MCB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Silverman, E.
Right arrow Articles by Maller, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Silverman, E.
Right arrow Articles by Maller, J. L.
Molecular and Cellular Biology, December 2004, p. 10573-10583, Vol. 24, No. 24
0270-7306/04/$08.00+0     DOI: 10.1128/MCB.24.24.10573-10583.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Activation of p90Rsk1 Is Sufficient for Differentiation of PC12 Cells

Eran Silverman,1 Morten Frödin,2 Steen Gammeltoft,2 and James L. Maller1*

Howard Hughes Medical Institute and Department of Pharmacology, University of Colorado School of Medicine, Denver, Colorado,1 Department of Clinical Biochemistry, Glostrup Hospital, University of Copenhagen Medical School, Nordre Ringvej, Denmark2

Received 25 May 2004/ Returned for modification 6 July 2004/ Accepted 3 September 2004


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We investigated the role of Rsk proteins in the nerve growth factor (NGF) signaling pathway in PC12 cells. When rat Rsk1 or murine Rsk2 proteins were transiently expressed, NGF treatment (100 ng/ml for 3 days) caused three- and fivefold increases in Rsk1 and Rsk2 activities, respectively. Increased activation of both wild-type Rsk proteins could be achieved by coexpression of a constitutively active (CA) mitogen-activated protein kinase (MAPK) kinase, MEK1-DD, which is known to cause differentiation of PC12 cells even in the absence of NGF. Rsk1 and Rsk2 mutated in the PDK1-binding site were not activated by either NGF or MEK1-DD. Expression of constitutively active Rsk1 or Rsk2 in PC12 cells resulted in highly active proteins whose levels of activity did not change either with NGF treatment or after coexpression with MEK1-DD. Rsk2-CA expression had no detectable effect on the cells. However, expression of Rsk1-CA led to differentiation of PC12 cells even in the absence of NGF, as evidenced by neurite outgrowth. Differentiation was not observed with a nonactive Rsk1-CA that was mutated in the PDK1-binding site. Expression of Rsk1-CA did not lead to activation of the endogenous MAPK pathway, indicating that Rsk1 is sufficient to induce neurite outgrowth and is the only target of MAPK required for this effect. Collectively, our data demonstrate a key role for Rsk1 in the differentiation process of PC12 cells.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The rat pheochromocytoma PC12 cell line, first described in 1976 (14), is one of the most extensively studied models of cell signaling and neuronal differentiation (38). PC12 cells respond to various extracellular agonists, including growth factors, hormones, and neurotrophins (18). In response to stimulation with the growth factor epidermal growth factor (EGF), PC12 cells proliferate (18), whereas stimulation with nerve growth factor (NGF) causes the cells to differentiate and acquire neural morphology as visualized by the outgrowth of neurites (18). Extensive studies have shown that the mitogen-activated protein kinase (MAPK) signaling pathway is the major mediator of PC12 differentiation in response to NGF, although several other signaling pathways are also activated by NGF (reviewed in reference 18). Control of PC12 cell differentiation by the MAPK pathway is complicated and involves both temporal and spatial elements (38). The current model for differentiation of PC12 cells by NGF can be summarized as follows (18). Binding of NGF to its membrane tyrosine kinase receptor, TrkA, causes activation and autophosphorylation of the receptor, which in turn recruits a complex subset of adapter proteins that results in activation of the small G protein Ras. Activated Ras then stimulates activation of Raf-1 that phosphorylates its downstream target, MEK1, and MEK1 then phosphorylates its downstream targets ERK1 and ERK2 (ERK1/2). This pathway leads to a transient activation of ERK1/2, but a distinct pathway that leads to prolonged activation of ERK1/2 is essential for the differentiation process to take place. By recruiting a different set of adapter proteins, TrkA causes an activation of Rap-1 that stimulates B-Raf. Activated B-Raf activates MEK1, which in turn phosphorylates and activates ERK1/2 for a sustained period.

Several lines of evidence have demonstrated the importance of MAPK for the differentiation process. Most convincingly, several different constitutively activated upstream components in the pathway are sufficient to cause differentiation even in the absence of NGF, including Ras (40), MEK1 (13), and a MEK-ERK fusion protein (29). Moreover, blocking the activity of Ras or MEK1 interferes with the differentiation process induced by NGF (27). Once stimulated by this pathway, ERK1/2 activates several downstream cellular targets, both cytoplasmic and nuclear (7). Among the nuclear targets are various transcription factors, such as AP-1 (28), Elk-1 (8), and others; each has distinct transcriptional target genes. In addition to these targets, important cytoplasmic substrates of ERK1/2 are members of the p90Rsk family (Rsk) of protein kinases (11), comprising four members: Rsk1, Rsk2, Rsk3, and the newly identified Rsk4 (for review see reference 11). p90Rsk was first discovered in Xenopus oocytes (10) and was later shown to be activated by MAPK (33). Xenopus and mammalian homologs of this enzyme have been cloned and share similar properties (11, 22). Rsk family members were the first protein kinases found to have a two-kinase domain structure, an N-terminal kinase (NTK) domain and a C-terminal kinase (CTK) domain, which are separated by a linker region that contains a hydrophobic motif (22) (Fig. 1). Activation of Rsk proteins requires sequential phosphorylation events, both by upstream kinases and by autophosphorylation (for review, see reference 11). The current model suggests that ERK1/2 phosphorylates Rsk on Thr573 in the CTK domain (according to rat Rsk1 amino acid numbering) as well as Thr359 and Ser363 in the linker region. These phosphorylation events promote autophosphorylation of Ser380 in the linker region by the CTK, and phosphorylation of this residue creates a binding site for PDK1 (1), which in turn phosphorylate Ser221 on the T-loop of the NTK, generating an active NTK domain now able to phosphorylate downstream cellular targets (11).



View larger version (24K):
[in this window]
[in a new window]
 
FIG. 1. Rat Rsk1 and mouse Rsk2 constructs used in this study. Full-length rat Rsk1 and mouse Rsk2 were tagged with a 3XFLAG epitope at the N terminus. In order to create NA versions of these proteins, an S->K amino acid mutation was introduced at the PDK-binding site (S380 or S386 for Rsk1 and Rsk2, respectively). In addition, constitutively active versions of Rsk, Rsk1-CA and Rsk2-CA, were created by introducing the indicated point mutations, deleting the ERK-binding site at the C terminus, and replacing the hydrophobic motif with that of PRK2. An NA kinase-inactive version was generated by introducing a D->K mutation in the PRK2 hydrophobic motif, as described in Materials and Methods.

 
Rsk has been shown to regulate various substrates, including transcription factors such as CREB (41), C/EBPß (4), and Fos (6); structural proteins such as L1 Cam (39); cell cycle proteins such as Myt1 (26) and Bub1 (31); and cell survival proteins such as BAD (23). Rsk proteins have been shown to interact with various other proteins that may regulate their activity such as 14-3-3 proteins (5), PEA-15 protein (37) and YopM (24). In some biological processes, Rsk has been shown to be the sole substrate of MAPK required for the biological effect of the MAPK pathway (for review, see reference 35). In mammalian cells, Rsk family members have shown variable tissue expression patterns, including differential expression in the brain and skeleton (43). In this regard, the family member Rsk2 is critical for brain functions as mutation of this gene causes the Coffin-Lowry (CL) syndrome, which is characterized by mental retardation and skeletal malformations (35). It has also been previously shown that Rsk2 is the kinase responsible for phosphorylation of the transcription factor CREB in PC12 cells (41) and that Rsk1, Rsk2, and Rsk3 are activated by acute NGF treatment of PC12 cells (42).

In this study, we have tested the effects of Rsk proteins on the signaling pathways in PC12 cells using gain-of-function mutants of these proteins. To this end, we have constructed expression vectors for both wild-type (WT) and constitutively active (CA) rat Rsk1 and mouse Rsk2 proteins. The results establish a role for Rsk1 in the neuronal differentiation process of PC12 cells.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
7S NGF, rat tail collagen type I, and S6 peptide were purchased from Upstate Biotechnology, Inc. (Lake Placid, N.Y.). Antibodies to Rsk1 and Rsk2 (anti C-terminal peptide) were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, Calif.). Antibody to pMAPK was purchased from Cell Signaling Technology (Beverly, Mass.). The p3XFLAG-myc-CMV-26 expression vector, the p3XFLAG-CMV-BAP control plasmid (coding for bacterial alkaline phosphatase [BAP]), peroxidase-conjugated-anti-FLAG M2 monoclonal antibody, anti-FLAG M2 affinity gel, fluorescein isothiocyanate (FITC)-conjugated-anti-FLAG M2 monoclonal antibody, horse serum, and protease inhibitor cocktail were all from Sigma (Saint Louis, Mo.). Fetal bovine serum was purchased from HyClone (Logan, Utah). Dulbecco's modified Eagle's medium, OptiMEM, penicillin-streptomycin antibiotic mix, and Lipofectamine 2000 were purchased from Invitrogen Corporation (Carlsbad, Calif.). BioCoat cellware 6- and 24-well plates and poly-L-lysine coverslips were purchased from BD Biosciences (Bedford, Mass.).

PC12 cell transient transfection. PC12 cells were generously provided by Lynn Heasley (Department of Medicine, University of Colorado Health Sciences Center). Cells were maintained in Dulbecco's modified Eagle's medium supplemented with 5% horse serum, 5% fetal bovine serum, and antibiotics in a 37°C, 5% CO2 humidified incubator. Twenty-four hours before transfection, cells were plated onto collagen-coated dishes at 60% confluency. Dishes were manually coated with rat tail collagen type I, or commercially available collagen type IV-precoated dishes (BioCoat) were used. Similar results were obtained with both types of dishes. On the day of transfection, cells were 80 to 90% confluent and transfected with the Lipofectamine 2000 reagent following the manufacturer's instructions. When NGF was used, it was added to the medium 6 h after transfection at a final concentration of 100 ng/ml. After 72 h in the presence of NGF, cells were either harvested for protein extraction or analyzed by photomicroscopy.

Plasmids. All plasmids were subcloned into the p3XFLAG-myc-CMV-26 expression vector by standard cloning procedures. Mouse Rsk2-expressing vectors were previously described (12), and the coding sequence of the various Rsk2 constructs (Rsk2-WT, Rsk2-WT-NA, Rsk2-CA, Rsk2-CA-NA) were subcloned into the 3XFLAG vector, using the following primers: forward, 5'->3' AATTGCGGCCGCGATGCCGCTGGCGCAGCT; reverse (for WT or WT-NA), 5'->3' GGCCTCTAGATCACAGGGCTGTTGAGGTGAT; and reverse (for CA or CA-NA), 5'->3' GGCCTCTAGATCAAGCAAGAGTGGAGCGGCCCA. To prepare the various RSK1 constructs, a pMT2-HA-rat-Rsk1-WT vector harboring the full-length rat Rsk1 coding sequence was generously provided by J. Avruch (Massachusetts General Hospital, Boston, Mass.) and used as template in a PCR with the following primers: forward, 5'->3' AATTGCGGCCGCGATGCCGCTCGCCCAGCTCAAGGAA; reverse, 5'->3' GGCCTCTAGATCACAGGGTGGTGGATGGCA. Interestingly, the pMT2-HA-rat-Rsk1-WT coding sequence provided contained a glutamic acid insertion at position 157, which is not present in the WT sequence (21); therefore this mutational insertion was deleted to create a WT Rsk1 for use in this work. A nonactive (NA) form of Rsk1-WT, Rsk1-WT-NA, was made by introducing the substitution S380K in the linker region. In order to create the constitutively active form of Rsk1, Rsk1-CA, several mutations were made. First, two PCR products were made with 3XFLAG-Rsk1-WT as the template. The first PCR product, which replaces the hydrophobic motif of Rsk1 with that of PRK2 (12), was made by using the following primers: forward, 5'->3' AATTGCGGCCGCGATGCCGCTCGCCCAGCTCAAGGAA; and reverse, 5'->3' CGAGTGCAGCGGTGCCTGGGTGGCCCGAGGCTTGCTGTCATCCTCACACCAATCAGCAATGTAGTCAAAATCTCTGAACATTTCCTGCTCCTCTTCCGAAGCACTGGGGGGGATGCCCGGCGAATCCCTG. The second PCR product, which deletes the last 13 amino acids of Rsk1, was made with the following primers: forward, 5'->3' CCTCGGGCCACCCAGGCTCCGCTG; and reverse, 5'->3' CCGGTCTAGATCACAGGATGGACGACTCGATTGG. The two PCR products were then ligated into the 3XFLAG-myc-CMV-26 vector. The resulting vector was further manipulated to create a fully active enzyme by substituting glutamic acid for T359 and S363. To create the NA form of Rsk1-CA, Rsk1-CA-NA, an additional point mutation was introduced by substituting a lysine at D978 (PRK2 numbering) within the inserted PRK2 hydrophobic motif. All mutations were performed by the QuickChange mutagenesis procedure (Stratagene), and each of the vectors used in this study was verified by sequencing. The CA form of mouse MEK1, MEK1-DD, was generously provided by R. L. Erikson (Harvard University) and, when necessary for immunofluorescence studies, was subcloned into the 3XFLAG-myc-CMV-26 vector.

The above-described coding sequences for Rsk1-WT, Rsk1-CA, Rsk2-WT, and Rsk2-CA were also subcloned into a pOTV-3XFLAG-LIC vector by standard PCR techniques. This vector was used to direct synthesis of mRNA for these genes by using the T7 mMessage mMachine kit (Ambion, Austin, Tex.).

Xenopus oocytes and embryos. Xenopus oocytes and embryos were isolated as previously described (16, 30). Oocytes were cultured exactly as described (16) and microinjected with 50 ng of either 3XFLAG-Rsk1-WT, Rsk1-CA, Rsk2-WT, or Rsk2-CA mRNA in H2O. In addition, titration experiments were performed in which various amounts (50, 10, and 5 ng) of 3XFLAG-Rsk1-CA or 3XFLAG-Rsk2-CA mRNA were microinjected into oocytes. After overnight incubation at 18°C, oocytes were induced to mature with progesterone (100 ng/ml) and collected 4 h after germinal vesicle breakdown (GVBD) for further manipulations. Proteins were extracted exactly as described previously (16) and used for immune complex kinase assays, kinase assays of total lysates, or immunoblotting as described below. The eggs of Xenopus were fertilized in vitro as described previously (17). One blastomere of a two-cell embryo was injected with ~50 ng of Rsk1-WT, Rsk1-CA, Rsk2-WT, or Rsk2-CA mRNA, and cell division was monitored with a dissecting microscope. In addition, titration experiments were performed in which various amounts (5, 10, and 50 ng) of 3XFLAG-Rsk1-CA or 3XFLAG-Rsk2-CA mRNA were injected in each of both blastomeres. Protein extracts were prepared from these embryos as described previously (16) when control embryos that were injected in one blastomere ceased to divide, typically about 3 h after injection.

PC12 protein extraction and kinase assay. Protein extracts of PC12 cells were prepared as follows. Cells were washed once with phosphate-buffered saline (PBS), and then lysis buffer (0.5% Triton X-100, 150 mM NaCl, 50 mM Tris-HCl [pH 7.4], 10% glycerol, protease inhibitor cocktail) was added to the tissue culture well. Cells were scraped, collected in tubes, and incubated on ice for 15 min. Extracts were then centrifuged for 4 min at 16,000 x g, and the supernatant was aliquoted and stored at –70. The protein concentration was determined as described previously (44). The same extracts were used for both Western blotting and immune complex kinase assays. For kinase assays, 100 to 200 µg of PC12 cell extract was incubated for 1 h at 4°C with anti-FLAG M2 affinity gel. Afterwards, the complexes were washed three times with lysis buffer and once with kinase buffer (50 mM Tris [pH 7.5], 50 mM NaCl, 5 mM EGTA, 1 mM ß-mercaptoethanol). A small aliquot (10%) of the FLAG beads was removed, boiled in sodium dodecyl sulfate (SDS) sample buffer, and used for immunoblot analysis. The rest of the FLAG immunoprecipitate was incubated for 10 min at 30°C with kinase buffer supplemented with 100 µM ATP, 5µCi of [{gamma}-32P]ATP, and 100 µM S6 peptide. The kinase reaction was terminated by addition of 15 µl of glacial acetic acid, and 25-µl aliquots of the supernatant were blotted onto p81 phosphocellulose paper, which was washed, dried, and counted by the Cerenkov method.

Indirect immunofluorescence. For immunofluorescent detection of expressed proteins, cells were plated onto poly-L-lysine-coated coverslips in 24-well plates. Cells were transfected 24 h after plating, as described above. Three days after transfection, cells were washed once with PBS and then fixed with PBS supplemented with 3.7% paraformaldehyde for 10 min at room temperature. After two washes with PBS, cells were incubated with 0.5% Triton X-100 for 4 min at room temperature. Cells were washed twice and incubated with 0.1-mg/ml anti-FLAG-FITC-conjugated antibody for 45 min at room temperature. After three washes with PBS, coverslips were mounted and cells were examined under a Nikon PCM2000 microscope or photographed with the attached charge-coupled device camera.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Construction of CA Rsk proteins. Based on the mechanism of Rsk activation described in the introduction, we constructed several mutant forms of rat Rsk1 and mouse Rsk2 proteins. All forms had a 3XFLAG epitope tag at their N terminus (Fig. 1). Rsk-WT contains the full-length coding sequence of either rat Rsk1 (Rsk1-WT) or mouse Rsk2 (Rsk2-WT). An NA form of the WT Rsk proteins (Rsk-WT-NA) was made by replacing Ser380 or Ser386 of Rsk1 or Rsk2, respectively, with lysine. Mutating this site abolishes PDK1 binding to Rsk and therefore prevents NTK activation (12). To construct a CA form of the Rsk proteins (Rsk-CA), several modifications were made within the Rsk-WT sequence. First, the C-terminal ERK binding site (11, 32) was deleted. Second, two amino acid substitutions were introduced: Thr359 and Ser363 or Thr365 and Ser369 (in Rsk1 or Rsk2, respectively) were each replaced with glutamic acid. The aim of these mutations is to mimic the negative charge associated with phosphorylation of these sites by ERK1/2. Finally, the Rsk hydrophobic motif (residues 371 to 390 of Rsk1 or 376 to 395 of Rsk2) was replaced with the hydrophobic motif of protein kinase C-related kinase 2 PRK2 (12). This motif (named PIF, for PDK1-interacting fragment; residues 968 to 985) is known to constitutively bind PDK1 with high affinity (2). Therefore, by implanting this motif in Rsk, PDK1 constitutively binds Rsk and activates the NTK (12). The NA version of these proteins was made by replacing Asp978 (PRK2 numbering) with lysine, thereby abolishing PDK-1 binding to Rsk.

Validating constitutively active Rsk function in the Xenopus system. Previous studies have shown that the Rsk proteins are targets of the MAPK pathway and have a critical role in the initiation of maturation as well as in cytostatic factor (CSF)-dependent metaphase arrest of Xenopus oocytes (reviewed in reference 36). In fact, in oocytes constitutively active Xenopus Rsk is sufficient to induce CSF (metaphase) arrest and is the only target of the MAPK pathway that is necessary for this effect (16). To validate the biological activity of the CA mammalian Rsk proteins we constructed, we tested their ability to initiate maturation of Xenopus oocytes and to induce CSF arrest in Xenopus embryos.

Immature Xenopus oocytes are arrested at the G2/M border of the meiotic cell cycle, and progesterone stimulation of the oocytes initiates maturation, as evidenced by the appearance of a white spot in the center of the animal hemisphere caused by GVBD. This is followed by entry into meiosis II, which is ultimately arrested at metaphase by CSF activity. Fertilization of the egg elevates calcium and overcomes CSF arrest, and exit from meiosis II is followed by entry into the embryonic cell cycle. Initiation of oocyte maturation is governed by the activity of the Cdc2/cyclin B complex, which is itself controlled by at least two signaling pathways: the Plx1/Ccd25C pathway and the Mos/MEK/MAPK/Rsk pathway (reviewed in reference 36).

Previous studies have shown that a CA form of Xenopus Rsk1 causes induction of oocyte maturation when injected into resting oocytes (15). Consistent with this, injection of mRNA encoding either rat Rsk1-CA or mouse Rsk2-CA caused 20 and 40%, respectively, of Xenopus oocytes to mature after an 18-h incubation in the absence of progesterone (Table 1). This effect was specific for Rsk-CA mRNA, as injection of Rsk1-WT or Rsk-2-WT mRNA under identical conditions had no effect on maturation (Table 1). Upon progesterone addition to injected oocytes that had not undergone maturation after 18 h, an accelerated rate of maturation was observed with either Rsk1-CA and Rsk2-CA compared to noninjected oocytes or oocytes injected with Rsk-WT mRNA (Table 1). Western blot analysis of oocyte extracts from each experimental group demonstrated that Rsk was equally expressed from all injected mRNAs (Fig. 2A). The various expressed Rsk proteins were immunoprecipitated from the oocytes and used for in vitro kinase assays against S6 peptide. The data show that the constitutively active Rsk proteins have elevated kinase activity that is not affected by progesterone treatment (Fig. 2B). Rsk-WT proteins have a lower basal kinase activity but are activated by progesterone about threefold compared to nonstimulated oocytes. The levels of activity of Rsk-WT proteins in progesterone-stimulated oocytes are comparable to the levels in oocytes expressing Rsk-CA (Fig. 2B). Despite that, only oocytes injected with Rsk-CA mRNA displayed accelerated maturation in response to progesterone.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Induction of the G2/M transition by Rsk-CA

 


View larger version (24K):
[in this window]
[in a new window]
 
FIG. 2. Expression and activity of Rsk1 and Rsk2 in Xenopus oocytes. As described in Table 1, Xenopus oocytes were injected with 50 ng of the indicated mRNAs, and after 18 h of incubation, progesterone (PG) was added to the nonmature oocytes as indicated. (A) Rsk expression in injected oocytes. Extracts of oocytes from each experimental group were prepared as described in Materials and Methods, and the equivalent of half an oocyte was analyzed for Rsk expression by SDS-PAGE and Western blotting using a FLAG antibody. (B) Ki-nase activity of Rsk in oocytes. Extracts were immunoprecipitated with anti-FLAG beads and assayed for kinase activity against S6 peptide, as described in Materials and Methods. Similar results were found in three independent experiments. (C) Relative kinase activity of Rsk in oocytes. Whole-cell extracts from oocytes were used for determination of kinase activity against S6 peptide. Results represent the total S6 peptide kinase activity of oocytes expressing the various Rsk proteins relative to the specific activity of Rsk in resting oocytes expressing only endogenous Rsk.

 
In order to compare the activity of 3XFLAG-Rsk proteins and the endogenous Rsk proteins, various amounts of mRNA of Rsk1-CA and Rsk2-CA were injected into oocytes. Kinase assays performed on whole-cell extracts demonstrate that the relative kinase activity against S6 peptide of Rsk1-CA and Rsk2-CA is only two and three times higher, respectively, than the activity of endogenous Rsk proteins in the presence of progesterone. All together, these results show that expression of Rsk-CA in oocytes causes known physiological effects of Rsk that are not artifacts of overexpression.

In order to evaluate the ability of the mammalian Rsk-CA proteins to cause CSF arrest, an activity that has previously been shown to be mediated by Rsk (3, 16), Xenopus embryos were injected with 50 ng of mRNA encoding various mammalian Rsk constructs. When either Rsk1-CA or Rsk2-CA mRNA was injected into one blastomere of a two-cell Xenopus embryo, the injected side ceased to divide and cleavage arrest was observed (Fig. 3A). The noninjected side continued to divide normally as shown in Fig. 3A. Similar injection of mRNA encoding the WT versions of Rsk1 or Rsk2 produced no cleavage arrest (Fig. 3A). Cleavage arrest by Rsk proteins has been previously shown to reflect arrest at metaphase in the cell cycle (16). Titration experiments using various amounts of mRNA of Rsk1-CA and Rsk2-CA injected into one blastomere of a two-cell Xenopus embryo (Fig. 3B) show a dose-dependent effect of Rsk-CA on cleavage arrest. Even at the lowest levels of injected mRNA (5 ng), an arrest could still be observed, although to a lesser extent than with higher concentrations of mRNA (10 and 50 ng). In these experiments, the same amounts of Rsk1-CA and Rsk2-CA mRNA were also injected into both blastomeres of a two-cell Xenopus embryo. When the embryos injected on one side demonstrated cleavage arrest (Fig. 3B), protein was extracted from the double-injected embryos. Western blot analysis with antibody to Rsk1 (Fig. 3C) demonstrates dose-dependent expression of Rsk1-CA protein from the injected mRNA. The expression levels of Rsk-CA are much lower than the expression levels of the endogenous Rsk1 proteins even at the largest amount of injected mRNA (Fig. 3C). Similar analysis using antibodies to Rsk2 was not possible because the antibody to Rsk2 is aimed at the extreme C terminus of Rsk2 and Rsk2-CA lacks the C terminus (Fig. 1). However, since the expression and effects of Rsk1-CA and Rsk2-CA are similar in oocytes (Fig. 2A) and Rsk2 effects on blastomere division are dose dependent, it is highly likely that the expression Rsk2 in blastomeres is also dose dependent. The biological activity of the mammalian Rsk proteins in Xenopus provides evidence that the CA mutants are able to phosphorylate physiologically relevant substrates.



View larger version (41K):
[in this window]
[in a new window]
 
FIG. 3. Rsk1-CA and Rsk2-CA exhibit CSF arrest. (A) Cleavage arrest. Two-cell Xenopus embryos were isolated as described in Materials and Methods. One blastomere of the embryo was injected with 50 ng of the indicated mRNA encoding either Rsk1-WT, Rsk1-CA, Rsk2-WT, or Rsk2-CA. (B) Dose dependence of cleavage arrest. One blastomere of the embryo was injected with the indicated amounts of mRNA of Rsk1-CA and Rsk2-CA. Cleavage arrest was monitored with a dissecting microscope and photographed when the injected blastomere reached stage 7. (C) Dose dependence expression of Rsk. Two blastomeres of a two-cell Xenopus embryos were injected with the indicated amounts of mRNA of Rsk1-CA and Rsk2-CA. Protein extracts of these embryos were analyzed for Rsk expression by SDS-PAGE and Western blotting using antibodies for Rsk1.

 
Activity of Rsk in PC12 cells. Next we studied the activity of the mammalian Rsk proteins in PC12 cells. After transfection of Rsk1-WT, kinase activity measured in an immune complex assay increased threefold with NGF treatment (100 ng/ml for 3 days; Fig. 4A, lanes 3 and 4). The mutant form of this protein, Rsk-1-WT-NA, was not activated by NGF (Fig. 4A, lanes 7 and 8). Similarly, transfected Rsk-2-WT was activated up to fivefold by NGF (Fig. 4B, lanes 3 and 4), whereas the NA mutant, Rsk2-WT-NA, was not activated under similar conditions (Fig. 4B, lanes 7 and 8).



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 4. Activity of Rsk1-WT and Rsk2-WT in PC12 cells. Plasmids encoding BAP (control) or Rsk1-WT (A) or Rsk2-WT (B) were transiently transfected into PC12 cells with the Lipofectamine 2000 reagent, either alone or in the presence of CA mouse MEK-1, MEK1-DD. Six hours after transfection, NGF (100 ng/ml) was added as indicated, and 3 days later, cells were harvested and protein was extracted. Subsequently, 3XFLAG-labeled proteins were immunoprecipitated with anti-FLAG antibody and assayed for kinase activity towards S6 peptide. Results are presented as the mean ± standard error (n = 5) increase in kinase activity compared to the activity of control-transfected cells.

 
The Rsk-WT proteins could also be activated by coexpression of a CA form of MEK1, MEK1-DD. This protein has been shown to be sufficient to induce PC12 cell differentiation even in the absence of NGF (13). Indeed, coexpression of MEK1-DD caused a marked activation of both Rsk1-WT (Fig. 4A, lanes 5 and 6) and Rsk2-WT (Fig. 4B, lanes 5 and 6), up to 22- and 40-fold, respectively. The activation by MEK1-DD of Rsk1-WT or Rsk2-WT was seven- or fivefold higher, respectively, than activation after a 3-day treatment with NGF. Like NGF, MEK1-DD could not activate the Rsk1-WT-NA and the Rsk2-WT-NA mutants (Fig. 4A, lanes 9 and 10 and 4B, lanes 9 and 10). In addition to activation of the Rsk-WT proteins, NGF caused nuclear translocation of both proteins. MEK1-DD on the other hand remained cytoplasmic and was not detected in the nucleus (data not shown).

Expression of Rsk1-CA in PC12 cells resulted in an active protein (Fig. 5A, lane 3) that could not be further activated by NGF or MEK1-DD (Fig. 5A, lanes 4 to 6). The mutant form of this protein, Rsk1-CA-NA, was not active (Fig. 5A, lanes 7 to 10), either by itself or in the presence of NGF or MEK1-DD.



View larger version (41K):
[in this window]
[in a new window]
 
FIG. 5. Activity of Rsk1-CA and Rsk2-CA in PC12 cells. A control plasmid encoding BAP or plasmids encoding Rsk1-CA (A) or Rsk2-CA (B), or NA mutants, Rsk1-CA-NA or Rsk2-CA-NA, were transiently transfected into PC12 cells either alone or in combination with MEK1-DD. Six hours after transfection, NGF was added as indicated, and 3 days later, proteins were extracted and assayed for kinase activity as described in the legend to Fig. 4. Results are presented as mean ± standard error (n = 5) fold increase in kinase activity compared to the kinase activity of control-transfected cells. (C) Expression of transfected genes. An aliquot (7.5%) of the immunoprecipitate of the indicated samples was taken prior to the kinase assay and analyzed by SDS-PAGE and Western blotting to determine the level of each 3XFLAG-labeled protein. (D) Comparison of Rsk levels. Forty micrograms of protein extracts from PC12 cells transfected with the indicated constructs was analyzed by SDS-PAGE and Western blotting using antibodies to Rsk1 and Rsk2.

 
Rsk2-CA exhibited the highest kinase activity in PC12 cells compared to all other Rsk constructs. It was over 100-fold more active relative to the basal activity of control transfected cells (Fig. 5B, lane 3), and it was also 2.5-fold more active than the maximal activity observed for Rsk2-WT activated by MEK1-DD (Fig. 4B, lanes 5 and 6). Rsk2-CA constitutive levels of activity did not change with either NGF treatment (Fig. 5B, lanes 4 and 6) or MEK1-DD coexpression (Fig. 5B, lanes 5 and 6). A mutant form of this protein, Rsk2-CA-NA, was completely inactive either alone (Fig. 5B, lane 7) or in the presence of NGF and/or MEK1-DD (Fig. 5B, lanes 8 to 10). To confirm that equal amounts of expressed Rsk proteins were immunoprecipitated from the PC12 cell extracts, samples of the immunoprecipitated proteins were analyzed by SDS-polyacrylamide gel electrophoresis (PAGE) and Western blotting. As seen in Fig. 5C, the amounts of immunoprecipitated protein were similar and did not change with NGF treatment. Both Rsk1-CA (Fig. 5C, lanes 5 and 6) and Rsk2-CA (Fig. 5C, lanes 3 and 4) proteins were expressed at the same level. In order to determine the overexpression levels of the ectopic Rsk proteins relative to the endogenous levels in PC12 cells, protein extracts were analyzed with antibodies to Rsk1 and Rsk2 (Fig. 5D, left and right panels, respectively). The results show that both Rsk1-WT (Fig. 5D, lanes 3 and 4) and Rsk1-CA (Fig. 5D, lane 5) are expressed at levels similar to those of endogenous Rsk1 (Fig. 5D, lanes 1 and 2). Since our transfection efficiency is approximately 30 to 40%, the results suggest the ectopic Rsk proteins are expressed at most only threefold over the endogenous level. Analysis using Rsk2 antibody yields similar results: 3XFLAG-Rsk2-WT expression levels (Fig. 5D, lanes 8 and 9) are comparable to the endogenous levels of Rsk2 proteins (Fig. 5D, lanes 6 and 7). Since the Rsk2 antibody does not recognize Rsk2-CA, there is no direct comparison of its expression levels to that of the endogenous Rsk2. However, FLAG blots, which demonstrate an equal expression of all transfected proteins (Fig. 5C and data not shown), indicate that the expression level of Rsk2-CA is comparable to the expression level of Rsk2-WT and therefore comparable to the levels of endogenous Rsk2.

Previous studies have shown that upon NGF treatment of PC12 cells, ERK1/2 is activated and this activation promotes the process of PC12 cell differentiation (for review, see reference 18). Using a phospho-specific antibody against the activated form of ERK1/2, it is evident that after 3 days of treatment with NGF there is only very low residual ERK1/2 activity (Fig. 6, lanes 1 and 2). Expression of Rsk proteins does not lead to detectable ERK1/2 activation in the cells (Fig. 6, lanes 5 to 12). Only in cells that overexpress MEK1-DD can a sustained activation of ERK be observed (Fig. 6, lanes 3 and 4).



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 6. Analysis of activated MAPK in PC12 cells. Extracts of PC12 cells transfected with the indicated constructs were prepared 72 h after transfection. Where indicated, NGF was added 6 h after transfection. Seventy-five micrograms of protein extract was used for Western blot analysis of levels of activated MAPK with antibodies specific for phosphorylated (active) ERK1/2. Arrows mark the p44 and p42 forms of ERK1 and -2, respectively.

 
Rsk1-CA induces differentiation of PC12 cells. In order to monitor the effects of the Rsk proteins on cell differentiation, PC12 cells were transfected with the various Rsk constructs and differentiation was monitored by scoring neurite outgrowth. Nontreated cells, which are small and rounded, can be seen in Fig. 7A, which depicts PC12 cells expressing a control plasmid, 3XFLAG-BAP, for 3 days. PC12 cells transfected with the control BAP plasmid and then treated with NGF are depicted in Fig. 7B. These cells are differentiated, and neurite outgrowth is clearly evident. It has previously been shown that overexpression of MEK1-DD is sufficient to cause neurite outgrowth even in the absence of NGF (13). This is confirmed in Fig. 7C, which shows PC12 cells expressing MEK1-DD for 3 days in the absence of NGF. It is evident that these cells differentiate and grow neurites which resemble those obtained with NGF treatment in control-transfected cells (Fig. 7B). Addition of NGF to PC12 cells expressing MEK1-DD causes no further differentiation than that achieved by MEK1-DD alone (Fig. 7D and C, respectively). Significantly, when Rsk1-CA was expressed in PC12 cells for 3 days in the absence of NGF, differentiated cells could also be observed (Fig. 7E). The differentiated cells grew elongated neurites that were comparable in size and shape to neurites observed in cells treated with NGF (Fig. 7B) or expressing MEK1-DD (Fig. 7D). No additional differentiation was evident when Rsk1-CA-expressing cells were treated with NGF (Fig. 7F and E, respectively). The NA form of Rsk1-CA, Rsk1-CA-NA, which is not active in the cells (Fig. 5A, lanes 7 to 10) does not cause PC12 cells to differentiate (Fig. 7G). Such cells resemble undifferentiated control cells (Fig. 7A) and undergo normal differentiation with NGF as judged by neurite outgrowth (Fig. 7H). This implies that Rsk1-CA-NA does not act as a dominant negative in this system. Unlike Rsk1, expression of Rsk2-CA, albeit having higher kinase activity (Fig. 5B), was not able to cause PC12 cell differentiation in the absence of NGF (Fig. 7I) and did not affect neurite extension induced by NGF (Fig. 7J).



View larger version (68K):
[in this window]
[in a new window]
 
FIG. 7. Expression of Rsk1-CA causes PC12 cell differentiation. PC12 cells were transfected with the indicated expression vectors, and where indicated, NGF was added 6 h after transfection. After 3 days in culture, neurite outgrowth was evaluated by photomicroscopy. Arrows mark extended neurites that grow in the absence of NGF.

 
These results show that PC12 cells transfected with either Rsk1-CA or MEK1-DD are undergoing neurite outgrowth. Because the transfection efficiency is around 40% in PC12 cells and because not all cells transfected with Rsk1-CA develop neurites, we sought direct evidence that the cells developing neurites are the ones in which Rsk1-CA is expressed. Utilizing anti-FLAG antibodies to examine transfected cells by immunofluorescence, it is clear that the cells transfected with Rsk1-CA, which show a positive anti-FLAG staining, also exhibit extended neurites (Fig. 8B). Likewise, in Fig. 8A, a cell that expresses ectopic 3XFLAG-tagged-MEK1-DD shows extended neurite outgrowth.



View larger version (35K):
[in this window]
[in a new window]
 
FIG. 8. Neurite extension occurs in Rsk1-CA-expressing cells. PC12 cells were transfected with the either 3XFLAG-MEK1-DD (A) or Rsk1-CA (B) and grown on coverslips in the absence of NGF. Three days after transfection, cells were fixed and stained with FLAG-FITC-conjugated antibody, as described in Materials and Methods. Arrows mark cells that express Rsk1-CA and extend neurites. Neurite extension was not observed in any cells that were not expressing Rsk1-CA.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present study, we have tested the role and effects of Rsk1 and Rsk2 in the NGF signaling pathway of PC12 cells. The PC12 cell model system was chosen for this work because these cells have been extensively studied and a differentiation process induced by NGF is mediated in large part by the MAPK pathway. The use of CA forms of Rsk enabled the study of the specific downstream effects of these kinases, without apparent activation of the upstream elements of the MAPK pathway. The constitutively active mammalian Rsk proteins were first tested in the Xenopus system, in which a critical role for Rsk has already been demonstrated (3, 16). The initiation of Xenopus oocyte maturation and the establishment of CSF arrest in Xenopus embryos have already been shown to depend upon Xenopus Rsk activity (3, 16). Our results show that the mammalian Rsk-CA proteins are also able to regulate the Xenopus oocyte and embryonic cell cycle in a manner already established for endogenous Rsk1. These results suggest the mammalian Rsk-CA proteins recognize physiologically relevant substrates.

Using PC12 cells, we tested the effects of exogenously expressed Rsk genes 3 days after transfection. We chose this time frame because the differentiation process requires an extended length of time, as previously shown (29). Our transient, high-efficiency transfection of the various Rsk constructs leads to several conclusions. Ectopically expressed Rsk-WT proteins are active after 3 days of NGF treatment by up to three- to fivefold relative to nontreated cells. Previous studies of the activation of endogenous Rsk proteins were performed 10 min after NGF treatment of PC12 cells (42). Our results suggest that Rsk proteins still retain some NGF-induced activity in the cells after 3 days in culture. The level of activity after 3 days in the presence of NGF is much lower than the one achieved by coexpression of the CA MEK1-DD. This is consistent with the fact that MEK1-DD is still highly active in the cells after 3 days, as is its substrate, ERK1/2 (Fig. 6), so a sustained activation of Rsk is obtained. However, with NGF stimulation for 3 days, the extent of Rsk-WT activation is diminished, as is the activation of ERK1/2 (Fig. 6, lanes 1 to 4). An interesting observation comes from the inability of NGF to activate the Rsk-WT-NA mutants. Since the only mutation in these proteins is the one impairing the PDK1 binding, an immediate conclusion is that PDK1 is essential for NGF-dependent activation of Rsk proteins. In contrast to Rsk-WT, the activity of the constitutively active Rsk proteins is high even in the absence of NGF and is not increased further with NGF or MEK1-DD. The kinase activity of Rsk2-CA is much higher than that of Rsk1-CA, despite equal levels of expression (Fig. 5C). Interestingly, while the kinase activity of Rsk2-CA is higher than the activity of Rsk2-WT with MEK1-DD, the activity of Rsk1-CA is about the same as that of Rsk1-WT in the presence of MEK1-DD. These results exclude the possibility that Rsk2 fails to cause neurite outgrowth due to an insufficient level of constitutive activity. As stated below, perhaps localization of Rsk is also important for the activation process to occur.

The present study shows that the protein kinase Rsk1 is sufficient for the differentiation process of PC12 cells. The fact that Rsk2-CA is more active than Rsk1-CA and yet only Rsk1-CA causes differentiation strengthens the conclusion from the Xenopus system that indeed the Rsk-CA enzymes we have made act upon their physiological cellular targets and are not acting nonspecifically as a result of overexpression, especially since their expression levels are comparable to those of the endogenous Rsk proteins (Fig. 5D). The outcome of coexpression of both Rsk1-CA and Rsk2-CA in PC12 cells was similar to that observed with expression of Rsk1-CA alone (data not shown). This result further supports the notion that Rsk1 and Rsk2 possess distinct and specific cellular targets, as has been suggested elsewhere (see reference 34 and reference 119 cited therein). The specificity of neurite outgrowth for Rsk1-CA but not Rsk2-CA is also supported by in vivo studies of the Rsk proteins (20) and will be detailed below.

Interestingly, not every cell that expresses Rsk1-CA grows neurites (Fig. 8B), and in general, the differentiation response to MEK1-DD expression is more robust. There are several possible explanations for this observation: Levels of expression of the Rsk1-CA in a given transfected cell might dictate the outcome in this cell. Another possibility is that the cellular localization of Rsk-CA and the local expression or activity level in each cellular compartment are critical for the differentiation process to occur. While MEK1-DD is exclusively cytoplasmic, Rsk-CA (as well as NGF-induced Rsk-WT) proteins exhibit both cytoplasmic and nuclear localization, with the majority of protein localized to the cytoplasm. Therefore, if a threshold of activity is not achieved in the nucleus, for example, the target genes of Rsk1 important for differentiation might not be activated. Another interesting observation emerging from our studies is that Rsk1-CA-NA-expressing cells differentiate normally in the presence of NGF. This implies that Rsk1-CA-NA does not act as a dominant negative in this system. In this regard, the expression of Rsk1-WT does not improve the response to NGF, which may be explained by the fact that the endogenous Rsk proteins are activated within 10 min of NGF treatment (42), and the endogenous proteins are sufficient to drive the differentiation process; therefore, the presence of extra Rsk-WT proteins has little effect. This might reflect the percentage of active MAPK present after 3 days (Fig. 6), so that the full potential of Rsk1-WT proteins to be activated is drastically reduced (Fig. 4).

After 3 days in culture in the presence of NGF, only low levels of phosphorylated ERK1/2 can be detected in PC12 cells, whereas in the presence of MEK1-DD, phosphorylated ERK levels remain high. The fact that no other treatment of the cells, including expression of Rsk1-CA, elevated the levels of the endogenous phospho-ERK after 3 days in culture (Fig. 6) indicates that Rsk1-CA causes cells to differentiate by activating downstream targets and not by activating a positive feedback loop, which would activate the endogenous MAPK pathway. The broad conclusion that can be deduced is that Rsk1 is the only target of MAPK required for the differentiation process, as is the case in other biological systems (16).

Studies in recent years suggest an important role for the MAPK cascade in synaptic plasticity of the adult brain (34). The importance of Rsk proteins in brain function was first identified in studies of the CL syndrome (35). The CL syndrome is an inherited condition characterized by severe psycho-motor retardation and is thought to be caused by mutations in the Rsk2 gene that reduce Rsk2 kinase activity (9, 19, 25). No disorder associated with mutation of Rsk1 or Rsk3 is known (43). Close examination of the expression pattern of Rsk genes demonstrates that the Rsk family members show tissue-specific expression in some cases, but often multiple forms are found in the same tissue, although expression levels may differ (43). The expression pattern of Rsk genes in mouse brain tissues reveals that Rsk1 expression is highest in tissues with high proliferative activity (43). Rsk2 is expressed at the highest level in regions with high synaptic activity (43), and Rsk3 is mainly expressed in the developing neural and sensory tissues (43). The fact that CL patients display normal overlapping expression of Rsk1 and Rsk3 in the tissues where Rsk2 is mutated suggests that in vivo the other Rsk proteins cannot compensate for the loss of Rsk2 activity: i.e., their functions are not redundant (20). This notion is in agreement with our results in PC12 cells where both Rsk2-CA and Rsk1-CA are active but only Rsk1-CA causes differentiation, suggesting that only Rsk1 activates the specific subset of genes that are critical for the differentiation process, whereas Rsk2 may activate a different set of genes whose expression is not sufficient for PC12 cell differentiation.

What are the possible targets of Rsk in PC12 cells that are important for the differentiation process? One candidate is the cell adhesion molecule L1, which has been previously shown to be activated by Rsk1 in PC12 cells (39). The L1 cell adhesion molecule was shown to help guide nascent axons to their target and participate in the axonal growth process, probably by altering cytoskeletal elements. Phosphorylation by Rsk1 regulates the interactions of L1 with intracellular signaling cascades or cytoskeletal elements involved in neurite outgrowth on specific substrates (39). Our preliminary microarray analysis of PC12 cells treated with either NGF, MEK1-DD, or Rsk1-CA indicates the upregulation of several genes known to be involved in the differentiation of PC12 cells. Our future studies will substantiate these findings and identify genes specifically activated by Rsk1 that are important for differentiation of PC12 cells.


    ACKNOWLEDGMENTS
 
We are grateful to Lynn Heasley (UCHSC) for providing PC12 cells and for helpful discussions. We also thank Joe Avruch (Massachusetts General Hospital) for providing rat Rsk1 cDNA and R.L. Erikson (Harvard University) for providing MEK1-DD cDNA.

This work was supported by the NIH (DK28353-22) and by the Howard Hughes Medical Institute. E.S. is an Associate and J.L.M. is an Investigator of the Howard Hughes Medical Institute.


    FOOTNOTES
 
* Corresponding author. Mailing address: HHMI and Department of Pharmacology, University of Colorado School of Medicine, 4200 E. 9th Ave., Campus Box C236, Denver, CO 80262. Phone: (303) 315-7075. Fax: (303) 315-7160. E-mail: Jim.Maller{at}UCHSC.edu. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Alessi, D. R., S. R. James, C. P. Downes, A. B. Holmes, P. R. Gaffney, C. B. Reese, and P. Cohen. 1997. Characterization of a 3-phosphoinositide-dependent protein kinase which phosphorylates and activates protein kinase B alpha. Curr. Biol. 7:261-269.[CrossRef][Medline]

2. Balendran, A., A. Casamayor, M. Deak, A. Paterson, P. Gaffney, R. Currie, C. P. Downes, and D. R. Alessi. 1999. PDK1 acquires PDK2 activity in the presence of a synthetic peptide derived from the carboxyl terminus of PRK2. Curr. Biol. 9:393-404.[CrossRef][Medline]

3. Bhatt, R. R., and J. E. Ferrell, Jr. 1999. The protein kinase p90 rsk as an essential mediator of cytostatic factor activity. Science 286:1362-1365.[Abstract/Free Full Text]

4. Buck, M., V. Poli, P. van der Geer, M. Chojkier, and T. Hunter. 1999. Phosphorylation of rat serine 105 or mouse threonine 217 in C/EBP beta is required for hepatocyte proliferation induced by TGF alpha. Mol. Cell 4:1087-1092.[CrossRef][Medline]

5. Cavet, M. E., S. Lehoux, and B. C. Berk. 2003. 14-3-3beta is a p90 ribosomal S6 kinase (RSK) isoform 1-binding protein that negatively regulates RSK kinase activity. J. Biol. Chem. 278:18376-18383.[Abstract/Free Full Text]

6. Chen, R. H., C. Abate, and J. Blenis. 1993. Phosphorylation of the c-Fos transrepression domain by mitogen-activated protein kinase and 90-kDa ribosomal S6 kinase. Proc. Natl. Acad. Sci. USA 90:10952-10956.[Abstract/Free Full Text]

7. Chen, Z., T. B. Gibson, F. Robinson, L. Silvestro, G. Pearson, B. Xu, A. Wright, C. Vanderbilt, and M. H. Cobb. 2001. MAP kinases. Chem. Rev. 101:2449-2476.[CrossRef][Medline]

8. Cruzalegui, F. H., E. Cano, and R. Treisman. 1999. ERK activation induces phosphorylation of Elk-1 at multiple S/T-P motifs to high stoichiometry. Oncogene 18:7948-7957.[CrossRef][Medline]

9. Delaunoy, J., F. Abidi, M. Zeniou, S. Jacquot, K. Merienne, S. Pannetier, M. Schmitt, C. Schwartz, and A. Hanauer. 2001. Mutations in the X-linked RSK2 gene (RPS6KA3) in patients with Coffin-Lowry syndrome. Hum. Mutat. 17:103-116.[CrossRef][Medline]

10. Erikson, E., and J. L. Maller. 1985. A protein kinase from Xenopus eggs specific for ribosomal protein S6. Proc. Natl. Acad. Sci. USA 82:742-746.[Abstract/Free Full Text]

11. Frodin, M., and S. Gammeltoft. 1999. Role and regulation of 90 kDa ribosomal S6 kinase (RSK) in signal transduction. Mol. Cell. Endocrinol. 151:65-77.[CrossRef][Medline]

12. Frodin, M., C. J. Jensen, K. Merienne, and S. Gammeltoft. 2000. A phosphoserine-regulated docking site in the protein kinase RSK2 that recruits and activates PDK1. EMBO J. 19:2924-2934.[CrossRef][Medline]

13. Fukuda, M., Y. Gotoh, T. Tachibana, K. Dell, S. Hattori, Y. Yoneda, and E. Nishida. 1995. Induction of neurite outgrowth by MAP kinase in PC12 cells. Oncogene 11:239-244.[Medline]

14. Greene, L. A., and A. S. Tischler. 1976. Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor. Proc. Natl. Acad. Sci. USA 73:2424-2428.[Abstract/Free Full Text]

15. Gross, S. D., A. L. Lewellyn, and J. L. Maller. 2001. A constitutively active form of the protein kinase p90Rsk1 is sufficient to trigger the G2/M transition in Xenopus oocytes. J. Biol. Chem. 276:46099-46103.[Abstract/Free Full Text]

16. Gross, S. D., M. S. Schwab, A. L. Lewellyn, and J. L. Maller. 1999. Induction of metaphase arrest in cleaving Xenopus embryos by the protein kinase p90Rsk. Science 286:1365-1367.[Abstract/Free Full Text]

17. Haccard, O., B. Sarcevic, A. Lewellyn, R. Hartley, L. Roy, T. Izumi, E. Erikson, and J. L. Maller. 1993. Induction of metaphase arrest in cleaving Xenopus embryos by MAP kinase. Science 262:1262-1265.[Abstract/Free Full Text]

18. Huang, E. J., and L. F. Reichardt. 2003. Trk receptors: roles in neuronal signal transduction. Annu. Rev. Biochem. 72:609-642.[CrossRef][Medline]

19. Jacquot, S., K. Merienne, D. De Cesare, S. Pannetier, J. L. Mandel, P. Sassone-Corsi, and A. Hanauer. 1998. Mutation analysis of the RSK2 gene in Coffin-Lowry patients: extensive allelic heterogeneity and a high rate of de novo mutations. Am. J. Hum. Genet. 63:1631-1640.[CrossRef][Medline]

20. Jacquot, S., M. Zeniou, R. Touraine, and A. Hanauer. 2002. X-linked Coffin-Lowry syndrome (CLS, MIM 303600, RPS6KA3 gene, protein product known under various names: pp90(rsk2), RSK2, ISPK, MAPKAP1). Eur. J. Hum. Genet. 10:2-5.[CrossRef][Medline]

21. Jensen, C. J., M. B. Buch, T. O. Krag, B. A. Hemmings, S. Gammeltoft, and M. Frodin. 1999. 90-kDa ribosomal S6 kinase is phosphorylated and activated by 3-phosphoinositide-dependent protein kinase-1. J. Biol. Chem. 274:27168-27176.[Abstract/Free Full Text]

22. Jones, S. W., E. Erikson, J. Blenis, J. L. Maller, and R. L. Erikson. 1988. A Xenopus ribosomal protein S6 kinase has two apparent kinase domains that are each similar to distinct protein kinases. Proc. Natl. Acad. Sci. USA 85:3377-3381.[Abstract/Free Full Text]

23. Lizcano, J. M., N. Morrice, and P. Cohen. 2000. Regulation of BAD by cAMP-dependent protein kinase is mediated via phosphorylation of a novel site, Ser155. Biochem. J. 349:547-557.[CrossRef][Medline]

24. McDonald, C., P. O. Vacratsis, J. B. Bliska, and J. E. Dixon. 2003. The yersinia virulence factor YopM forms a novel protein complex with two cellular kinases. J. Biol. Chem. 278:18514-18523.[Abstract/Free Full Text]

25. Merienne, K., S. Jacquot, S. Pannetier, M. Zeniou, A. Bankier, J. Gecz, J. L. Mandel, J. Mulley, P. Sassone-Corsi, and A. Hanauer. 1999. A missense mutation in RPS6KA3 (RSK2) responsible for non-specific mental retardation. Nat. Genet. 22:13-14.[CrossRef][Medline]

26. Palmer, A., A. C. Gavin, and A. R. Nebreda. 1998. A link between MAP kinase and p34(cdc2)/cyclin B during oocyte maturation: p90(rsk) phosphorylates and inactivates the p34(cdc2) inhibitory kinase Myt1. EMBO J. 17:5037-5047.[CrossRef][Medline]

27. Pang, L., T. Sawada, S. J. Decker, and A. R. Saltiel. 1995. Inhibition of MAP kinase kinase blocks the differentiation of PC-12 cells induced by nerve growth factor. J. Biol. Chem. 270:13585-13588.[Abstract/Free Full Text]

28. Pearson, G., F. Robinson, T. Beers Gibson, B. E. Xu, M. Karandikar, K. Berman, and M. H. Cobb. 2001. Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions. Endocr. Rev. 22:153-183.[Abstract/Free Full Text]

29. Robinson, M. J., S. A. Stippec, E. Goldsmith, M. A. White, and M. H. Cobb. 1998. A constitutively active and nuclear form of the MAP kinase ERK2 is sufficient for neurite outgrowth and cell transformation. Curr. Biol. 8:1141-1150.[CrossRef][Medline]

30. Roy, L. M., O. Haccard, T. Izumi, B. G. Lattes, A. L. Lewellyn, and J. L. Maller. 1996. Mos proto-oncogene function during oocyte maturation in Xenopus. Oncogene 12:2203-2211.[Medline]

31. Schwab, M. S., B. T. Roberts, S. D. Gross, B. J. Tunquist, F. E. Taieb, A. L. Lewellyn, and J. L. Maller. 2001. Bub1 is activated by the protein kinase p90(Rsk) during Xenopus oocyte maturation. Curr. Biol. 11:141-150.[CrossRef][Medline]

32. Smith, J. A., C. E. Poteet-Smith, K. Malarkey, and T. W. Sturgill. 1999. Identification of an extracellular signal-regulated kinase (ERK) docking site in ribosomal S6 kinase, a sequence critical for activation by ERK in vivo. J. Biol. Chem. 274:2893-2898.[Abstract/Free Full Text]

33. Sturgill, T. W., L. B. Ray, E. Erikson, and J. L. Maller. 1988. Insulin-stimulated MAP-2 kinase phosphorylates and activates ribosomal protein S6 kinase II. Nature 334:715-718.[CrossRef][Medline]

34. Thomas, G. M., and R. L. Huganir. 2004. MAPK cascade signalling and synaptic plasticity. Nat. Rev. Neurosci. 5:173-183.[CrossRef][Medline]

35. Trivier, E., D. De Cesare, S. Jacquot, S. Pannetier, E. Zackai, I. Young, J. L. Mandel, P. Sassone-Corsi, and A. Hanauer. 1996. Mutations in the kinase Rsk-2 associated with Coffin-Lowry syndrome. Nature 384:567-570.[CrossRef][Medline]

36. Tunquist, B. J., and J. L. Maller. 2003. Under arrest: cytostatic factor (CSF)-mediated metaphase arrest in vertebrate eggs. Genes Dev. 17:683-710.[Free Full Text]

37. Vaidyanathan, H., and J. W. Ramos. 2003. RSK2 activity is regulated by its interaction with PEA-15. J. Biol. Chem. 278:32367-32372.[Abstract/Free Full Text]

38. Vaudry, D., P. J. Stork, P. Lazarovici, and L. E. Eiden. 2002. Signaling pathways for PC12 cell differentiation: making the right connections. Science 296:1648-1649.[Abstract/Free Full Text]

39. Wong, E. V., A. W. Schaefer, G. Landreth, and V. Lemmon. 1996. Involvement of p90rsk in neurite outgrowth mediated by the cell adhesion molecule L1. J. Biol. Chem. 271:18217-18223.[Abstract/Free Full Text]

40. Wood, K. W., C. Sarnecki, T. M. Roberts, and J. Blenis. 1992. ras mediates nerve growth factor receptor modulation of three signal-transducing protein kinases: MAP kinase, Raf-1, and RSK. Cell 68:1041-1050.[CrossRef][Medline]

41. Xing, J., D. D. Ginty, and M. E. Greenberg. 1996. Coupling of the RAS-MAPK pathway to gene activation by RSK2, a growth factor-regulated CREB kinase. Science 273:959-963.[Abstract]

42. Xing, J., J. M. Kornhauser, Z. Xia, E. A. Thiele, and M. E. Greenberg. 1998. Nerve growth factor activates extracellular signal-regulated kinase and p38 mitogen-activated protein kinase pathways to stimulate CREB serine 133 phosphorylation. Mol. Cell. Biol. 18:1946-1955.[Abstract/Free Full Text]

43. Zeniou, M., T. Ding, E. Trivier, and A. Hanauer. 2002. Expression analysis of RSK gene family members: the RSK2 gene, mutated in Coffin-Lowry syndrome, is prominently expressed in brain structures essential for cognitive function and learning. Hum. Mol. Genet. 11:2929-2940.[Abstract/Free Full Text]

44. Zor, T., and Z. Selinger. 1996. Linearization of the Bradford protein assay increases its sensitivity: theoretical and experimental studies. Anal. Biochem. 236:302-308.[CrossRef][Medline]


Molecular and Cellular Biology, December 2004, p. 10573-10583, Vol. 24, No. 24
0270-7306/04/$08.00+0     DOI: 10.1128/MCB.24.24.10573-10583.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Silverman, E.
Right arrow Articles by Maller, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Silverman, E.
Right arrow Articles by Maller, J. L.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. J. Virol. Eukaryot. Cell
Microbiol. Mol. Biol. Rev. Clin. Vaccine Immunol. All ASM Journals