decreased the induction of the reverse orientation gene. The orientation dependence of transgene expression has been observed previously and correlated with differences in DNA methylation (24, 48). Experiments using methylation-sensitive restriction enzymes did not indicate that the integrated genes become methylated (G. Randall, unpublished data); however, we have not pursued the basis for the orientation dependence of induced expression further.



View larger version (39K):
[in this window]
[in a new window]
 
FIG. 3. Induction of GFP gene expression. (A) GFP expression from transiently transfected plasmids. Q-PCR was carried out with cDNA reverse transcribed from total RNA from cells transiently transfected with pFRT.myc.TET-GFP or pFRT.TRE-GFP and treated with doxycycline (6 h) or left untreated. The data are presented as the ratio of signals from sister cell cultures with and without ligand treatment, normalized for cotransfected ß-galactosidase plasmid expression. Error bars indicate standard deviations. For., forward; Rev., reverse. (B) Effect of doxycycline treatment (24 h) on GFP expression in cells containing stably integrated pFRT.myc.TRE-GFP (forward orientation). (C) Time course Northern analysis of pFRT.myc.TRE-GFP expression in cell lines upon doxycycline (Dox) induction, hybridized successively with probes for GFP and ß-actin. RNA from cells containing stably integrated pFRT.myc (c-myc wild type) was used as a negative control. (D) Q-PCR was carried out with cDNA reverse transcribed from total RNA from cells stably transfected with the pFRT.myc.TET-GFP or pFRT.TRE-GFP plasmids and treated with doxycycline (6 h) or left untreated. The data represent copies of GFP cDNA per 1,000 copies of GAPDH cDNA. Error bars indicate standard deviations.

To quantitate the induction of GFP expression in each of the stable GFP cell lines, real-time PCR was carried out on reverse-transcribed cDNA by use of primers complementary to GFP or an internal control, GAPDH cDNA. Relative to the expression of GAPDH, doxycycline strongly (~7-fold) induced GFP expression in the pFRT.TRE-GFP and pFRT.myc.TRE-GFP (forward) cell lines and modestly (~2-fold) induced expression in the pFRT.myc.TRE-GFP (reverse) cell line (Fig. 3D).

To determine whether structural changes in the chromatin of the integrated pFRT.myc.TRE-GFP constructs were correlated with their levels of gene expression, micrococcal nuclease (MNase) was used to digest nuclei from these cell lines. As shown in Fig. 4A, although local changes in the structure of the TRE were detectable on the original autoradiograms after induction, no large-scale differences were evident between the nuclease digestion patterns of the integrated plasmids containing uninduced versus induced genes. At the sensitivity of this assay, these data suggest that gross structural changes are not seen encompassing the c-myc replicator sequences between the cell lines irrespective of the induction of gene expression from the transcription units.



View larger version (55K):
[in this window]
[in a new window]
 
FIG. 4. Analysis of chromatin structure. (A) Nuclei were isolated from the pFRT.myc.TRE-GFP forward and reverse cell lines with or without doxycycline induction and subjected to increasing amount of micrococcal nuclease digestion (solid triangles). The DNA was purified, digested with NcoI (arrowheads), and hybridized to the Neo probe (solid bar). Asterisks indicate the TRE promoter regions of the forward and reverse TRE-GFP constructs. (B) Formaldehyde cross-linked chromatin was isolated from uninduced cells or doxycycline-treated cells (6 h) and immunoprecipitated with anti-acetyl histone H4 antibody or normal rabbit serum (NRS). Immunoprecipitated DNA was quantitated at the indicated STSs (Hyg, UV, GFP, DV, and TK) and at STS-54.8 in the human ß-globin locus by Q-PCR. The data on the left-hand y axes are expressed relative to STS-54.8. The data on the right-hand y axes show percent increase in H4 acetylation calculated as follows: (100% x uninduced/induced) – 100%. Error bars indicate standard deviations.

As a further assay of chromatin structure, ChIP was performed using anti-acetyl histone H4 antibody, and DNA sequences across the ectopic c-myc locus were quantitated in the immunoprecipitates (Fig. 4B). In the uninduced state all sites assayed showed hyperacetylation of about 2- to 10-fold relative to that seen with a sequence-tagged site in the transcriptionally inactive ß-globin locus, with the highest levels of acetyl-H4 in the region of the constitutively expressed Hyg gene. Enhanced hyperacetylation of the ectopic locus was observed upon induction of GFP expression, with the greatest increases in H4 acetylation observed over the GFP gene and its downstream flanking DNA. Moreover, the level of H4 acetylation of the forward-orientation GFP gene was 2 to 3 times that of the reverse orientation GFP gene, irrespective of induction. Thus, the level of H4 acetylation qualitatively, but not quantitatively, mirrored the expression levels of these genes. Overall, the level of histone acetylation, the degree and pattern of MNase sensitivity, and the profile of decreasing histone H4 acetylation from upstream to downstream across the ectopic locus did not show dramatic changes upon induction of transcription. We conclude that the induction of transcription is not associated with further large-scale changes in chromatin structure at the already accessible ectopic site.

Quantitation of nascent strand abundance. As a measure of replication origin activity, the abundance of short (1- to 2-kb) nascent DNA strands in asynchronous populations of clonally expanded cells containing pFRT.myc.TRE-GFP was determined at the ectopic c-myc replicator sites before and after induction of transcription. Nascent DNA was isolated by cell lysis and electrophoresis in alkaline gels (51, 52). This method eliminates all handling of DNA prior to size fractionation and avoids potential variability in nascent DNA isolation results. As has been reported previously, normalization of the nascent strand abundance at the ectopic site to the abundance at an internal reference site minimizes the standard deviation of these measurements (51, 52, 85). The internal reference for these studies was the ß-globin STS-54.8 (41). Quantitative real-time PCR (Q-PCR) was used to compare the origin activity of the uninduced and induced pFRT.myc.TRE-GFP constructs with the activity of the wild-type pFRT.myc and the inactive pFRT.myc.3'{Delta}1420 constructs.

As shown in Fig. 5, in the absence of doxycycline induction, the presence of the TRE-GFP gene in either orientation elevated origin activity at STS-UV approximately 10- to 15-fold compared to the results seen with the inactive c-myc deletion construct pFRT.myc.3'{Delta}1420 or pFRT.myc.3'{Delta}820 and to levels roughly twice those of the wild-type replicator (pFRT.myc), with only minor changes at STS-Hyg or STS-TK. That the uninduced GFP transcription unit can substitute functionally for the endogenous c-myc promoter region suggests that some aspect of basal transcription strongly stimulates origin activity. On the other hand, induction with doxycycline decreased the abundance of short nascent strands at STS-UV in both the forward and reverse cell lines to approximately the level of that in the pFRT.myc cell line. Similar results were also obtained using competitive PCR to quantitate nascent strand abundances before and after induction of transcription (data not shown). Thus, the induction of transcription suppressed but did not eliminate replicator function. As summarized in Table 2, there was not the same quantitative relationship between the extent of induced transcription and the decrease in nascent strand abundance in the forward and reverse pFRT.myc.TRE-GFP cell lines. Both the forward and reverse cell lines showed a decrease of approximately fourfold in nascent DNA levels at STS-UV despite a sevenfold induction of transcription in the forward cell line and a twofold induction in the reverse cell line. One possible explanation for these observations is that the replicator is sensitive to the duration of transcription complex occupancy on the GFP gene. Experiments performed using {alpha}-amanitin to test this possibility are described below.



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 5. Nascent strand abundance and Q-PCR analysis. (A and B) The abundance of short nascent strands at STS-Hyg, STS-UV, and STS-TK in cells containing pFRT.myc.TRE-GFP in the forward orientation (A) or the reverse orientation (B) was analyzed by real-time PCR. Cells were left uninduced, treated with doxycycline (6 h), or treated with {alpha}-amanitin (1 h) in the presence or absence of inducer. The nascent strand abundance in cells containing integrated pFRT.myc or pFRT.myc.3'{Delta}1420 is shown for comparison. Values shown are relative to nascent strand abundance at ß-globin STS-54.8 (41). (C) Absence of replicator activity in control constructs. The abundance of short nascent strands at the indicated STSs was measured in cell lines containing pFRT.myc (wild-type core replicator) or the deletion mutant pFRT.myc.3'{Delta}1420 or pFRT.myc.3'{Delta}820. (D) Absence of replicator activity in cells containing pFRT.TRE-GFP under induced or uninduced conditions. Values shown are relative to nascent strand abundance at ß-globin STS-54.8. Error bars indicate standard deviations.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Expression and replication in GFP cell lines

To confirm that the TRE-GFP transcription unit contributed to restoring c-myc replicator activity, an additional cell line was constructed containing pFRT.myc.3'{Delta}820, which is the vector for the inducible GFP constructs. Q-PCR was used to compare the levels of abundance of nascent strands at STS-Hyg, STS-UV, and STS-TK in cell lines containing the wild-type c-myc replicator pFRT.myc, a mutant c-myc replicator (pFRT.myc.3'{Delta}1420) shown to be as inactive as the empty acceptor site or a negative genomic control construct (51, 52), and the pFRT.myc.3'{Delta}820 mutant. Earlier results had shown that deletion of 200-bp segments from the 3' region of the replicator (nt 1533 to 1932 or nt 2134 to 2337), reduced or eliminated origin activity (51). As expected from these prior results, the pFRT.myc.3'{Delta}820 construct was inert in the nascent-strand-abundance assay (Fig. 5C).

The replicator activity of the pFRT.myc.TRE-GFP constructs was also dependent on the presence of the c-myc replicator sequences, since pFRT.TRE-GFP, from which all but the 5' 79 bp of c-myc sequence were removed, did not show replicator activity when integrated at the same chromosomal location (Fig. 5D and Table 2). Because the basal level of expression from pFRT.TRE-GFP was much higher than that from pFRT.myc.TRE-GFP (Fig. 3), it was possible that the presence of the c-myc sequences stimulated replication activity not because of a positive replicator function but because they negatively affected the basal level of GFP expression. This does not appear to be the case, however, since replicator activity was not seen at the reverse-orientation gene whose induced expression was comparable to that of the basal expression of the forward gene, and GFP expression at the same level as that of pFRT.myc.TRE-GFP, but in analogous ecdysone-dependent GFP promoter construct cell lines, did not enable replication activity of the GFP transcription unit (data not shown).

{alpha}-Amanitin treatment. Irrespective of polarity, both forward and reverse pFRT.myc.TRE-GFP cell lines showed greater origin activity when uninduced and a decrease in origin activity upon transcriptional induction. To analyze this effect further we used {alpha}-amanitin, which inhibits transcription in HeLa cells by strongly blocking the progress of engaged RNA Pol II molecules but does not displace the enzyme from its template (3, 42, 49, 59, 72). When cells were treated with {alpha}-amanitin a polar effect of gene orientation was observed. In uninduced cells harboring the forward orientation of pFRT.myc.TRE-GFP, {alpha}-amanitin reduced the origin activity at STS-UV approximately threefold to levels similar to those of induced cells, whereas in the reverse orientation, {alpha}-amanitin had little effect on nascent strand abundance in uninduced cells (Fig. 5 and Table 2). Cells were also treated with {alpha}-amanitin following induction of transcription with doxycycline. As shown in Fig. 5, for both the forward and reverse pFRT.myc.TRE-GFP cell lines the effects of {alpha}-amanitin on nascent strand abundance were highly similar whether transcription had been induced with doxycycline or not.

These results implied that compared to the results seen with the uninduced state, increased passage of the RNA Pol II transcription complex across the TRE-GFP gene reduced origin activity, as did stalling of the transcription complex proximal to the replicator, but that stalling of the transcription complex distal to the replicator was more permissive of origin activity. ChIP was performed to confirm that RNA Pol II was bound at the expected sites under these experimental conditions. As observed in similar experiments (63, 74, 77), the greatest abundance of Pol II-bound sequences was near the promoter (Fig. 6). Mirroring the induction of GFP expression observed by Northern blotting or reverse transcription PCR, doxycycline increased the amount of promoter sequences bound by Pol II approximately sixfold in the pFRT.myc.TRE-GFP forward-orientation cell line whereas no significant change was observed in the reverse orientation cell line. {alpha}-Amanitin treatment during the last hour of doxycycline induction further increased the binding of RNA Pol II at the promoter region of the GFP genes two- to threefold. However, the dramatic inhibition of replication in the presence of doxycycline and {alpha}-amanitin was only observed in the forward-orientation cell line (cf. Fig. 5). Taken together, these results suggest that the increased association of the Pol II complex with the TRE-GFP genes or stalling of the Pol II complex near the replicator adversely affected replication initiation.



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 6. RNA Pol II ChIP. Formaldehyde cross-linked chromatin was isolated from forward and reverse orientation cell lines that were left uninduced, treated with doxycycline (6 h), or treated with doxycycline (6 h) and {alpha}-amanitin (1 h). Chromatin was immunoprecipitated with antibodies against RNA Pol II or normal rabbit serum. Q-PCR of the immunoprecipitated DNA was carried out at the STSs indicated. The data are represented as the abundance of Pol II-bound DNA in the induced or induced plus {alpha}-amanitin-treated cells relative to that of the RNA Pol II bound DNA in uninduced cells. Error bars indicate standard deviations.

CREB-GAL4p expression restores origin activity to an inactive replicator. To assess directly whether transcription factor binding per se could stimulate replication, the cell line pFRT.myc.3'{Delta}1420-GAL4 was constructed in which the promoter sequences missing from pFRT.myc.3'{Delta}1420 were replaced with a GAL4p binding cassette (Fig. 1F). The GAL4p DNA binding domain or a fusion protein comprising the amino terminal transcription activation domain of the cyclic AMP response element binding protein CREB and the DNA binding domain of GAL4p (69) were expressed at similar levels in these cells or in pFRT.myc.3'{Delta}1420 as a control (Fig. 7A), and replication initiation activity was measured. Expression of CREB-GAL4p rescued replication initiation activity in the pFRT.myc.3'{Delta}1420-GAL4 cells but not in pFRT.myc.3'{Delta}1420 cells lacking the GAL4p binding site (Fig. 7B). In contrast, GAL4p expression could not rescue replication activity in the pFRT.myc.3'{Delta}1420-GAL4 cells. Expression of CREB-GAL4p or GAL4p did not affect replication activity at the endogenous c-myc replicator (Fig. 7B) or at the ß-globin locus (data not shown); thus, the effect of CREB-GAL4p expression was limited to the region near the GAL4p binding site. ChIP analysis (Fig. 7C) indicated that the expression of CREB-GAL4p correlated with a local increase in histone H4 acetylation near the GAL4p binding site. These results indicate that the GAL4 target cassette is accessible for binding, that CREB-GAL4p is able to recruit histone acetyltransferase activity to this site, and that targeted transcription factor binding can rescue the activity of the inactive c-myc replicator.



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 7. Expression of CREB-GAL4p restores origin activity to pFRT.myc.3'{Delta}1420-GAL4. (A) GAL4p or CREB-GAL4p was transiently expressed in the indicated cell lines. Western blot, anti-GAL4p antibody. Equal amounts of cell extract (actin control not shown) were loaded. (B) Nascent strand abundance was measured at STS-UV and STS-DV in the indicated cell lines with or without GAL4p or CREB-GAL4p expression (48 h posttransfection). Nascent strand abundances were normalized for CREB-GAL4 and GAL4 plasmid transfection efficiency (50 to 54%) as determined by flow cytometry (Materials and Methods). For comparison, the levels of nascent strands 5' and 3' to the endogenous c-myc 2.4-kb core replicator were measured. Values shown are relative to nascent strand abundance at ß-globin STS-54.8. Error bars indicate standard deviations. (C) Formaldehyde cross-linked chromatin was immunoprecipitated from pFRT.myc.3'{Delta}1420-GAL4 cells transfected with GAL4p- or CREB-GAL4p-expressing plasmids, and the indicated STSs were quantitated in the immunoprecipitated DNA by real-time PCR. Error bars indicate standard deviations.


arrow
DISCUSSION
 
Replication and transcription begin at nonrandom sites along eukaryotic chromosomes, but despite the general early S-phase replication of transcribed sequences, attempts to compare levels of origin activity proximal to promoters in cells where the promoter is active versus inactive promoter results have produced both positive (46, 81) and negative (40, 60) correlations. Thus, the observed differences in origin activity may derive from a property of each cell type other than active transcription. When autonomously replicating plasmids harboring a constitutively expressed selectable marker gene and an inducible reporter gene were assayed in human 293S cells, expression of the marker gene was compatible with replication but induced transcription of the reporter gene was not (31).

Here we extend these observations to a chromosomal context. Previous work has shown that the chromosomally integrated c-myc replicator construct pFRT.myc.3'{Delta}1420, which is missing the 3' portion of the replicator, and mutants from which individual ~200-bp blocks containing transcription factor binding sites had been deleted do not show origin activity (51). To test the hypothesis that the presence of a transcription unit facilitates replication initiation, clonal cell lines were constructed containing single-copy chimeric replicators in which the c-myc 3' transcription factor binding sites (9, 20, 35, 37, 67, 71, 78, 87) were replaced by inducible transcription units. The origin activity of all constructs was monitored after integration at the same chromosomal location. The transcription units were placed in both orientations relative to the replicator sequences to assay for polar effects in constructs where replication and transcription forks were moving in the same or opposite directions.

The replicator-GFP fusion plasmids showed significant induction of GFP gene expression in transient assays. In contrast, whereas single-copy integrants of pFRT.myc.TRE-GFP in the forward orientation showed induction quantitatively similar to that seen with transiently transfected cultures, the presence of doxycycline only modestly induced expression of the integrated pFRT.myc.TRE-GFP reverse construct. It is conceivable that these differences stem from comparing expression of a population of transiently transfected plasmid to that from a clonal cohort of a single integrated plasmid. However, we do not believe these effects on transcription are due to mutation of the integrated plasmids undetected by Southern blotting or PCR, since doxycycline induction of the forward and reverse pFRT.myc.TRE-GFP integrants had the same effect on replication.

As reported previously, the greatest abundance of short nascent DNAs was detected closest to the c-myc replicator sequences (51). Prior to induction the pFRT.myc.TRE-GFP constructs showed >15-fold-elevated origin activity at STS-UV compared to the results seen with mutant pFRT.myc.3'{Delta}1420. This observation suggests that replacement of the endogenous c-myc transcription factor binding site region with a heterologous transcription factor-binding region can restore replicator activity. Since integration of an inducible TRE-GFP gene without the bulk of c-myc replicator sequences at the same chromosomal location did not engender replicator activity, this effect appears to be dependent on cooperation between the c-myc sequences and the transcription unit. A background level of expression is detected from each of the transcription units in the absence of induction. Among other possibilities, the chromatin structure correlated with the basal expression of the TRE-GFP transcription units may also be conducive to site-specific replication initiation. Alternatively, since we have not mapped the sites of transcription initiation in the uninduced versus induced states, it is formally possible that the transcription start sites for background expression are compatible with replication while the start sites for induced expression are not. However, the results of Pol II ChIP and the orientation-dependent effects on replication of inhibiting transcription with {alpha}-amanitin argue against this, as does the observation that CREB-GAL4p binding in the absence of known promoter sequences restores replication activity.

Binding of the CREB-GAL4p transcription factor to the inactive pFRT.myc.3'{Delta}1420-GAL4 replicator was associated with restoration of origin activity. Although we have not constructed a pFRT.GAL4 cell line devoid of c-myc replicator sequences, earlier data from other laboratories (48, 65) as well as from our own (51), and the data presented in this report, show that transcription factor binding sites are insufficient for origin activity in the absence of replicator elements. We believe, therefore, that the binding of CREB-GAL4p acts in concert with sequence elements (58) or proteins (23, 33) associated with the 5' 1,000 bp of the c-myc replicator. Work to be presented elsewhere in which we describe the identification in a yeast one-hybrid screen of a previously uncharacterized protein that binds to the c-myc DUE in vivo and modulates replication complex assembly in vitro is potentially relevant.

While the present work was in progress it was reported that transgenes containing transcription factor binding sites from the human ß-globin locus control region (hypersensitive sites 2, 3, and 4; LCR HS2-4) (39, 62, 79) fused upstream of a ß-globin promoter and EGFP gene were targeted into the mouse genome (24, 48). In two of three chromosomal locations the transgenes showed orientation-dependent expression correlated with changes in DNA methylation. In one of these cell lines, the transcriptionally permissive orientation was associated with local histone H4 hyperacetylation and early S-phase activation of the otherwise late-replicating insertion site. This effect was retained in a construct missing the ß-globin promoter but containing the LCR HS2-4 (48). In comparison, a recent study of the nonexpressed but decondensed chicken ß-globin locus did not find a consistent correlation between origin activity and histone acetylation (68). These observations are consistent with the conclusion that transcription factor binding and histone acetylation may be two of several aspects of chromatin structure that can promote origin activity.

When expression from pFRT.myc.TRE-GFP was induced by doxycycline, origin activity was decreased approximately to the levels observed from the wild-type c-myc replicator at the ectopic locus but not to levels as low as those seen with the pFRT.myc.3'{Delta}1420 mutant. These data imply that the process of induced transcription inhibits replication. The similarity of nuclease digestion patterns over the uninduced and induced loci suggests that the inhibition of replication occurs without stable, large-scale movement of nucleosomes, although the structure of chromatin is modified by histone hyperacetylation. One interpretation of the absence of a polar effect of transcription is that ample positive or negative torsional strain does not accumulate to affect replication differentially. Alternatively, replication may be inhibited by states repressive for replication at both the 5' and 3' ends of the transcription unit.

{alpha}-Amanitin binds RNA Pol II (42, 49, 72) and dramatically slows transcription in HeLa cells (14). Treatment of the uninduced cell lines to block background GFP gene expression did not result in a detectable change in the flow cytometry profile of the cultures (data not shown). Nascent DNA quantitation of {alpha}-amanitin-treated forward-orientation pFRT.myc.TRE-GFP cells decreased origin activity at STS-UV to levels comparable to those of induced cells, while {alpha}-amanitin treatment of reverse-orientation cells only marginally reduced origin activity. {alpha}-Amanitin neither dissociates the RNA Pol II-DNA-RNA complex nor competes for nucleotide incorporation but inhibits RNA Pol II translocation from several thousand to only a few bases per minute (15, 17, 18, 42, 72). That {alpha}-amanitin inhibition of basal and of induced transcription had similar effects on replication suggests that the identity of the transcription factor present at the promoter is less crucial than the residence of the transcription complex. Thus, in the presence of {alpha}-amanitin, a state inhibitory for replication may persist near the 5' end of a transcription unit, while the inhibitory state at the 3' end of the transcription unit is dissipated. Under these conditions, replication was inhibited in the forward-orientation cell line where the TRE-GFP promoter is proximal to the c-myc replicator sequences but was not inhibited in the reverse-orientation cell line.

Findings with the inducible cell lines revealed that a transcription unit restores origin activity at an inactive replicator while induced transcription represses origin activity irrespective of the orientation of the transcription unit relative to that of the replicator. The observation that transcriptional induction of the forward and reverse TRE-GFP constructs shows similar effects on replication but significantly different quantitative effects on transcription suggests that the structures of the promoter and replicator are qualitatively different under uninduced and induced conditions. Moreover, {alpha}-amanitin treatment mimics the effect of elevated transcription when the TRE promoter is proximal to the replicator, but the effect of the presence of {alpha}-amanitin is diminished when the TRE promoter is distal to the replicator. One hypothesis to incorporate these observations is that transcription factor binding enhances origin activity at the endogenous or ectopic c-myc replicators but that a later step in transcriptional activation is repressive to replication initiation. In similarity to a model proposed for chromatin structural changes by human HSF1-dependent transcription at the hsp70 promoter (14), elevated expression may interfere with origin activity by the establishment of a repressive chromatin structure for replication initiation near the promoter that is stable with respect to the presence of {alpha}-amanitin and by the {alpha}-amanitin-sensitive propagation of a repressive state with the transcription fork. Hence, in the presence of {alpha}-amanitin the relative locations of the promoter and replicator could account for the observed orientation-dependent effects on replication. In the context of the present results, binding of a transcriptional activator or coactivator near the c-myc replicator is conducive to replication initiation, while subsequent occupancy of a nearby promoter by the Pol II transcriptional machinery may inhibit origin activity.

The experiments presented here take advantage of a common genomic integration site to compare the effects of sequence deletions and substitutions and examine a single type of replicator. Thus, it is conceivable that these results are locus specific and that other replicators would use different strategies to regulate origin activity at other chromosomal sites. At the ectopic acceptor site the H4 histones are hyperacetylated, possibly due to the presence of the constitutively expressed Hygr gene or another aspect of chromatin structure. However, origin activity is not observed at the ectopic site in the absence of c-myc replicator sequences, and the origin activity of the wild-type 2.4-kb c-myc replicator at the ectopic location is similar to that at the endogenous c-myc locus on a per copy basis (Fig. 7). By contrast, the origin activity of pFRT.myc.3'{Delta}1420-GAL4 bound by CREB-GAL4p exceeds that of the endogenous c-myc locus. Since all of these constructs were assayed in the same chromosomal location, these differences may derive from differences in the amount or affinity of the cognate binding proteins for their target sites in the replicator. In a recent study an unexpectedly large number of transcription factor binding site regions were predicted to exist within the genome, with roughly 50% of these not associated with RNA coding genes (16). Taken together with the results presented here, these data lead us to speculate that transcription factor binding at genomic sites not associated with canonical promoter elements may influence replicator activity. Experiments are under way to determine the effects of other transcriptional activators and repressors on the c-myc replicator.


arrow
ACKNOWLEDGMENTS
 
This work was supported by an Ohio Research Challenge Award from the Wright State University School of Medicine and by a Public Health Service grant (GM53819) to M.L.

We thank M. Mechali for suggesting the use of {alpha}-amanitin.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biochemistry and Molecular Biology, Wright State University School of Medicine, 3640 Colonel Glenn Highway, Dayton, OH 45435. Phone: (937) 775-3125. Fax: (937) 775-3730. E-mail: michael.leffak{at}wright.edu. Back


arrow
REFERENCES
 
    1
  1. Aladjem, M. I., L. W. Rodewald, J. L. Kolman, and G. M. Wahl. 1998. Genetic dissection of a mammalian replicator in the human beta-globin locus. Science 281:1005-1009.[Abstract/Free Full Text]
  2. 2
  3. Altman, A. L., and E. Fanning. 2001. The Chinese hamster dihydrofolate reductase replication origin beta is active at multiple ectopic chromosomal locations and requires specific DNA sequence elements for activity. Mol. Cell. Biol. 21:1098-1110.[Abstract/Free Full Text]
  4. 3
  5. Archard, L. C., K. Johnson, and A. D. Malcolm. 1985. Specific transcription of orthopox virus DNA by HeLa cell RNA polymerase II. FEBS Lett. 192:53-56.[CrossRef][Medline]
  6. 4
  7. Austin, R. J., T. L. Orr-Weaver, and S. P. Bell. 1999. Drosophila ORC specifically binds to ACE3, an origin of DNA replication control element. Genes Dev. 13:2639-2649.[Abstract/Free Full Text]
  8. 5
  9. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.). 1997. Current protocols in molecular biology. Wiley, New York, N.Y.
  10. 6
  11. Battey, J., C. Moulding, R. Taub, W. Murphy, T. Stewart, H. Potter, G. Lenoir, and P. Leder. 1983. The human c-myc oncogene: structural consequences of translocation into the IgH locus in Burkitt lymphoma. Cell 34:779-787.[CrossRef][Medline]
  12. 7
  13. Bazar, L., D. Meighen, V. Harris, R. Duncan, D. Levens, and M. Avigan. 1995. Targeted melting and binding of a DNA regulatory element by a transactivator of c-myc. J. Biol. Chem. 270:8241-8248.[Abstract/Free Full Text]
  14. 8
  15. Bell, S. P., and A. Dutta. 2002. DNA replication in eukaryotic cells. Annu. Rev. Biochem. 71:333-374.[CrossRef][Medline]
  16. 9
  17. Bentley, D. L., and M. Groudine. 1986. Novel promoter upstream of the human c-myc gene and regulation of c-myc expression in B-cell lymphomas. Mol. Cell. Biol. 6:3481-3489.[Abstract/Free Full Text]
  18. 10
  19. Berberich, S., A. Trivedi, D. C. Daniel, E. M. Johnson, and M. Leffak. 1995. In vitro replication of plasmids containing human c-myc DNA. J. Mol. Biol. 245:92-109.[CrossRef][Medline]
  20. 11
  21. Bosco, G., W. Du, and T. L. Orr-Weaver. 2001. DNA replication control through interaction of E2F-RB and the origin recognition complex. Nat. Cell Biol. 3:289-295.[CrossRef][Medline]
  22. 12
  23. Brewer, B. J. 1988. When polymerases collide: replication and the transcriptional organization of the E. coli chromosome. Cell 53:679-686.[CrossRef][Medline]
  24. 13
  25. Brewer, B. J., D. Lockshon, and W. L. Fangman. 1992. The arrest of replication forks in the rDNA of yeast occurs independently of transcription. Cell 71:267-276.[CrossRef][Medline]
  26. 14
  27. Brown, S. A., and R. E. Kingston. 1997. Disruption of downstream chromatin directed by a transcriptional activator. Genes Dev. 11:3116-3121.[Abstract/Free Full Text]
  28. 15
  29. Bushnell, D. A., P. Cramer, and R. D. Kornberg. 2002. Structural basis of transcription: alpha-amanitin-RNA polymerase II cocrystal at 2.8 A resolution. Proc. Natl. Acad. Sci. USA 99:1218-1222.[Abstract/Free Full Text]
  30. 16
  31. Cawley, S., S. Bekiranov, H. H. Ng, P. Kapranov, E. A. Sekinger, D. Kampa, A. Piccolboni, V. Sementchenko, J. Cheng, A. J. Williams, R. Wheeler, B. Wong, J. Drenkow, M. Yamanaka, S. Patel, S. Brubaker, H. Tammana, G. Helt, K. Struhl, and T. R. Gingeras. 2004. Unbiased mapping of transcription factor binding sites along human chromosomes 21 and 22 points to widespread regulation of noncoding RNAs. Cell 116:499-509.[CrossRef][Medline]
  32. 17
  33. Chafin, D. R., H. Guo, and D. H. Price. 1995. Action of alpha-amanitin during pyrophosphorolysis and elongation by RNA polymerase II. J. Biol. Chem. 270:19114-19119.[Abstract/Free Full Text]
  34. 18
  35. Cochet-Meilhac, M., and P. Chambon. 1974. Animal DNA-dependent RNA polymerases. Mechanism of the inhibition of RNA polymerases B by amatoxins. Biochim. Biophys. Acta 353:160-184.[Medline]
  36. 19
  37. Danis, E., K. Brodolin, S. Menut, D. Maiorano, C. Girard-Reydet, and M. Mechali. 2004. Specification of a DNA replication origin by a transcription complex. Nat. Cell Biol. 6:721-730.[CrossRef][Medline]
  38. 20
  39. DesJardins, E., and N. Hay. 1993. Repeated CT elements bound by zinc finger proteins control the absolute and relative activities of the two principal human c-myc promoters. Mol. Cell. Biol. 13:5710-5724.[Abstract/Free Full Text]
  40. 21
  41. Dhar, S. K., K. Yoshida, Y. Machida, P. Khaira, B. Chaudhuri, J. A. Wohlschlegel, M. Leffak, J. Yates, and A. Dutta. 2001. Replication from oriP of Epstein-Barr virus requires human ORC and is inhibited by geminin. Cell 106:287-296.[CrossRef][Medline]
  42. 22
  43. Dhar, V., A. I. Skoultchi, and C. L. Schildkraut. 1989. Activation and repression of a beta-globin gene in cell hybrids is accompanied by a shift in its temporal replication. Mol. Cell. Biol. 9:3524-3532.[Abstract/Free Full Text]
  44. 23
  45. Duncan, R., L. Bazar, G. Michelotti, T. Tomonaga, H. Krutzsch, M. Avigan, and D. Levens. 1994. A sequence-specific, single-strand binding protein activates the far upstream element of c-myc and defines a new DNA-binding motif. Genes Dev. 8:465-480.[Abstract/Free Full Text]
  46. 24
  47. Feng, Y. Q., M. C. Lorincz, S. Fiering, J. M. Greally, and E. E. Bouhassira. 2001. Position effects are influenced by the orientation of a transgene with respect to flanking chromatin. Mol. Cell. Biol. 21:298-309.[Abstract/Free Full Text]
  48. 25
  49. Formosa, T. 2003. Changing the DNA landscape: putting a SPN on chromatin. Curr. Top. Microbiol. Immunol. 274:171-201.[Medline]
  50. 26
  51. Freundlieb, S., U. Baron, A. L. Bonin, M. Gossen, and H. Bujard. 1997. Use of tetracycline-controlled gene expression systems to study mammalian cell cycle. Methods Enzymol. 283:159-173.[Medline]
  52. 27
  53. Gerber, J. K., E. Gogel, C. Berger, M. Wallisch, F. Muller, I. Grummt, and F. Grummt. 1997. Termination of mammalian rDNA replication: polar arrest of replication fork movement by transcription termination factor TTF-I. Cell 90:559-567.[CrossRef][Medline]
  54. 28
  55. Gilbert, D. M. 2001. Making sense of eukaryotic DNA replication origins. Science 294:96-100.[Abstract/Free Full Text]
  56. 29
  57. Girard-Reydet, C., D. Gregoire, Y. Vassetzky, and M. Mechali. 2004. DNA replication initiates at domains overlapping with nuclear matrix attachment regions in the xenopus and mouse c-myc promoter. Gene 332:129-138.[CrossRef][Medline]
  58. 30
  59. Gossen, M., and H. Bujard. 1992. Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc. Natl. Acad. Sci. USA 89:5547-5551.[Abstract/Free Full Text]
  60. 31
  61. Haase, S. B., S. S. Heinzel, and M. P. Calos. 1994. Transcription inhibits the replication of autonomously replicating plasmids in human cells. Mol. Cell. Biol. 14:2516-2524.[Abstract/Free Full Text]
  62. 32
  63. Hay, N., J. M. Bishop, and D. Levens. 1987. Regulatory elements that modulate expression of human c-myc. Genes Dev. 1:659-671.[Abstract/Free Full Text]
  64. 33
  65. He, L., J. Liu, I. Collins, S. Sanford, B. O'Connell, C. J. Benham, and D. Levens. 2000. Loss of FBP function arrests cellular proliferation and extinguishes c-myc expression. EMBO J. 19:1034-1044.[CrossRef][Medline]
  66. 34
  67. He, Z., B. T. Brinton, J. Greenblatt, J. A. Hassell, and C. J. Ingles. 1993. The transactivator proteins VP16 and GAL4 bind replication factor A. Cell 73:1223-1232.[CrossRef][Medline]
  68. 35
  69. Hiebert, S. W., M. Lipp, and J. R. Nevins. 1989. E1A-dependent trans-activation of the human MYC promoter is mediated by the E2F factor. Proc. Natl. Acad. Sci. USA 86:3594-3598.[Abstract/Free Full Text]
  70. 36
  71. Holland, L., L. Gauthier, P. Bell-Rogers, and K. Yankulov. 2002. Distinct parts of minichromosome maintenance protein 2 associate with histone H3/H4 and RNA polymerase II holoenzyme. Eur. J. Biochem. 269:5192-5202.[Medline]
  72. 37
  73. Imagawa, M., R. Chiu, and M. Karin. 1987. Transcription factor AP-2 mediates induction by two different signal-transduction pathways: protein kinase C and cAMP. Cell 51:251-260.[CrossRef][Medline]
  74. 38
  75. Ishimi, Y., K. Matsumoto, and R. Ohba. 1994. DNA replication from initiation zones of mammalian cells in a model system. Mol. Cell. Biol. 14:6489-6496.[Abstract/Free Full Text]
  76. 39
  77. Jackson, D. A., J. C. McDowell, and A. Dean. 2003. Beta-globin locus control region HS2 and HS3 interact structurally and functionally. Nucleic Acids Res. 31:1180-1190.[Abstract/Free Full Text]
  78. 40
  79. James, C. D., and M. Leffak. 1986. Polarity of DNA replication through the avian alpha-globin locus. Mol. Cell. Biol. 6:976-984.[Abstract/Free Full Text]
  80. 41
  81. Kamath, S., and M. Leffak. 2001. Multiple sites of replication initiation in the human beta-globin gene locus. Nucleic Acids Res. 29:809-817.[Abstract/Free Full Text]
  82. 42
  83. Kedinger, C., M. Gniazdowski, J. L. Mandel, Jr., F. Gissinger, and P. Chambon. 1970. Alpha-amanitin: a specific inhibitor of one of two DNA-pendent RNA polymerase activities from calf thymus. Biochem. Biophys. Res. Commun. 38:165-171.[CrossRef][Medline]
  84. 43
  85. Kohzaki, H., Y. Ito, and Y. Murakami. 1999. Context-dependent modulation of replication activity of Saccharomyces cerevisiae autonomously replicating sequences by transcription factors. Mol. Cell. Biol. 19:7428-7435.[Abstract/Free Full Text]
  86. 44
  87. Kumar, S., and M. Leffak. 1991. Conserved chromatin structure in c-myc 5' flanking DNA after viral transduction. J. Mol. Biol. 222:45-57.[CrossRef][Medline]
  88. 45
  89. Kumar, S., and M. Leffak. 1989. DNA topology of the ordered chromatin domain 5' to the human c-myc gene. Nucleic Acids Res. 17:2819-2833.[Abstract/Free Full Text]
  90. 46
  91. Leffak, M., and C. D. James. 1989. Opposite replication polarity of the germ line c-myc gene in HeLa cells compared with that of two Burkitt lymphoma cell lines. Mol. Cell. Biol. 9:586-593.[Abstract/Free Full Text]
  92. 47
  93. Li, R., and M. R. Botchan. 1993. The acidic transcriptional activation domains of VP16 and p53 bind the cellular replication protein A and stimulate in vitro BPV-1 DNA replication. Cell 73:1207-1221.[CrossRef][Medline]
  94. 48
  95. Lin, C. M., H. Fu, M. Martinovsky, E. Bouhassira, and M. I. Aladjem. 2003. Dynamic alterations of replication timing in mammalian cells. Curr. Biol. 13:1019-1028.[CrossRef][Medline]
  96. 49
  97. Lindell, T. J., F. Weinberg, P. W. Morris, R. G. Roeder, and W. J. Rutter. 1970. Specific inhibition of nuclear RNA polymerase II by alpha-amanitin. Science 170:447-449.[Abstract/Free Full Text]
  98. 50
  99. Little, R. D., T. H. Platt, and C. L. Schildkraut. 1993. Initiation and termination of DNA replication in human rRNA genes. Mol. Cell. Biol. 13:6600-6613.[Abstract/Free Full Text]
  100. 51
  101. Liu, G., M. Malott, and M. Leffak. 2003. Multiple functional elements comprise a mammalian chromosomal replicator. Mol. Cell. Biol. 23:1832-1842.[Abstract/Free Full Text]
  102. 52
  103. Malott, M., and M. Leffak. 1999. Activity of the c-myc replicator at an ectopic chromosomal location. Mol. Cell. Biol. 19:5685-5695.[Abstract/Free Full Text]
  104. 53
  105. Maser, R. S., O. K. Mirzoeva, J. Wells, H. Olivares, B. R. Williams, R. A. Zinkel, P. J. Farnham, and J. H. Petrini. 2001. Mre11 complex and DNA replication: linkage to E2F and sites of DNA synthesis. Mol. Cell. Biol. 21:6006-6016.[Abstract/Free Full Text]
  106. 54
  107. McWhinney, C., and M. Leffak. 1990. Autonomous replication of a DNA fragment containing the chromosomal replication origin of the human c-myc gene. Nucleic Acids Res. 18:1233-1242.[Abstract/Free Full Text]
  108. 55
  109. McWhinney, C., and M. Leffak. 1988. Episomal persistence of a plasmid containing human c-myc DNA, p. 467-471. In B. Stillman and T. Kelly (ed.), Cancer cells, vol. 6. CSH Laboratory Press, New York, N.Y.
  110. 56
  111. McWhinney, C., S. E. Waltz, and M. Leffak. 1995. Cis-acting effects of sequences within 2.4-kb upstream of the human c-myc gene on autonomous plasmid replication in HeLa cells. DNA Cell Biol. 14:565-579.[Medline]
  112. 57
  113. Mechali, M. 2001. DNA replication origins: from sequence specificity to epigenetics. Nat. Rev. Genet. 2:640-645.[Medline]
  114. 58
  115. Michelotti, G. A., E. F. Michelotti, A. Pullner, R. C. Duncan, D. Eick, and D. Levens. 1996. Multiple single-stranded cis elements are associated with activated chromatin of the human c-myc gene in vivo. Mol. Cell. Biol. 16:2656-2669.[Abstract]
  116. 59
  117. Mirkovitch, J., and J. E. Darnell, Jr. 1992. Mapping of RNA polymerase on mammalian genes in cells and nuclei. Mol. Biol. Cell 3:1085-1094.[Abstract]
  118. 60
  119. Miyagi, S., Y. P. Zhao, Y. Saitoh, K. Tamai, and K. I. Tsutsumi. 2001. Replication of the rat aldolase B locus differs between aldolase B-expressing and non-expressing cells. FEBS Lett. 505:332-336.[CrossRef][Medline]
  120. 61
  121. Motulsky, H. 1995. Intuitive biostatistics. Oxford University Press, New York, N.Y.
  122. 62
  123. Navas, P. A., R. A. Swank, M. Yu, K. R. Peterson, and G. Stamatoyannopoulos. 2003. Mutation of a transcriptional motif of a distant regulatory element reduces the expression of embryonic and fetal globin genes. Hum. Mol. Genet. 12:2941-2948.[Abstract/Free Full Text]
  124. 63
  125. Nissen, R. M., and K. R. Yamamoto. 2000. The glucocorticoid receptor inhibits NFkappaB by interfering with serine-2 phosphorylation of the RNA polymerase II carboxy-terminal domain. Genes Dev. 14:2314-2329.[Abstract/Free Full Text]
  126. 64
  127. Ohba, R., K. Matsumoto, and Y. Ishimi. 1996. Induction of DNA replication by transcription in the region upstream of the human c-myc gene in a model replication system. Mol. Cell. Biol. 16:5754-5763.[Abstract]
  128. 65
  129. Paixao, S., I. N. Colaluca, M. Cubells, F. A. Peverali, A. Destro, S. Giadrossi, M. Giacca, A. Falaschi, S. Riva, and G. Biamonti. 2004. Modular structure of the human lamin B2 replicator. Mol. Cell. Biol. 24:2958-2967.[Abstract/Free Full Text]
  130. 66
  131. Parthun, M. R., J. Widom, and D. E. Gottschling. 1996. The major cytoplasmic histone acetyltransferase in yeast: links to chromatin replication and histone metabolism. Cell 87:85-94.[CrossRef][Medline]
  132. 67
  133. Postel, E. H., S. E. Mango, and S. J. Flint. 1989. A nuclease-hypersensitive element of the human c-myc promoter interacts with a transcription initiation factor. Mol. Cell. Biol. 9:5123-5133.[Abstract/Free Full Text]
  134. 68
  135. Prioleau, M.-N., M.-C. Gendron, and O. Hyrien. 2003. Replication of the chicken ß-globin locus: early-firing origins at the 5' HS4 insulator and the {rho}- and ßA-globin genes show opposite epigenetic modifications. Mol. Cell. Biol. 23:3536-3549.[Abstract/Free Full Text]
  136. 69
  137. Quinn, P. G. 1993. Distinct activation domains within cAMP response element-binding protein (CREB) mediate basal and cAMP-stimulated transcription. J. Biol. Chem. 268:16999-17009.[Abstract/Free Full Text]
  138. 70
  139. Ritzi, M., K. Tillack, J. Gerhardt, E. Ott, S. Humme, E. Kremmer, W. Hammerschmidt, and A. Schepers. 2003. Complex protein-DNA dynamics at the latent origin of DNA replication of Epstein-Barr virus. J. Cell Sci. 116:3971-3984.[Abstract/Free Full Text]
  140. 71
  141. Roussel, M. F., J. N. Davis, J. L. Cleveland, J. Ghysdael, and S. W. Hiebert. 1994. Dual control of myc expression through a single DNA binding site targeted by ets family proteins and E2F-1. Oncogene 9:405-415.[Medline]
  142. 72
  143. Rudd, M. D., and D. S. Luse. 1996. Amanitin greatly reduces the rate of transcription by RNA polymerase II ternary complexes but fails to inhibit some transcript cleavage modes. J. Biol. Chem. 271:21549-21558.[Abstract/Free Full Text]
  144. 73
  145. Sambrook, J., E. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  146. 74
  147. Sawado, T., J. Halow, M. A. Bender, and M. Groudine. 2003. The beta-globin locus control region (LCR) functions primarily by enhancing the transition from transcription initiation to elongation. Genes Dev. 17:1009-1018.[Abstract/Free Full Text]
  148. 75
  149. Schepers, A., M. Ritzi, K. Bousset, E. Kremmer, J. L. Yates, J. Harwood, J. F. Diffley, and W. Hammerschmidt. 2001. Human origin recognition complex binds to the region of the latent origin of DNA replication of Epstein-Barr virus. EMBO J. 20:4588-4602.[CrossRef][Medline]
  150. 76
  151. Schubeler, D., D. Scalzo, C. Kooperberg, B. van Steensel, J. Delrow, and M. Groudine. 2002. Genome-wide DNA replication profile for Drosophila melanogaster: a link between transcription and replication timing. Nat. Genet. 32:438-442.[CrossRef][Medline]
  152. 77
  153. Scribner, K. B., and M. M. McGrane. 2003. RNA polymerase II association with the phosphoenolpyruvate carboxykinase (PEPCK) promoter is reduced in vitamin A-deficient mice. J. Nutr. 133:4112-4117.[Abstract/Free Full Text]
  154. 78
  155. Siebenlist, U., L. Hennighausen, J. Battey, and P. Leder. 1984. Chromatin structure and protein binding in the putative regulatory region of the c-myc gene in Burkitt lymphoma. Cell 37:381-391.[CrossRef][Medline]
  156. 79
  157. Tahara, T., J. Sun, K. Nakanishi, M. Yamamoto, H. Mori, T. Saito, H. Fujita, K. Igarashi, and S. Taketani. 2004. Heme positively regulates the expression of ß-globin at the locus control region via the transcriptional factor Bach1 in erythroid cells. J. Biol. Chem. 279:5480-5487.[Abstract/Free Full Text]
  158. 80
  159. Tao, L., Z. Dong, M. Leffak, M. Zannis-Hadjopoulos, and G. Price. 2000. Major DNA replication initiation sites in the c-myc locus in human cells. J. Cell. Biochem. 78:442-457.[CrossRef][Medline]
  160. 81
  161. Trempe, J. P., Y. I. Lindstrom, and M. Leffak. 1988. Opposite replication polarities of transcribed and nontranscribed histone H5 genes. Mol. Cell. Biol. 8:1657-1663.[Abstract/Free Full Text]
  162. 82
  163. Trivedi, A., S. E. Waltz, S. Kamath, and M. Leffak. 1998. Multiple initiations in the c-myc replication origin independent of chromosomal location. DNA Cell Biol. 17:885-896.[Medline]
  164. 83
  165. Vassilev, L., and E. M. Johnson. 1990. An initiation zone of chromosomal DNA replication located upstream of the c-myc gene in proliferating HeLa cells. Mol. Cell. Biol. 10:4899-4904.[Abstract/Free Full Text]
  166. 84
  167. Waltz, S. E., A. A. Trivedi, and M. Leffak. 1996. DNA replication initiates non-randomly at multiple sites near the c-myc gene in HeLa cells. Nucleic Acids Res. 24:1887-1894.[Abstract/Free Full Text]
  168. 85
  169. Wang, L., C. M. Lin, S. Brooks, D. Cimbora, M. Groudine, and M. I. Aladjem. 2004. The human beta-globin replication initiation region consists of two modular independent replicators. Mol. Cell. Biol. 24:3373-3386.[Abstract/Free Full Text]
  170. 86
  171. Zhang, J. J., Y. Zhao, B. T. Chait, W. W. Lathem, M. Ritzi, R. Knippers, and J. E. Darnell, Jr. 1998. Ser727-dependent recruitment of MCM5 by Stat1alpha in IFN-gamma-induced transcriptional activation. EMBO J. 17:6963-6971.[CrossRef][Medline]
  172. 87
  173. Zobel, A., F. Kalkbrenner, S. Guehmann, M. Nawrath, G. Vorbrueggen, and K. Moelling. 1991. Interaction of the v-and c-Myb proteins with regulatory sequences of the human c-myc gene. Oncogene 6:1397-1407.[Medline]


Molecular and Cellular Biology, December 2004, p. 10193-10207, Vol. 24, No. 23
0270-7306/04/$08.00+0     DOI: 10.1128/MCB.24.23.10193-10207.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Thomae, A. W., Pich, D., Brocher, J., Spindler, M.-P., Berens, C., Hock, R., Hammerschmidt, W., Schepers, A. (2008). Interaction between HMGA1a and the origin recognition complex creates site-specific replication origins. Proc. Natl. Acad. Sci. USA 105: 1692-1697 [Abstract] [Full Text]  
  • Liu, G., Bissler, J. J., Sinden, R. R., Leffak, M. (2007). Unstable Spinocerebellar Ataxia Type 10 (ATTCT){middle dot}(AGAAT) Repeats Are Associated with Aberrant Replication at the ATX10 Locus and Replication Origin-Dependent Expansion at an Ectopic Site in Human Cells. Mol. Cell. Biol. 27: 7828-7838 [Abstract] [Full Text]  
  • Huvet, M., Nicolay, S., Touchon, M., Audit, B., d'Aubenton-Carafa, Y., Arneodo, A., Thermes, C. (2007). Human gene organization driven by the coordination of replication and transcription. Genome Res 17: 1278-1285 [Abstract] [Full Text]  
  • Kemp, M., Bae, B., Yu, J. P., Ghosh, M., Leffak, M., Nair, S. K. (2007). Structure and Function of the c-myc DNA-unwinding Element-binding Protein DUE-B. J. Biol. Chem. 282: 10441-10448 [Abstract] [Full Text]  
  • Minami, H., Takahashi, J., Suto, A., Saitoh, Y., Tsutsumi, K.-i. (2006). Binding of AlF-C, an Orc1-Binding Transcriptional Regulator, Enhances Replicator Activity of the Rat Aldolase B Origin. Mol. Cell. Biol. 26: 8770-8780 [Abstract] [Full Text]  
  • Ghosh, M., Kemp, M., Liu, G., Ritzi, M., Schepers, A., Leffak, M. (2006). Differential Binding of Replication Proteins across the Human c-myc Replicator.. Mol. Cell. Biol. 26: 5270-5283 [Abstract] [Full Text]  
  • Hayashida, T., Oda, M., Ohsawa, K., Yamaguchi, A., Hosozawa, T., Locksley, R. M., Giacca, M., Masai, H., Miyatake, S. (2006). Replication Initiation from a Novel Origin Identified in the Th2 Cytokine Cluster Locus Requires a Distant Conserved Noncoding Sequence. J. Immunol. 176: 5446-5454 [Abstract] [Full Text]  
  • Buzina, A., Aladjem, M. I., Kolman, J. L., Wahl, G. M., Ellis, J. (2005). Initiation of DNA replication at the human {beta}-globin 3' enhancer. Nucleic Acids Res 33: 4412-4424 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An erratum has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ghosh, M.
Right arrow Articles by Leffak, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ghosh, M.
Right arrow Articles by Leffak, M.