Institute of Molecular Medicine, College of Medicine, National Taiwan University, Taipei, Taiwan
Received 20 April 2004/ Returned for modification 11 June 2004/ Accepted 9 September 2004
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Little is known about the signal transduction pathway in which Brk is involved. Brk expression sensitizes the mammary epithelial cells to the mitogenic response of epidermal growth factor (EGF) and potentiates their anchorage-independent growth (20). Accordingly, Brk was found to associate with EGF receptor and enhance EGF-dependent phosphorylation of erbB3, which subsequently leads to an increased recruitment of phosphoinositide 3-kinase (PI 3-kinase) and activation of Akt (19). This finding links Brk to the EGF-induced activation of PI 3-kinase/Akt pathway and may provide a mechanistic insight into Brk-dependent mitogenic sensitization. However, whether Brk is involved in other pathways induced by EGF and whether the catalytic activity of Brk is regulated by EGF signaling have not been explored.
Since the identification of Brk from metastatic breast carcinoma, it remains unclear whether this kinase contributes to the metastatic malignancy. To date, two substrates of Brk/Sik have been identified, i.e., the adaptor-like protein BKS (38) and the nuclear RNA-binding protein Sam68 (11). BKS possesses a PH-like domain, followed by an SH2 domain, and has recently been found to play a regulatory role in STAT3 activation (35). The physiological significance of BKS phosphorylation by Brk, however, is unclear. Another substrate is Sam68, which belongs to a member of the STAR family of RNA-binding proteins that regulate RNA metabolism (59). Phosphorylation of Sam68 by Brk attenuates its RNA-binding ability and Brk colocalizes with Sam68 in the nucleus (11). These findings point out a physiological role of Brk in regulating RNA function, although it remains largely elusive whether and how this effect contributes to the oncogenic function of Brk.
Paxillin is a multidomain protein that is recruited to the leading edges of cells upon the initiation of migration. It primarily functions as a molecular scaffold that provides multiple docking sites at the plasma membrane for an array of signaling, adaptor, and structural proteins (56). The motifs and domains present in paxillin include LIM domains, leucine-rich motifs (termed LD repeats), proline-rich sequences, and phosphotyrosine binding sites (46, 56). The LD repeats serve as binding regions for the focal adhesion proteins FAK, vinculin (7), the FAK-related kinase Pyk2 (57), and the ARF GAP, Git/PKL/CAT (57), whereas the LIM domains are crucial for focal adhesion targeting of paxillin (7), presumably through its association with the ß-integrin tails. Importantly, many of the paxillin interacting proteins are involved in the regulation of actin cytoskeleton organization, which is necessary for cell motility events associated with diverse biological responses, such as embryonic development, wound repair, and tumor metastasis (46). Accordingly, paxillin-null mice die at embryonic day 9.5 and display impaired development of heart and somites (16). Furthermore, paxillin-null fibroblasts show abnormalities in focal adhesion structure and cortical actin cytoskeleton and have reduced rates of cell spreading and migration (16).
Paxillin undergoes tyrosine phosphorylation in response to various physiological stimuli and integrin-mediated cell adhesion events (46). Paxillin has four major tyrosine phosphorylation sites: Y31, Y40, Y118, and Y181 (40). Among them, phosphorylation of Y31/118 is highly augmented during cell adhesion and migration (40). These two phosphorylated residues serve as docking sites for the recruitment of downstream effectors such as Crk (42, 47) and p120RasGAP (55), thereby regulating cell motility and adhesion, respectively. In Nara Bladder Tumor II cells, replacement of Y31 and/or Y118 with phenylalanine greatly reduces CrkII association and cell motility (42), even though other reports demonstrated that the downstream events of paxillin tyrosine phosphorylation are cell type specific and could be influenced by the presence of other Crk-associated proteins, such as p130Cas (61). Notably, although a large number of stimuli induce tyrosine phosphorylation of paxillin, only a few tyrosine kinases have been reported to phosphorylate paxillin (46). FAK and its related protein Pyk2 interact and colocalize with paxillin, and evidence from both in vitro and in vivo studies indicates paxillin as a substrate of these kinases (5, 17, 47). Src family kinases have also been implicated in regulating tyrosine phosphorylation of paxillin since such phosphorylation is enhanced in fibroblasts derived from mice lacking Csk (an Src inhibitory kinase) (53) and decreased in SYF cells, which lacks Src, Fyn, and Yes (22). Furthermore, a recent study demonstrated a direct phosphorylation of paxillin by Src (18). In addition to FAK and Src, the proto-oncogene c-Abl was shown to associate with paxillin upon cell adhesion and to phosphorylate paxillin in vitro (26).
We report here the identification of a novel paxillin tyrosine kinase, Brk. Brk directly binds and phosphorylates paxillin both in vitro and in vivo and functions as a crucial mediator of EGF-induced paxillin phosphorylation at Y31 and Y118. As a consequence, Brk promotes the activation of Rac1, thereby stimulating cell migration and invasion in response to EGF. Our findings not only reveal a role of Brk in EGF-induced cell motility but also provide the first potential link between Brk and metastatic malignancy.
| MATERIALS AND METHODS |
|---|
|
|
|---|
cDNA cloning and plasmid constructions.
The cDNA of Brk was generated by reverse transcription-PCR with RNA purified from T-47D human breast carcinoma cells, and its sequence was verified by sequencing analysis. This cDNA fragment was cloned into pRK5M and pRK5F to generate C-terminally myc- and Flag-tagged Brk, respectively. The BrkKM mutant was generated by PCR amplification with the primers 5'-ACAAGATCTGGCGGCGTGCC-3' and 5'-TTGTCTCGAGAAATCACCATAATGGCCACC-3' and the Advantage-GC 2 PCR kit (Clontech). The resulting fragment was digested by BglII and XhoI and was used to replace the BglII-XhoI fragment of pRK5M-Brk. The Brk
SH2 mutant was constructed by a similar PCR-based strategy, whereas the Brk
SH3 mutant was made by in vitro mutagenesis with a QuikChange site-directed mutagenesis kit. To obtain the full-length cDNA sequence of paxillin, two expressed sequence tag clones, BM561570 and BQ218095, covering the 5' and 3' of paxillin, respectively, were purchased from Open Biosystems. These two fragments were ligated by using the overlapping SacI site and cloned into pBluescript. The resulting full-length paxillin cDNA was cloned to pRK5F or pBabePuro3 or used as a template to generate its N-terminal and C-terminal deletion mutants by a PCR approach. The paxillinDYF mutant, in which the tyrosine 31 and tyrosine 118 were both replaced by phenylalanine, was constructed by site-directed mutagenesis and then subcloned to pBabeHygro. CrkII R38K and CrkII W170K mutants were generated by site-directed mutagenesis with the wild-type cDNA as a template.
Antibodies and reagents. Antibodies to phosphotyrosine (4G10) and Rac1 (23A8), Src, and p418 Src were from UBI, whereas anti-Brk and anti-myc (9E10) were from Santa Cruz. The paxillin antibody was from BD Biosciences, and the antibodies specifically recognizing Y31- and Y118-phosphorylated paxillin were from Biosource. Anti-Flag M2 antibody was from Sigma, whereas anti-FAK was from Transduction Laboratories. EGF was purchased from UBI.
GST fusion proteins. The cDNA fragments for paxillin and its mutant were cloned to pGEX-4T vector to generate glutathione S-transferase (GST) fusion proteins. Production and purification of the GST fusion proteins were performed as described previously (54). For purification of GST-PAK-CRIB, bacteria were lysed in buffer containing 50 mM Tris (pH 7.5), 150 mM NaCl, 5 mM MgCl2, 1 mM dithiothreitol, 1% Triton X-100, and 1 mM phenylmethylsulfonyl fluoride (PMSF) by vortexing the mixture for 15 min to 1 h at 4°C, followed by sonication two to three times at 4°C. Cell debris was removed by centrifugation at 10,000 rpm for 10 min, and the supernatant was incubated with glutathione-Sepharose beads for 1.5 h at 4°C. The beads were washed five to eight times with lysis buffer and then resuspended in lysis buffer containing 5% glycerol.
Production of baculovirus. The cDNA for Brk or BrkKM containing a Flag tag was cloned to pVL1392 vector. These plasmids, together with the linearized baculovirus DNA (BaculoGold; Pharmingen), were introduced into monolayers of Sf9 cells cultured in Grace's medium (Life Technologies) supplemented with 10% FCS. The recombinant virus was harvested, amplified, and then used to infect monolayers of Sf9 cells in TMN-FH medium. After a 4-day incubation, the Flag-tagged Brk was purified by using the anti-Flag M2 agarose (Sigma).
Immunoprecipitations. Cells were lysed in radioimmunoprecipitation assay buffer containing 50 mM Tris (pH 8.0), 0.15 M NaCl, 1% NP-40, 0.5% deoxycholic acid, 0.1% sodium dodecyl sulfate (SDS), 1 mM PMSF, 1 µg of aprotinin/ml, 1 µg of leupeptin/ml, 1 mM sodium vanadate, 4 mM sodium pyrophosphate, and 20 mM NaF. Lysates containing equal amount of proteins were subjected to immunoprecipitation as described previously (54).
In vitro kinase assay.
293 or Sf9 cells expressing Brk or BrkKM were lysed in Brk lysis buffer containing 50 mM HEPES (pH 7.4), 150 mM NaCl, 5 mM MgCl2, 1 mM EGTA, 1% Triton X-100, 1 mM PMSF, 1 µg of aprotonin/ml, 1 µg of leupeptin/ml, 1 mM sodium vanadate, 4 mM sodium pyrophosphate, and 20 mM NaF. Brk or BrkKM was precipitated from cell lysates by anti-Flag antibody and then incubated in 30 µl of kinase buffer containing 50 mM HEPES (pH 7.5), 10 mM MgCl2, 10 mM MnCl2, 1 mM DTT, 10 µM ATP, and 10 µCi of [
-32P]ATP in the presence or absence of 2 µg of GST-paxillin or GST-paxillinDYF mutant at 30°C for 10 min. The reaction was stopped by boiling in SDS sample buffer, separated by SDS-polyacrylamide gel electrophoresis (PAGE), and analyzed by autoradiography, Coomassie blue staining, or Western blotting. To determine the stoichiometry of phosphorylation of paxillin by Brk, 0.8 µg of Flag-tagged Brk immobilized on protein G beads was incubated with 0.05 µg of GST-paxillin in 10 µl of kinase reaction mixture as described above. The reaction was allowed to proceed for 0 to 60 min and then stopped by boiling in SDS sample buffer. The reaction products were separated by SDS-PAGE, and the protein band corresponding to GST-paxillin was excised. 32P incorporation was determined by scintillation counting to calculate the number of moles of phosphate transferred per moles of recombinant GST-paxillin.
Assay for GTP-bound Rac. Detection and quantitation of GTP-bound Rac1 was performed essentially as described previously (45). Cells were lysed in Rac lysis buffer containing 25 mM HEPES (pH 7.5), 150 mM NaCl, 10 mM MgCl2, 1 mM EDTA, 1% Triton X-100, 10% glycerol, 1 mM PMSF, 1 µg of aprotinin/ml, 1 µg of leupeptin/ml, 1 mM sodium vanadate, 4 mM sodium pyrophosphate, and 20 mM NaF. Then, 300 µl of cell lysate was incubated with 10 µg of GST-PAK-CRIB at 4°C for 1.5 h. The pull-down complexes were washed with Rac lysis buffer three times and then subjected to Western blotting to detect the bound Rac.
Immunofluorescence and confocal studies. A431 cells were fixed with 3.7% paraformaldehyde in phosphate-buffered saline at 4°C overnight, followed by permeabilization with extraction buffer containing 50 mM NaCl, 300 mM sucrose, 10 mM PIPES (pH 6.8), 3 mM MgCl2, and 0.5% Triton X-100 for 7 min. Cells were blocked with phosphate-buffered saline supplemented with 10% goat serum, 1% bovine serum albumin, and 50 mM NH4Cl for 1 h and then incubated with anti-Brk antibody for 2 h, followed by incubation with anti-paxillin antibody for 1.5 h. Cells were then washed and incubated with Alexa Fluor 488- and Texas red-conjugated secondary antibodies. Cells were then washed, mounted, and examined with a Leica DM RA epifluorescence microscope or a Leica TCS SP2 confocal laser-scanning microscope with a x63 or x100 oil objective lens. Fluorescent images were captured by using the MetaMorph Image System and then processed by using Adobe Photoshop software.
Cell migration assays. For chemotaxis assays, Transwell chamber filters (8-µm pore size; Costar) were coated with 15 µg of collagen/ml on both sides. Serum-starved cells (104) resuspended in DMEM with 1% bovine serum albumin were added to the upper chamber. The same medium supplemented with 0.15 to 15 ng of EGF/ml as a chemoattractant was added to the lower chamber. After incubation at 37°C for 3 to 5 h, the cells on the upper side of the filter were removed by wiping it with a cotton swab, and migratory cells on the lower membrane surface were then counted. When transiently transfected cells were used for this assay, green fluorescent protein (GFP)-positive cells migrated to the underside of the filter were counted under a fluorescence microscope. Each assay was set up in triplicate, and at least five random fields were analyzed for each filter.
For wound-healing migration assay by time-lapse video microscopy, confluent cells were wounded by using disposable plastic tips and washed with growth medium. Dishes were placed in an open chamber with atmospheric and temperature controls, and cell movement was viewed by using a Zeiss Axiovert 100 TV microscope equipped with a cooled charge-coupled device video camera. Phase-contrast images obtained at 5-min intervals were collected. In some cases, fluorescence images were also obtained during the recording period. Images were analyzed with the Metamorph program and processed by using Adobe Photoshop software.
Cell invasion assays. Cells were serum starved for 6 h and then seeded at a density of 104 per well in the upper chamber of Transwells precoated with 54 µg of Matrigel (BD Biosciences). DMEM containing 10 ng of EGF/ml was added to the lower chamber. After incubation for 48 h, cells that appeared on the lower side of filter were counted as described for the Transwell cell migration assay.
Reduction of endogenous Brk expression with siRNA. A 19-nucleotide small interfering RNA (siRNA) duplex with 3' TT overhangs corresponding to the Brk mRNA positions 645 to 663 (AAGGUGGCCAUUAAGGUGAUU) and a control siRNA were synthesized by Dharmacon. siRNA transfections were performed by using the RNAi Shuttle Transfection Kit (Orbigen) according to the manufacturer's protocol. To achieve a high efficiency of transfection, cells were transfected three times at 24-h intervals. After transfection, cells were harvested for Western blot analysis or assayed for migration.
| RESULTS |
|---|
|
|
|---|
68 kDa were significantly induced in cells overexpressing Brk compared to those carrying BrkKM or a control vector (Fig. 1A). A similar induction of the phosphorylation of proteins
68 kDa by Brk was observed in 293T cells and Cos-1 cells (data not shown). In searching for cellular proteins with a molecular mass of
68 kDa, we noticed that the 68-kDa protein paxillin serves as a substrate for certain Src family kinases (18, 22, 53). Furthermore, paxillin is an abundant cellular protein, which is coincident with the broad, strong band revealed by our Western blots. In addition, overexpression of Brk in certain epithelial cells induced biological and morphological effects that resembled those induced by paxillin phosphorylation (see below). We therefore investigated whether Brk could promote paxillin phosphorylation. Indeed, overexpression of Brk in quiescent Cos-1 cells led to a marked enhancement of paxillin tyrosine phosphorylation, as determined by immunoprecipitation with anti-paxillin antibody followed by Western blotting with the anti-phosphotyrosine antibody. This induction of paxillin phosphorylation was not observed in cells expressing BrkKM (Fig. 1B), indicating a requirement of Brk catalytic activity. Similar induction of paxillin tyrosine phosphorylation by Brk, but not BrkKM, was observed in 293T, HaCaT (Fig. 1B), and HeLa cells (data not shown). In contrast, Brk did not promote FAK tyrosine phosphorylation (Fig. 1C), indicating that the induction of paxillin tyrosine phosphorylation in cells overexpressing Brk is independent of FAK. To determine the tyrosine residues that are involved in this phosphorylation event, we utilized phosphorylation-specific paxillin antibodies. This analysis revealed that phosphorylation at both Y31 and Y118 was increased in cells expressing Brk (Fig. 1D). To investigate whether these two residues are the major phosphorylation sites targeted by Brk, we generated a Flag-tagged paxillin mutant (paxillinDYF), in which the Y31 and Y118 were both replaced by phenylalanine. When this mutant and Brk were coexpressed in Cos-1 cells, we found that Brk could not phosphorylate the paxillinDYF mutant (Fig. 1E). Altogether, our data indicate that Brk promotes paxillin phosphorylation at Y31 and Y118 in vivo.
|
SH2 and Brk
SH3 mutants in which the SH2 and SH3 domains, respectively, were deleted. Notably, deletion of either the SH2 or the SH3 domain of Brk almost completely abolished its interaction with paxillin (Fig. 2C), indicating that both domains are important for this interaction. Next, we mapped the region in paxillin involved in Brk interaction. Flag-tagged full-length paxillin, its N-terminal LD motif-containing region (amino acids 1 to 315), or the C-terminal LIM domain-containing region (amino acids 316 to 557), together with myc-tagged Brk, was coexpressed in Cos-1 cells, and cell lysates were used for immunoprecipitation analysis. We found that both the N-terminal and C-terminal segments of paxillin displayed weak interactions with Brk compared to the full-length protein (Fig. 2D). Together, these results reveal a complex interaction mode of the two proteins and suggest the involvement of multiple regions in their interaction.
|
1.61 mol of phosphate incorporation per mol of GST-paxillin (Fig. 3C), a finding consistent with two phosphorylation sites. Taken together, these results not only identify paxillin as a direct substrate of Brk but also indicate that Y31 and Y118 are the principal sites phosphorylated by Brk.
|
|
|
Brk is colocalized with paxillin at the leading cell edges of migratory cells. The identification of Brk as a paxillin kinase and a mediator of EGF-induced paxillin phosphorylation prompted us to examine whether Brk could colocalize with paxillin in any subcellular compartment. Paxillin is a focal adhesion protein and recruited to the leading cell edges upon the initiation of migration (24, 46). Furthermore, the phosphorylation of paxillin at Y31 and Y118 is highly augmented during cell migration, and this phosphorylated protein is present at the leading cell edges of the migrating epithelial cells (41). To monitor the subcellular localization of Brk during cell migration, confluent A431 cells were induced for migration by scrapping to generate a cell-free zone, as used in the "wound healing" motility assay. Immediately after wounding, endogenous paxillin was mainly localized in the cytoplasm, whereas endogenous Brk was distributed in both the cytoplasm and the nucleus (Fig. 6A). At 2 h after wounding, membrane ruffles prevailed at the leading edges, indicating the highly migratory behavior of the cells. Importantly, at this time we observed an accumulation of Brk to the membrane ruffles, where it was almost completely colocalized with paxillin. The Brk image also partially merged with that of Y31/118-phosphorylated paxillin at the cell periphery at this time point (Fig. 6B). At 6 h after wounding, certain cells formed prominent focal adhesions at the cell periphery. Notably, Brk was relocalized back to the cytoplasm and nucleus and was virtually absent at these focal adhesions (Fig. 6A). This dynamic distribution of Brk and its colocalization with paxillin not only further strengthens the relationship between the two proteins but also implies a possible role of Brk in cell migration.
|
|
In addition to Transwell motility analysis, a wound-healing assay was performed as an alternative method for monitoring cell migration. In this assay, Cos-1 cells cotransfected with GFP and BrkKM (or a control vector) were grown to confluent and then wounded by scratching. Cell migration toward the wound was recorded by time-lapse video microscopy, and cells expressing BrkKM or the control vector were traced by monitoring their GFP fluorescence. At 16 h after wounding, Cos-1 cells transfected with a control vector were capable of moving into the center of the wound. However, cells expressing BrkKM failed to migrate into the center of the wound at this time point (Fig. 8). A similar reduction in wound-induced migratory event was seen in HeLa cells expressing BrkKM (data not shown). To demonstrate a physiological role of Brk in cell migration, we assessed whether knockdown of the endogenous Brk would impair motility. Using a Brk-specific siRNA, but not a control siRNA, we were able to reduce the expression of Brk in HeLa cells to 15% of the endogenous level (Fig. 9A). When these siRNA-treated cells and parental HeLa cells were tested for EGF-induced chemotaxis by using Transwell assays, we observed a nearly complete inhibition of EGF-induced motility in cells receiving Brk siRNA compared to those treated with a control siRNA or without siRNA (Fig. 9B). In addition, these Brk siRNA-treated cells displayed a significant reduction in wound-induced migration (Fig. 9C). Together, the results not only provide additional evidence for the role of Brk in motility but also demonstrate a physiological significance of this effect of Brk.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
|
, and PI 3-kinase (4, 31, 49, 50, 52). Therefore, it is likely that multiple pathways elicited by EGF converge on the Rac1 activation, thereby promoting cell morphogenesis and motility. Consistent with this notion, we show that blockage of Brk activity or paxillin phosphorylation significantly reduced but did not completely inhibit EGF-induced Rac1 activity. Our study identified paxillin as a binding partner and a direct substrate of Brk. The association of Brk and paxillin is complex and involves the SH2 and SH3 domains of Brk and the N-terminal and C-terminal regions of paxillin. Notably, the SH2 and SH3 domains of Brk are also involved in the interaction with another Brk substrate, Sam68 (11), and similar substrate binding via SH2 and SH3 domains has been reported for Src family kinases (8). To date, only a few tyrosine kinases have been implicated in regulating the phosphorylation of paxillin (46). FAK and its related protein CAKß/Pyk2 are the two major players controlling the tyrosine phosphorylation of paxillin (1, 47). Similar to Brk, these two kinases physically associate with paxillin and phosphorylate paxillin at Y31 and Y118 (1, 48). However, Brk differs from FAK in certain aspects. First, Brk is recruited to membrane ruffles but not focal adhesions in migratory cells, whereas FAK is a major component of focal adhesions. Second, FAK is activated in response to both growth factors and integrin signaling (48), whereas the catalytic activity of Brk is not significantly regulated by integrin-mediated cell adhesions. These divergences of Brk with FAK predict a more restricted role of Brk in regulating growth factor (e.g., EGF)-induced motility rather than integrin-mediated cell adhesions. Consistent with this notion, Brk overexpression did not significantly affect the adhesion of Cos-1 cell on fibronectin (data not shown).
Phosphorylation of paxillin at Y31 and Y118 is reported to promote migration (42) and affect focal adhesion dynamics (60). Mutation of these two tyrosine residues significantly decreases the disassembly rate of focal adhesions (60) and leads to the formation of large focal adhesion structures at the cell periphery (41). In addition to serving as a binding site for CrkII, Y31/118-phosphorylated paxillin is capable of recruiting p120RasGAP at the cell periphery, thereby releasing its binding partner p190RhoGAP to downregulate RhoA (55). This pathway is necessary for efficient membrane ruffling and spreading during cell migration (55). We hypothesize that Brk-induced paxillin phosphorylation might similarly decrease RhoA activity at the cell periphery, since inhibition of Brk activity in Cos-1 cells prevents membrane ruffling and extension in response to migratory cues (data not shown). The effect of Y31/118 phosphorylation on cell migration, however, seems to be context dependent (61). Since Y31/118-phosphorylated paxillin is present in both focal adhesions and leading cell edges, it has been proposed that this context-dependent migratory effect may have resulted from the distinct downstream signaling pathways engaged in the differentially localized phosphorylated paxillin (55). Consistent with this notion, the recruitment of p120RasGAP occurs only at leading cell edge but not at focal adhesions (55). In this regard, periphery-localized rather than focal-adhesion-localized Brk might selectively activate downstream pathways that promote cell migration by phosphorylating paxillin only at the cell periphery.
The details of the mechanism by which EGF induces the catalytic activity of Brk are currently unknown. Recent studies have revealed that, similar to Src family kinases, Brk activity is negatively regulated by intramolecular interactions, which involve the binding of SH2 and SH3 domains to the autophosphorylated Y447 residue and a proline-rich linker region, respectively (43, 44). Disruption of these interactions by binding to a synthetic SH2 or SH3 ligand leads to Brk activation (44). Since EGF stimulation induces the interaction of Brk with EGF receptor (19), presumably via the SH2 domain of Brk, this intermolecular interaction might relieve the intramolecular constraint, thereby activating Brk catalytic activity. Regardless of the specific mechanism, our finding that Brk is a downstream target of EGF is consistent with previous findings that Brk is able to enhance certain biological functions and signaling events of EGF (19, 20).
Overexpression of Brk has been found in >60% of breast carcinoma tissues and in several other cancer types (3, 13, 27, 34, 36), suggesting a role for Brk in tumorigenesis. Furthermore, during the progression of prostate cancers, Brk translocation from the nucleus to the cytoplasm was observed (10), implying that Brk might facilitate tumor progression by phosphorylating cytoplasmic proteins. Our finding that Brk phosphorylates the cytoplasm-localized paxillin, which in turn activates a signaling pathway to promote cell migration and invasion, correlates well with these expression data obtained from tumor cells and tissues. We hypothesize that Brk probably utilizes this pathway to participate in tumor progression and metastasis. In addition to promoting cell migration and invasion, Brk has also been reported to sensitize cells to the proliferation effect of EGF (20). Thus, Brk might elicit diverse biological effects, thereby participating in the distinct stages of tumorigenesis.
| ACKNOWLEDGMENTS |
|---|
This study was supported by grant NSC92-2312-B-002-005.
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
2. Bagrodia, S., S. J. Taylor, K. A. Jordon, L. Van Aelst, and R. A. Cerione. 1998. A novel regulator of p21-activated kinases. J. Biol. Chem. 273:23633-23636.
3. Barker, K. T., L. E. Jackson, and M. R. Crompton. 1997. BRK tyrosine kinase expression in a high proportion of human breast carcinomas. Oncogene 15:799-805.[CrossRef][Medline]
4. Bar-Sagi, D., and A. Hall. 2000. Ras and Rho GTPases: a family reunion. Cell 103:227-238.[CrossRef][Medline]
5. Bellis, S. L., J. T. Miller, and C. E. Turner. 1995. Characterization of tyrosine phosphorylation of paxillin in vitro by focal adhesion kinase. J. Biol. Chem. 270:17437-17441.
6. Blume-Jensen, P., and T. Hunter. 2001. Oncogenic kinase signaling. Nature 411:355-365.[CrossRef][Medline]
7. Brown, M. C., J. A. Perrotta, and C. E. Turner. 1996. Identification of LIM3 as the principal determinant of paxillin focal adhesion localization and characterization of a novel motif on paxillin directing vinculin and focal adhesion kinase binding. J. Cell Biol. 135:1109-1123.
8. Brown, M. T., and J. A. Cooper. 1996. Regulation, substrates and functions of src. Biochim. Biophys. Acta 1287:121-149.[Medline]
9. Brugnera, E., L. Haney, C. Grimsley, M. Lu, S. F. Walk, A. C. Tosello-Trampont, I. G. Macara, H. Madhani, G. R. Fink, and K. S. Ravichandran. 2002. Unconventional Rac-GEF activity is mediated through the Dock180-ELMO complex. Nat. Cell Biol. 4:574-582.[Medline]
10. Derry, J. J., G. S. Prins, V. Ray, and A. L. Tyner. 2003. Altered localization and activity of the intracellular tyrosine kinase BRK/Sik in prostate tumor cells. Oncogene 22:4212-4220.[CrossRef][Medline]
11. Derry, J. J., S. Richard, Valderrama-Carvajal, H., X. Ye, V. Vasioukhin, A. W. Cochrane, T. Chen, and A. L. Tyner. 2000. Sik (BRK) phosphorylates Sam68 in the nucleus and negatively regulates its RNA binding ability. Mol. Cell. Biol. 20:6114-6126.
12. Dolfi, F., M. Garcia-Guzman, M. Ojaniemi, H. Nakamura, M. Matsuda, and K. Vuori. 1998. The adaptor protein Crk connects multiple cellular stimuli to the JNK signaling pathway. Proc. Natl. Acad. Sci. USA 95:15394-15399.
13. Easty, D. J., P. J. Mitchell, K. Patel, V. A. Florenes, R. A. Spritz, and D. C. Bennett. 1997. Loss of expression of receptor tyrosine kinase family genes PTK7 and SEK in metastatic melanoma. Int. J. Cancer 71:1061-1065.[CrossRef][Medline]
14. Feller, S. M. 2001. Crk family adaptors-signalling complex formation and biological roles. Oncogene 20:6348-6371.[CrossRef][Medline]
15. Gumienny, T. L., E. Brugnera, A. C. Tosello-Trampont, J. M. Kinchen, L. B. Haney, K. Nishiwaki, S. F. Walk, M. E. Nemergut, I. G. Macara, R. Francis, T. Schedl, Y. Qin, L. Van Aelst, M. O. Hengartner, and K. S. Ravichandran. 2001. CED-12/ELMO, a novel member of the CrkII/Dock180/Rac pathway, is required for phagocytosis and cell migration. Cell 107:27-41.[CrossRef][Medline]
16. Hagel, M., E. L. George, A. Kim, R. Tamimi, S. L. Opitz, C. E. Turner, A. Imamoto, and S. M. Thomas. 2002. The adaptor protein paxillin is essential for normal development in the mouse and is a critical transducer of fibronectin signaling. Mol. Cell. Biol. 22:901-915.
17. Hanks, S. K., and T. R. Polte. 1997. Signaling through focal adhesion kinase. Bioessays 19:137-145.[CrossRef][Medline]
18. Ishibe, S., D. Joly, X. Zhu, and L. G. Cantley. 2003. Phosphorylation-dependent paxillin-ERK association mediates hepatocyte growth factor-stimulated epithelial morphogenesis. Mol. Cell 12:1275-1285.[CrossRef][Medline]
19. Kamalati, T., H. E. Jolin, M. J. Fry, and M. R. Crompton. 2000. Expression of the BRK tyrosine kinase in mammary epithelial cells enhances the coupling of EGF signalling to PI 3-kinase and Akt, via erbB3 phosphorylation. Oncogene 19:5471-5476.[CrossRef][Medline]
20. Kamalati, T., H. E. Jolin, P. J. Mitchell, K. T. Barker, L. E. Jackson, C. J. Dean, M. J. Page, B. A. Gusterson, and M. R. Crompton. 1996. Brk, a breast tumor-derived non-receptor protein-tyrosine kinase, sensitizes mammary epithelial cells to epidermal growth factor. J. Biol. Chem. 271:30956-30963.
21. Klemke, R. L., J. Leng, R. Molander, P. C. Brooks, K. Vuori, and D. A. Cheresh. 1998. CAS/Crk coupling serves as a "molecular switch" for induction of cell migration. J. Cell Biol. 140:961-972.
22. Klinghoffer, R. A., C. Sachsenmaier, J. A. Cooper, and P. Soriano. 1999. Src family kinases are required for integrin but not PDGFR signal transduction. EMBO J. 18:2459-2471.[CrossRef][Medline]
23. Lamorte, L., S. Rodrigues, V. Sangwan, C. E. Turner, and M. Park. 2003. Crk associates with a multimolecular paxillin/GIT2/beta-PIX complex and promotes Rac-dependent relocalization of paxillin to focal contacts. Mol. Biol. Cell 14:2818-2831.
24. Laukaitis, C. M., D. J. Webb, K. Donais, and A. F. Horwitz. 2001. Differential dynamics of alpha 5 integrin, paxillin, and alpha-actinin during formation and disassembly of adhesions in migrating cells. J. Cell Biol. 153:1427-1440.
25. Leduc, I., and S. Meloche. 1995. Angiotensin II stimulates tyrosine phosphorylation of the focal adhesion-associated protein paxillin in aortic smooth muscle cells. J. Biol. Chem. 270:4401-4404.
26. Lewis, J. M., and M. A. Schwartz. 1998. Integrins regulate the association and phosphorylation of paxillin by c-Abl. J. Biol. Chem. 273:14225-14230.
27. Llor, X., M. S. Serfas, W. Bie, V. Vasioukhin, M. Polonskaia, J. Derry, C. M. Abbott, and A. L. Tyner. 1999. BRK/Sik expression in the gastrointestinal tract and in colon tumors. Clin. Cancer Res. 5:1767-1777.
28. Lu, Z., G. Jiang, P. Blume-Jensen, and T. Hunter. 2001. Epidermal growth factor-induced tumor cell invasion and metastasis initiated by dephosphorylation and downregulation of focal adhesion kinase. Mol. Cell. Biol. 21:4016-4031.
29. Malliri, A., M. Symons, R. F. Hennigan, A. F. Hurlstone, R. F. Lamb, T. Wheeler, and B. W. Ozanne. 1998. The transcription factor AP-1 is required for EGF-induced activation of rho-like GTPases, cytoskeletal rearrangements, motility, and in vitro invasion of A431 cells. J. Cell Biol. 143:1087-1099.
30. Manser, E., T. H. Loo, C. G. Koh, Z. S. Zhao, X. Q. Chen, L. Tan, I. Tan, T. Leung, and L. Lim. 1998. PAK kinases are directly coupled to the PIX family of nucleotide exchange factors. Mol. Cell 1:183-192.[CrossRef][Medline]
31. Marcoux, N., and K. Vuori. 2003. EGF receptor mediates adhesion-dependent activation of the Rac GTPase: a role for phosphatidylinositol 3-kinase and Vav2. Oncogene 22:6100-6106.[CrossRef][Medline]
32. Matsuda, M., S. Nagata, S. Tanaka, K. Nagashima, and T. Kurata. 1993. Structural requirement of CRK SH2 region for binding to phosphotyrosine-containing proteins: evidence from reactivity to monoclonal antibodies. J. Biol. Chem. 268:4441-4446.
33. McCann, A. H., P. A. Dervan, M. O'Regan, M. B. Codd, W. J. Gullick, B. M. Tobin, and D. N. Carney. 1991. Prognostic significance of c-erbB-2 and estrogen receptor status in human breast cancer. Cancer Res. 51:3296-3303.
34. Meric, F., W. P. Lee, A. Sahin, H. Zhang, H. J. Kung, and M. C. Hung. 2002. Expression profile of tyrosine kinases in breast cancer. Clin. Cancer Res. 8:361-367.
35. Minoguchi, M., S. Minoguchi, D. Aki, A. Joo, T. Yamamoto, T. Yumioka, T. Matsuda, and A. Yoshimura. 2003. STAP-2/BKS, an adaptor/docking protein, modulates STAT3 activation in acute-phase response through its YXXQ motif. J. Biol. Chem. 278:11182-11189.
36. Mitchell, P. J., K. T. Barker, J. E. Martindale, T. Kamalati, P. N. Lowe, M. J. Page, B. A. Gusterson, and M. R. Crompton. 1994. Cloning and characterization of cDNAs encoding a novel non-receptor tyrosine kinase, brk, expressed in human breast tumours. Oncogene 9:2383-2390.[Medline]
37. Mitchell, P. J., K. T. Barker, J. Shipley, and M. R. Crompton. 1997. Characterization and chromosome mapping of the human nonreceptor tyrosine kinase gene, brk. Oncogene 15:1497-1502.[CrossRef][Medline]
38. Mitchell, P. J., E. A. Sara, and M. R. Crompton. 2000. A novel adaptor-like protein which is a substrate for the non-receptor tyrosine kinase, BRK. Oncogene 19:4273-4282.[CrossRef][Medline]
39. Moulin, V. 1995. Growth factors in skin wound healing. Eur. J. Cell Biol. 68:1-7.[Medline]
40. Nakamura, H. K., Yano, E. Schaefer, and H. Sabe. 2001. Different modes and qualities of tyrosine phosphorylation of Fak and Pyk2 during epithelial-mesenchymal transdifferentiation and cell migration: analysis of specific phosphorylation events using site-directed antibodies. Oncogene 20:2626-2635.[CrossRef][Medline]
41. Nakamura, K., H. Yano, H. Uchida, S. Hashimoto, E. Schaefer, and H. Sabe. 2000. Tyrosine phosphorylation of paxillin alpha is involved in temporospatial regulation of paxillin-containing focal adhesion formation and F-actin organization in motile cells. J. Biol. Chem. 275:27155-27164.
42. Petit, V., B. Boyer, D. Lentz, C. E. Turner, J. P. Thiery, and A. M. Valles. 2000. Phosphorylation of tyrosine residues 31 and 118 on paxillin regulates cell migration through an association with CRK in NBT-II cells. J. Cell Biol. 148:957-970.
43. Qiu, H., and W. T. Miller. 2002. Regulation of the nonreceptor tyrosine kinase Brk by autophosphorylation and by autoinhibition. J. Biol. Chem. 277:34634-34641.
44. Qiu, H., and W. Miller.T. 2004. Role of the Brk SH3 domain in substrate recognition. Oncogene 23:2216-2223.[CrossRef][Medline]
45. Sander, E. E., J. P. ten Klooster, S. van Delft, R. A. van der Kammen, and J. G. Collard. 1999. Rac downregulates Rho activity: reciprocal balance between both GTPases determines cellular morphology and migratory behavior. J. Cell Biol. 147:1009-1022.
46. Schaller, M. D. 2001. Paxillin: a focal adhesion-associated adaptor protein. Oncogene 20:6459-6472.[CrossRef][Medline]
47. Schaller, M. D., and J. T. Parsons. 1995. pp125FAK-dependent tyrosine phosphorylation of paxillin creates a high-affinity binding site for Crk. Mol. Cell. Biol. 15:2635-2645.[Abstract]
48. Schlaepfer, D. D., C. R. Hauck, and D. J. Sieg. 1999. Signaling through focal adhesion kinase. Prog. Biophys. Mol. Biol. 71:435-478.[CrossRef][Medline]
49. Scita, G., P. Tenca, E. Frittoli, A. Tocchetti, M. Innocenti, G. Giardina, and P. P. Di Fiore. 2000. Signaling from Ras to Rac and beyond: not just a matter of GEFs. EMBO J. 19:2393-2398.[CrossRef][Medline]
50. Sini, P., A. Cannas, A. J. Koleske, P. P. Di Fiore, and G. Scita. 2004. Abl-dependent tyrosine phosphorylation of Sos-1 mediates growth-factor-induced Rac activation. Nature Cell Biol. 6:268-274.[Medline]
51. Slamon, D. J., G. M. Clark, S. G. Wong, W. J. Levin, A. Ullrich, and W. L. McGuire. 1987. Human breast cancer: correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science 235:177-182.
52. Tamas, P., Z. Solti, P. Bauer, A. Illes, S. Sipeki, A. Bauer, A. Farago, J. Downward, and L. Buday. 2003. Mechanism of epidermal growth factor regulation of Vav2, a guanine nucleotide exchange factor for Rac. J. Biol. Chem. 278:5163-5171.