RNA Folding Affects the Recruitment of SR Proteins by Mouse and Human Polypurinic Enhancer Elements in the Fibronectin EDA Exon

In humans, inclusion or exclusion of the fibronectin EDA exonis mainly regulated by a polypurinic enhancer element (exonicsplicing enhancer [ESE]) and a nearby silencer element (exonicsplicing silencer [ESS]). While human and mouse ESEs behaveidentically, mutations introduced into the homologous mouseESS sequence result either in no change in splicing efficiencyor in complete exclusion of the exon. Here, we show that thisapparently contradictory behavior cannot be simply accountedfor by a localized sequence variation between the two species.Rather, the nucleotide differences as a whole determine severalchanges in the respective RNA secondary structures. By comparinghow the two different structures respond to homologous deletionsin their putative ESS sequences, we show that changes in splicingbehavior can be accounted for by a differential ESE displayin the two RNAs. This is confirmed by RNA-protein interactionanalysis of levels of SR protein binding to each exon. The immunoprecipitationpatterns show the presence of complex multi-SR protein-RNA interactionsthat are lost with secondary-structure variations after theintroduction of ESE and ESS variations. Taken together, ourresults demonstrate that the sequence context, in addition tothe primary sequence identity, can heavily contribute to themaking of functional units capable of influencing pre-mRNA splicing.

INTRODUCTION

Top

Introduction

The splicing process is a very flexible and critical step ingene expression. In fact, selected removal or inclusion of individualexons from nascent mRNA molecules allows a single gene to generatemultiple proteins with different primary structures; in thesecases, the process is known as alternative splicing (1, 38).Constitutive and alternative splicing processes are catalyzedby the spliceosome, a very complex RNA-protein aggregate thathas been recently estimated to contain approximately 145 differentproteins in addition to the five spliceosomal snRNAs (1, 38,41, 68). These factors are responsible for accurate positioningof the spliceosome on the 5' and 3' splice sequences that definethe exon. However, correct positioning of the spliceosome isa very complex process owing to the degeneracy of the splicesite consensus sequences, the presence of cryptic splice sitesin large introns, and the fact that most pre-mRNAs contain multipleintrons (26). Therefore, the action of several different proteinsis required to achieve accurate positioning of the spliceosomeon the splice site. Not surprisingly, alterations in the splicingprocess have been increasingly reported as being involved inmany genetic diseases (5, 8, 13, 23, 58). Among the well-knownfactors that may heavily influence the identification of intron-exonboundaries by the spliceosome are the exon length (3, 65), thepresence of splicing enhancer and silencer elements (5, 38),the strength of splicing signals (26), and the promoter architecture(19, 33). In addition to these factors, it has been proposedthat the natural tendency of RNAs to fold in highly stable secondaryand tertiary structures can potentially influence splicing activity(2, 4, 17, 21, 43, 49, 50). Recently, changes in RNA structurehave been suggested to play a role in pathogenetic processesinvolving the tau gene (27, 31, 66) and the dystrophin gene(48).

In the fibronectin (FN) gene, the influence of secondary structurehas been suggested to play an important role in determiningalternative splicing efficiency (52). This gene is a usefulsystem for investigation of alternative splicing because itoccurs in three developmentally regulated but noncoordinatedsites (EDA and EDB exons and the IIICS region), giving riseto at least 20 different polypeptides in humans (24, 37, 47).Furthermore, the functional relevance of these alternative splicingevents has been recently shown in a genetically engineered mousemodel devoid of regulated EDA splicing (53). In particular,inclusion of the EDA exon is totally dependent on the presenceof an 81-nucleotide (nt) sequence located within its centralregion (42) that was subsequently found to contain two cis-actingelements, a purine-rich human exonic splicing enhancer (hESE[5' GAAGAAGA 3']) and a human exonic splicing silencer (hESS[5' CAAGG 3']), located 13 nt downstream of the ESE (10). Asidefrom their enhancing or silencing function, these two elementsare also very different in context dependence. In fact, whilethe function of the hESE element can be exported to at leastsome different exonic contexts, the hESS function was observedto strictly depend on the complete EDA exonic context (52).Even more strikingly, we have reported that in a hybrid exoncontaining both EDA and EDB exon sequences, the hESS elementacquires the properties of an enhancer sequence (52). Our resultsthus raised the possibility that the function of the hESS elementin the EDA context might be to maintain the correct displayof the ESE sequence rather than to bind specific splicing regulatoryproteins (52). Indeed, the importance of RNA secondary structurein the regulation of FN alternative splicing has also been proposedfor another region of the EDA exon (64) and a report investigatingthe splicing of the EDB exon has indicated the presence of anexonic splicing enhancer element(s) that may be context dependent(39) in addition to the well-characterized intronic enhancerelement (29).

Comparative study of functional sequences through evolutionhas been a very useful tool with which to understand mechanismsand structures that otherwise elude interpretation (25, 36).Recently, this approach has yielded important information regardingthe evolution of the FGF-R2 gene through alternative splicingof the mutually exclusive IIIb and IIIc units (49). Hence, ourinterest in analyzing the EDA ESE function in a highly homologoussystem, such as the mouse. As expected, the mouse and humanexons have a very high level of nucleotide sequence similarityand the difference between the two sequences consists of onlyeight nucleotide substitutions. This similarity is also reflectedat the functional level, as the hESE and mouse ESE (mESE) sequenceshave already been reported to be interchangeable (54).

In the present study, we have characterized the effects of introducingsimilar mutations into the mouse and hESS homologous regions.Our results show that these mutations introduced into the mouseand human sequences do not have the same effect on the regulationof alternative splicing, with the putative mouse ESS (mESS)sequence behaving as a splicing enhancer. This unexpected findingcan be accounted for by the existence of significant differencesin the two RNA secondary structures that, following mutation,can differentially affect ESE display. These results were confirmedby immunoprecipitation (IP) analysis, which showed a correlationbetween SR protein occupancy of the ESE sequences and RNA secondary-structurepredictions.

MATERIALS AND METHODS

Top

Materials and Methods

Plasmid construction. Constructs hTot, h ${Delta}$ 2e, h ${Delta}$ 4, mTot, and m ${Delta}$ A have been previouslydescribed (10, 54). The m ${Delta}$ B5, m ${Delta}$ B6, Ah ${Delta}$ B5, Ah ${Delta}$ B5AhTh, Ah ${Delta}$ B53h, Am ${Delta}$ B53h,and m/h ${Delta}$ 4Cm mutations were introduced by PCR-directed mutagenesisstarting from the mouse EDA minigene as previously described(54). Plasmid ESEx2 was obtained by cloning into the PstI siteof pBluescript II SK+ the sequence 5' CTGATGGTGAAGAAGACACTGCACCTGATGGTGAAGAAGACACTGCAG3' in such a way as to allow multiple insertions. Sequence analysisconfirmed the presence of two inserts in the correct orientation.Plasmid NF-1 IVS37 was obtained by amplification of a 170-nt-longintronic region from nt 131 to nt 305 of IVS37 in the NF-1 geneby using sense and antisense primers 5' CCTCTTAAAGTTTAGTTGTT3' and 5' ACAGTACTTGGCAATAGCAGATAA 3'.

Cell culture, transfection, and RT-PCR analysis. NIH 3T3 cells were maintained in Dulbecco's modified Eagle mediumsupplemented with 10% fetal calf serum, 50 mg of gentamicinper ml, and 4 mM L-glutamine. Approximately 1.6 x 10⁶ cellswere transfected with 5 µg of specific plasmid purifiedby CsCl gradient centrifugation and 3 µg of T antigenexpression plasmid (pb5'sVBglII) by means of a modified calciumphosphate precipitation method (32) or DOTAP reagent (BoehringerMannheim) as suggested by the manufacturer. Cells were harvested36 h after transfection. Total RNA was then prepared from thetransfected cells by a single-step extraction method with RNAzolTMB (TEL-TEST Inc.). A standard reverse transcription (RT) protocolwith Moloney murine leukemia virus from Gibco/BRL was used.To perform the RT-PCR assay for analysis of the alternativelyspliced products, the cDNA was synthesized with an oligo(dT)primer and then amplified by PCR with the primers previouslydescribed for the human and mouse minigenes (10, 54). Four independenttransfections were carried out for each construct.

Enzymatic analysis of RNA secondary structure. Single-strand-specific (S1 nuclease and T1 RNase) and double-strand-specific(V1 RNase) enzymes were used to analyze the secondary structureof the in vitro-transcribed RNAs. Single-stranded regions wereidentified by cleavage with RNase T1 (which cleaves in correspondenceto guanosine residues present in single-strand regions) andnuclease S1 (which cleaves single-stranded nucleic acids withoutbase specificity). Double-stranded or stacked regions were alsoidentified by cleavage with RNase V1 (which does not possessany base specificity). A sequencing reaction performed withthe same primer used in the RT analysis was used to fit allof the observed cleavage sites in the primary nucleotide sequence.The complete mouse sequences originally inserted into the pSVED-Avectors were cloned into the SmaI site of the pBluescript IISK+ plasmid and transcribed with T7 RNA polymerase (PharmaciaBiotech). Enzymatic digestion was performed essentially as previouslydescribed (52). Briefly, reaction mixtures contained 1 µgof RNA and 0.02 U of RNase V1 (Pharmacia Biotech), 0.5 U ofRNase T1 (Sigma), or 20 U of S1 nuclease (Pharmacia Biotech)and were incubated at 30°C for 15 min. A control aliquotof RNA without the addition of RNases was processed simultaneouslywith the digested samples. The RNase cleavage sites were identifiedby primer extension with a ³²P-end-labeled oligonucleotide primer(5' GGGTGGTGGGTGCGTTAA 3'), and the RT reaction products wereloaded onto a 6% polyacrylamide sequencing gel and exposed toKodak X-Omat AR film for 12 to 24 h. The results were then usedto optimize the RNA secondary-structure predictions performedby the mFold program (available at The European mFold Server[http://bibiserv.techfak.uni-bielefeld.de/mfold/]) (70).

IP of SR proteins following UV cross-linking. The RNA probes used in this study (hTot, h ${Delta}$ 2e, h ${Delta}$ 4, mTot, m ${Delta}$ A,m ${Delta}$ B5, m ${Delta}$ B6, and NF-1 IVS37) were obtained by cloning into pBluescriptKS+ the human and mouse sequences both wild type and carryingthe different mutations. In order to avoid possible interferencewith other factors binding to the first half of the mouse andhuman EDA exon, only the sequences from nt 107 to nt 270 ofthe human exon and from nt 103 to nt 270 of the mouse exon werecloned. Each plasmid was then linearized with the appropriaterestriction enzyme and transcribed with T7 RNA polymerase inaccordance with standard procedures. Plasmid ESEx2 was transcribedwith T3 RNA polymerase and T7 RNA polymerase (to obtain a controlRNA). UV cross-linking of [ ${alpha}$ -³²P]UTP-labeled RNAs with commercialHeLa nuclear extract (C4; Biotech) was performed as describedbefore (7). To each sample we added 150 µl of IP buffer(20 mM Tris [pH 8.0], 300 mM NaCl, 1 mM EDTA, 0.25% NP-40) togetherwith 1 µg of monoclonal antibodies (MAbs) and incubatedthe mixture for 2 h at 4°C on a rotator wheel. Anti-SF2/ASF(MAb 96) and anti-SR phosphorylated domain (MAb 1H4) MAbs werepurchased from Zymed Laboratories Inc., while anti-SC35 MAbwas purchased from Sigma. After the 2-h incubation, we addedto each sample 30 µl of Protein A/G-Plus Agarose (SantaCruz Biotechnologies) and incubated the mixture at 4°C overnight.On the following morning, the beads were subjected to four washingcycles with 1.5 ml of IP buffer and then loaded onto a sodiumdodecyl sulfate (SDS)-11% polyacrylamide gel electrophoresis(PAGE) gel. Gels were run at a constant 30 mA for approximately3.5 h, dried, and then exposed for 4 to 6 days with a BioMaxScreen (Kodak). Three independent IP assays were carried outfor each antibody. Competition experiments were performed byadding unlabeled RNA in a 5 M excess to the reaction mixturebefore addition of the labeled hTot RNA. IPs were then performedas already described.

RESULTS

Top

Results

Comparison of alternative splicing regulation in the mouse and human EDA sequences following homologous deletions. To compare the alternative splicing regulation of the humanand mouse FN EDA exons, we used an FN- ${alpha}$ -globin hybrid minigene,named pSV ${alpha}$ Glob (10), into which we inserted the mouse and humanEDA exons (mTot and hTot, respectively) together with flankingintrons and exons (Fig. 1A). This is a well-proven system formeasurement of the levels of in vivo alternative splicing ofthe FN EDA exon in different cellular systems and has been usedextensively in previous studies of both human and mouse EDAexons (9, 10, 12, 52, 54). Figure 1B shows the effect on thealternative splicing of the EDA exon of analogous deletionsin the region surrounding the mESE, mESS, hESE, and hESS elements.It can be seen that deletion of both hESE and mESE polypurinicsequences (h ${Delta}$ 2e and m ${Delta}$ A mutants) causes complete exon skippingfrom the resulting mRNA. Thus, both hESE and mESE act as exonicsplicing enhancers, a result that has been previously describedby our laboratory (10, 54). However, when we deleted the putativemouse silencer element (identified solely on the basis of homologywith the human sequence), we did not observe the same effects.In fact, while a deletion in the hESS element (h ${Delta}$ 4 mutant) causesalmost total exon inclusion, the identical mutation in mESS(m ${Delta}$ B5 mutant) does not appear to have any effect on the levelsof exon inclusion (Fig. 1B). Even more strikingly, deletionof a single additional nucleotide in the mESS element (m ${Delta}$ B6)causes total exon exclusion. This result was identical to thatobserved when the mESE element had been deleted (m ${Delta}$ A mutant),thus identifying the putative mESS sequence as possessing enhancercharacteristics.

View larger version (48K):
[in this window]
[in a new window]
FIG.1. Changes in mouse and human FN EDA alternative splicing caused by the introduction of deletions into the ESE and ESS regulatory regions. (A) Schematic representation of the human and mouse minigenes. The FN exons and introns are labeled by white boxes and lines, linker sequences are shadowed, and ${alpha}$ -globin exon 3 is indicated by black boxes. The locations of the primers used in the RT-PCR assay are shown: closed arrows indicate human-specific primers, while open arrows indicate mouse-specific primers. The sequence of the exonic region involved in EDA splicing regulation is reported for the human wild-type minigene (hTot) and mutants carrying a deletion of the ESE (h ${Delta}$ 2e), ESS (h ${Delta}$ 4) or for the mouse wild-type minigene (mTot) and mutants carrying a deletion of the mESE (m ${Delta}$ A) or mESS (m ${Delta}$ B5 and m ${Delta}$ B6). The respective ESE (hESE and mESE) and ESS (hESS and mESS) sequences are in bigger characters. (B) RT-PCR analysis of total RNA from cells expressing each of the indicated constructs in the NIH 3T3 cell line. PCR products either containing (+) or lacking (-) the FN EDA exon in the messenger transcribed from the transfected minigene are indicated. M, molecular weight markers (1 kb; BRL).

Effects of stepwise changes in the m ${Delta}$ B5 sequences toward their h ${Delta}$ 4 homologue. The observed changes in splicing behavior may be caused by theeffects of one (or more) nucleotide substitutions on putativeSR binding sites. In fact, in many experimental systems, singlenucleotide substitutions have been known to affect ESE elements(11, 13, 14, 44). This may be particularly relevant for theEDA exon, as proteins belonging to the SR protein family havea well-known ability to alter EDA inclusion in the mature mRNA(19, 40, 42). The use of SR scoring matrices to identify potentialSR binding sites has been very useful in functionally characterizingseveral disease-causing mutations in the BRCA1 and SMN1 genes,as recently reviewed (13). Therefore, we decided to apply theavailable scoring matrices for SF2/ASF, SC35, SRp40, and SRp55to the human and mouse sequences (scoring matrices are availableat http://exon.cshl.org/ESE/ESEmatrix.html) (15). The resultsshowed that the 8-nt differences between the human and mouseEDA exon sequences may have resulted in changes in either thepositioning or scoring result of several putative SR proteinbinding sites (data not shown).

In order to evaluate experimentally the importance of thesepotential binding site changes, we decided to progressively"humanize" the exon sequence of m ${Delta}$ B5 toward the h ${Delta}$ 4 sequence.The rationale for this mutagenesis approach was that if anyof these exonic single-nucleotide substitutions was responsiblefor the observed changes in splicing behavior (through eithercreation or deletion of SR protein binding sites), then we wouldexpect some mutants to display the h ${Delta}$ 4 splicing pattern (Fig.1B). Figure 2A shows a schematic diagram of the mutants engineeredto test this hypothesis (Ah ${Delta}$ B5, Ah ${Delta}$ B5AhTh, Ah ${Delta}$ B53h, and Am ${Delta}$ B53h).These mutants were transfected in NIH 3T3 cells, and by RT-PCR,we analyzed the effect on EDA exon inclusion. Figure 2B showsthat none of the mutants acquires the h ${Delta}$ 4 splicing pattern (allincluded) and that the nucleotide substitutions, at most, causesmall shifts in the EDA ± ratio. Only a complete changeof all of the exonic nucleotides to the human sequence restoresthe h ${Delta}$ 4 pattern, as shown for the m/h ${Delta}$ 4Cm mutant. It should benoted that in this construct the human G-to-C substitution atposition +7 of the 5' splice site is kept unchanged, also rulingout any potential effect of differing 5' splice site relativestrengths in the generation of the h ${Delta}$ 4 splicing pattern. It shouldalso be noted that this mutational analysis also rules out thepossible influence of additional SR proteins (for which no matricesare currently available) or the presence of more elusive regulatorysequences such as the composite enhancer and silencer elementsrecently identified in the cystic fibrosis transmembrane regulator(57, 59). It is thus clear that the reason why mESS and hESSbehave differently must lie elsewhere.

View larger version (31K):
[in this window]
[in a new window]
FIG.2. Effects on the splicing process of gradually humanizing the m ${Delta}$ B5 mouse sequence to the h ${Delta}$ 4 sequence. (A) Schematic diagram of each mutant analyzed with the minigene system in NIH 3T3 cells. Open boxes represent the ESE and ESS sequences, respectively. Uppercase letters represent human nucleotides, while lowercase letters denote mouse nucleotides. On the human sequence, nucleotides are numbered. Straight lines represent exonic sequences, while broken lines represent intronic sequences. For clarity, the diagrams have not been drawn to scale. (B) RT-PCR analysis of total RNA from cells expressing each of the indicated constructs in the NIH 3T3 cell line. PCR products either containing (+) or lacking (-) the FN EDA exon in the messenger transcribed from the transfected minigene are indicated.

Determining the RNA secondary structure of the mouse EDA exon. Previous studies performed in our laboratory had already indicatedthat the function of the hESS element in the human EDA exonis totally dependent on its original human context (52). Thus,the potential existence of structural differences between thehuman and mouse sequences might well result in different behaviorsof the two RNAs when they are subjected to similar deletions.To further analyze this issue, it was first necessary to determinethe wild-type mouse secondary structure. To experimentally determinewhich of the mouse EDA secondary structures predicted by computeranalysis with the mFold program (69-71) was closer to reality,we performed an RNase mapping analysis of the mouse EDA exon(Fig. 3A and B). Single-stranded regions were identified bycleavage with RNase T1 and nuclease S1, while double-strandedor stacked regions were identified by cleavage with RNase V1.The results (Fig. 4B) were then compared with our previouslypublished secondary structure of the human EDA exon (52) (Fig.4A).

View larger version (74K):
[in this window]
[in a new window]
FIG.3. Enzymatic determination of the RNA secondary structure of the mouse EDA exon. In vitro-transcribed mTot RNA was enzymatically digested with S1 nuclease and RNases T1 and V1 and reverse transcribed with an antisense primer. The RT products were separated on a sequencing polyacrylamide gel. A sequencing reaction (numbered according to the exon length) performed with the same primer was run in parallel with the cleavages in order to precisely determine the cleavage sites. In order to cover the whole exon length, short (A) and long (B) runs were performed. Squares, circles, and triangles indicate S1 nuclease and RNase T1 and V1 cleavage sites, respectively. Black, shaded, and white symbols indicate high, medium, and low cleavage intensities, respectively. No enzyme was added to the reaction mixture in lane N. The mESS and mESE positions are marked on the right of each sequencing reaction.

View larger version (22K):
[in this window]
[in a new window]
FIG. 4. Comparison of the RNA secondary structure of the human (A) and mouse (B) wild-type EDA sequences. The two structures were optimized by computer-assisted RNA modeling, and the respective ESE and ESS elements are circled to facilitate their localization. Squares, circles, and triangles indicate S1 nuclease and RNase T1 and V1 cleavage sites, respectively. Black, shaded, and white symbols indicate high, medium, and low cleavage intensities, respectively. The asterisks in the mouse secondary-structure model mark the nucleotide differences between the mouse and human nucleotide sequences.

Figure 4A and B show that the cleavages in the first half ofthe exon are very well conserved, a result that is in keepingwith the absence of nucleotide differences in the first halfof the mouse and human EDA exons. This is also consistent witha previous phylogenetic analysis that indicated that duringevolution, the first two stem-loop domains (I and II) are absolutelyconserved between different species, including mice and humans(64). On the other hand, the eight nucleotide substitutionsbetween the human and mouse sequences in the second half ofthe exon result in distinct changes in the digestion pattern,indicating that structural changes may be present. In fact,the secondary-structure predictions for this region indicatedseveral changes, such as the loss of single-stranded cuts inthe human CCGGGU loop (VIa) with respect to the homologous CCGGGG*sequence that is predicted to form part of the main stem ofmouse domain III (as indicated by the V1 cleavages on the twoC's). Overall, what is observed is a change concerning the generaldisposition of the stem-loop elements in the mouse and humansequences. However, it is nonetheless important to note thatthe mESE sequence is localized in an apical stem-loop positionwhile the putative mESS sequence is also part of a double-strandedregion (thus mimicking the hESE-hESS sequence disposition).

Analysis of the changes in the mouse and human RNA secondary structures following homologous deletions. It was then of interest to analyze the changes in secondarystructure following the introduction of the m ${Delta}$ B5 and m ${Delta}$ B6 mutations(in particular regarding mESE display). Figure 5B and C showthe secondary-structure analysis of the m ${Delta}$ B5 and m ${Delta}$ B6 mutantscompared to the mTot sequence (Fig. 5A). This analysis showsthat the mESE element in the m ${Delta}$ B5 RNA remains in a stem-loopconfiguration, as demonstrated by the presence of single-strand-specificcleavages in its location flanked by double-stranded cleavagesites (Fig. 5B, top). In keeping with this observation, thesecondary-structure predictions indicate a local change in thesecondary structure which nonetheless maintains the mESE regionin a stem-loop configuration (Fig. 5B, bottom). On the otherhand, deletion of the m ${Delta}$ B6 region results in more extensive changesin the restriction cleavage sites with respect to the mTot structuralanalysis (Fig. 5C, top). In particular, it is worth noting theappearance of a strong T1 cleavage site in correspondence toguanosine G150 (indicated by an arrow) which is totally absentin the mTot RNA, where this G150 is predicted to be part ofa stem region and is part of a region cut by V1 RNase (Fig.5A, top). This is consistent with the secondary-structure predictionsperformed for the m ${Delta}$ B6 mutant, which place the G150 nucleotidein a loop region at the apex of a new structure while, as previouslysaid, in the mTot RNA this nucleotide was predicted to be partof a stem region. In this structure, an important feature isrepresented by the loss of a stem-loop configuration for themESE region and its partial inclusion in a stem configuration(Fig. 5C, bottom), a situation very different from the mTotand m ${Delta}$ B5 results.

View larger version (45K):
[in this window]
[in a new window]
FIG. 5. Secondary-structure analysis of the ESE region in the mTot (A), m ${Delta}$ B5 (B), and m ${Delta}$ B6 (C) constructs. The in vitro-transcribed RNAs were enzymatically digested with S1 nuclease and RNases T1 and V1 and reverse transcribed, and the RT products were separated on a sequencing polyacrylamide gel. No enzyme was added to the reaction mixture in lane N. The regions containing the ESE and ESS elements are shown by a vertical line. The upper part of each panel shows the enzymatic analysis of RNA templates of mTot, m ${Delta}$ B5, and m ${Delta}$ B6 constructs. The bottom part reports the cleavages on the optimized secondary-structure predictions. Squares, circles, and triangles indicate S1 nuclease and RNase T1 and V1 cleavage sites, respectively. Black, shaded, and white symbols indicate high, medium, and low cleavage intensities, respectively. The arrow indicates the position of G150, which is present in a stem position in the mTot RNA but shifts to a loop configuration in the m ${Delta}$ B6 mutant.

In conclusion, these findings correlate well with the transfectionresults (Fig. 1B), which have shown that the m ${Delta}$ B5 mutant displaysa splicing pattern identical to that of mTot while the m ${Delta}$ B6 deletionresults in exon skipping.

Recruitment of SR proteins on the human and mouse EDA exons following deletion of the hESE (h ${Delta}$ 2e) and mESE (m ${Delta}$ A) sequences. In order to functionally test the recruitment of the differentSR proteins by the ESE elements of the mouse and human wild-typeand mutant sequences, we performed UV cross-linking analysis,followed by IP with MAbs. Figure 6A shows the UV cross-linkingprofiles of hTot, h ${Delta}$ 2e, mTot, and m ${Delta}$ A with total nuclear extractfrom HeLa cells. The UV cross-linked samples were subsequentlyimmunoprecipitated with MAbs against SF2/ASF (MAb 96) and thephosphorylated SR domain (MAb 1H4) that recognizes mainly Srp40,SRp55, and SRp75 and MAb anti-SC35 (Fig. 6B, C, and D, respectively).The results show that both the human and mouse wild-type RNAs(hTot and mTot) were able to immunoprecipitate SF2/ASF, SRp40,SRp55, and SRp75 at similar levels, with the only exceptionbeing represented by SC35, which shows lower affinity for themouse sequence (Fig. 6D). Interestingly, consistent with theseresults, the SR scoring matrices predict the presence of a higherscore in the human ESE (at position 161) as opposed to its homologousbinding site in the mESE region (data not shown). On the otherhand, neither the h ${Delta}$ 2e nor the m ${Delta}$ A RNA was able to immunoprecipitateany labeled SR protein, a result that is consistent with theidentification of the ESE elements as the only target for SRprotein recruitment to the EDA exon (42, 54).

View larger version (58K):
[in this window]
[in a new window]
FIG. 6. UV cross-linking analysis of the wild-type human and mouse sequences (hTot and mTot) and ESE deletion-carrying mutants (h ${Delta}$ 2e and m ${Delta}$ A) with HeLa nuclear extract. Each RNA was labeled with [ ${alpha}$ -³²P]UTP and then incubated with approximately 150 µg of HeLa nuclear extract before being subjected to UV cross-linking and digestion with RNase. Samples were then run on an SDS-11% PAGE gel and exposed to BioMax autoradiographic film. The electrophoretic mobility of prestained markers (Broad Range; New England Biolabs) is shown on the left (A). IP was then performed with equal amounts of each UV cross-linked sample shown in panel A with specific MAbs against different SR proteins: SF2/ASF (B, MAb 96), the phosphorylated RS domain (C, MAb 1H4), and SC35 (D, anti-SC35). The mobility of the SR proteins is indicated on the left. The SF2/ASF antibody immunoprecipitates more than one protein band owing to the presence of differently phosphorylated forms, as specified by the manufacturer.

Recruitment of SR proteins on the human and mouse EDA exons following introduction of the m ${Delta}$ B5 and m ${Delta}$ B6 mutations. It was thus of interest to extend these analyses to the m ${Delta}$ B5and m ${Delta}$ B6 mutations and determine whether they could affect SRrecruitment by the mESE element. Figure 7 shows the UV cross-linkingprofiles of hTot, h ${Delta}$ 2e, h ${Delta}$ 4, mTot, m ${Delta}$ B5, and m ${Delta}$ B6 with total nuclearextract from HeLa cells before IP analysis (Fig. 7A) and afterIP with MAb 96 (Fig. 7B), MAb 1H4 (Fig. 7C), and MAb anti-SC35(Fig. 7D). The results show that the m ${Delta}$ B5 and h ${Delta}$ 4 mutants arevery similar to the mTot IP pattern but the m ${Delta}$ B6 mutant couldnot immunoprecipitate SF2/ASF (Fig. 7B). This result is verysimilar to the observed effect of the h ${Delta}$ 2e and m ${Delta}$ A mutations (Fig.6B and 7B), with the difference that the m ${Delta}$ B6 mutant containsthe full mESE sequence, as opposed to h ${Delta}$ 2e, where the ESE sequenceis deleted.

View larger version (85K):
[in this window]
[in a new window]
FIG. 7. UV cross-linking analysis of human and mouse mutants with HeLa nuclear extract. Each RNA was labeled with [ ${alpha}$ -³²P]UTP and then incubated with HeLa nuclear extract before being subjected to UV cross-linking and digestion with RNase. Samples were then run on an SDS-11% PAGE gel and exposed to BioMax autoradiographic film. The electrophoretic mobility of prestained molecular size markers (Broad Range; New England Biolabs) is shown on the left (A). IP was then performed with the same amount of each UV cross-linked sample shown in panel A with specific MAbs against different SR proteins: SF2/ASF (B, MAb 96), the phosphorylated RS domain (C, MAb 1H4), and SC35 (D, anti-SC35). The mobility of the SR proteins is indicated on the left. The SF2/ASF antibody immunoprecipitates more than one protein band owing to the presence of differently phosphorylated forms, as specified by the manufacturer.

In order to complement and extend these observations, we alsoperformed competition experiments with unlabeled RNAs to assesstheir ability to compete with the SR proteins for binding tothe human RNA (hTot). The results, shown in Fig. 8, demonstratethat all of the RNAs behaved as expected from the direct IPanalysis. In fact, both the h ${Delta}$ 2e and m ${Delta}$ B6 RNAs could not competewith labeled hTot RNA for SF2/ASF (Fig. 8A) while the m ${Delta}$ B5 andh ${Delta}$ 4 RNAs could compete for all of the SR proteins (Fig. 8A to C).Indeed, the m ${Delta}$ B6 mutant is the RNA that shows a general reductionin competition efficiency for all of the other SR proteins examined.

View larger version (59K):
[in this window]
[in a new window]
FIG. 8. Competition and IP analysis of unlabeled mouse and human EDA sequences in the presence of labeled hTot RNA. Competition prior to UV cross-linking was performed by incubating labeled hTot RNA and HeLa nuclear extracts with equal amounts of unlabeled hTot, h ${Delta}$ 2e, h ${Delta}$ 4, mTot, m ${Delta}$ B5, and m ${Delta}$ B6 (in approximately fivefold molar excess) before IP analysis. IPs were performed with specific MAbs against SF2/ASF (A, MAb 96), the phosphorylated RS domain (B, MAb 1H4), and SC35 (C, anti-SC35). The mobility of the SR proteins is indicated on the left. Samples were run on an SDS-11% PAGE gel and exposed to BioMax autoradiographic film.

Recruitment of SR proteins by artificial and naturally occurring GAAGAAGA-containing sequences. Finally, we wished to determine the contribution of the ESEsequence to exon SR protein recruitment with respect to thestructural context. Therefore, we performed an IP analysis oftwo RNAs containing GAAGAAGA sequences in different contexts.First, we used a small artificial RNA containing two ESE sequencerepeats (ESEX2) flanked by eight nucleotides of the EDA sequenceon either side (Fig. 9A). As shown in Fig. 9B, this RNA wasfound to be a rather inefficient binder of SR proteins, especiallyconsidering the fact that it carried two tandem copies of theESE sequence. This highlights the importance of the contextin which the binding sequence is embedded.

View larger version (57K):
[in this window]
[in a new window]
FIG. 9. IP analysis comparing the recruitment of SR proteins by human ESE sequences alone (GAAGAAGA) as opposed to the full EDA exon. (A) Comparison of the two RNAs used in this experiment: the hTot RNA contains the ESE within its original context (nt 107 to 270), while the ESEx2 RNA contains two copies of the ESE element (flanked only by 8 nt of the EDA sequence) at the 3' end of pBluescript II SK+ sequences (dotted line). Numbering on the ESEx2 construct refers to the distance from the T3 RNA polymerase promoter on pBluescript II SK+. A control RNA is also included. IPs (B) were performed with equal amounts of the UV cross-linked samples and with the different specific MAbs against SR proteins: SF2/ASF (MAb 96), the phosphorylated RS domain (MAb 1H4), and SC35 (anti-SC35). The leftmost gel contains the total UV cross-linked proteins prior to IP. (C) Comparison of the hTot RNA with a naturally occurring, 170-nt-long intronic region containing a GAAGAAGA sequence from IVS37 of the NF-1 gene. The numbering on the IVS37 construct refers to intronic nucleotide positions starting from the 5' splice site of NF-1 exon 37. (D) IP profile of these two sequences with the same antibodies used in panel B. As above, the leftmost gel contains the total UV cross-linked proteins prior to IP. In all of the gels, the mobility of the SR proteins is indicated on the left. Samples were run on an SDS-11% PAGE gel and exposed to BioMax autoradiographic film.

It was also of interest to check whether a naturally occurringGAAGAAGA sequence was capable of binding the same complementof SR proteins as the EDA exon. For this purpose, we chose anintronic region in IVS37 of the NF-1 gene that contains a GAAGAAGAsequence at position +167 and amplified the sequence surroundingit to mimic the hESE position in the human exon (Fig. 9C). Itshould be noted that, as expected, very little homology existswithin the hTot and IVS37 sequences (data not shown). The IPanalyses reported in Fig. 9D confirm that this naturally occurringGAAGAAGA sequence cannot bind any of the SR proteins detectedwith the hTot sequence. Taken together, these results providean effective measurement of how important correct sequence displayof the ESE in the EDA exon is for its recognition by SR proteinfactors.

DISCUSSION

Top

Discussion

In this study, we report that deletions in the putative mESSelement localized in the FN EDA exon do not have the same effectson alternative splicing as deletions originally described forthe hESS element (10). The sequences of the two exons are verysimilar, with only 8 nt substitutions out of a total 270 nt,and in this study we show that no single nucleotide (or subset)can account by itself for the observed differences in splicingbehavior. However, when all specific nucleotides in the mouseEDA exon but not the 5' splice site are replaced with theirhuman counterparts, the mESS behaves the same way as the hESS.This raised the possibility that the nucleotide substitutionscould be involved in some higher-order regulatory structurerather than in just the modification of the primary nucleotidesequence. In fact, the structural analysis performed in thisstudy has shown that these eight substitutions induce distinctchanges in the mouse and human RNA structures. However, beforeanalyzing these changes in detail, it is worth discussing thesimilarities. First of all, our RNase digestion analysis showsa complete conservation of the first two stem-loops in the humanand mouse exons. This is consistent with the fact that in thefirst part of the EDA exon the mouse and human sequences areidentical and have the structure proposed by a previous phylogeneticstudy of this region (64). Most importantly, the detection ofthis expected similarity provides a good internal control forthe structural differences that we observe in the 3' half ofthe mouse and human exons. It is in this region, in fact, thatthe eight nucleotide differences between the human and mousesequences are localized and may thus determine the changes inthe overall stem-loop dispositions. The effect of these substitutionson RNA secondary structure is not an unexpected finding, asapparently benign single-nucleotide polymorphisms have alreadybeen reported to induce different structural folds in the premRNA structure both in vivo and in vitro (61). Despite thesedifferences, an important similarity between the human and mousestructures is the presence of the ESE sequences within terminalstem-loop domains. The maintenance of this region in a single-strandedcondition in both RNAs is consistent with the observation thatsingle strandedness of RNA elements is a necessary requirementto obtain sequence-specific protein binding, such as in thecase of the Drosophila doublesex splicing enhancer elementswith the RNA-binding domain of Tra2 (28) or TDP-43 for UG repeatedsequences (6).

At the same time, these structural differences also raise thepossibility that deletion of the human and mESS sequences maynot result in the same structural change in both RNAs (and thusin a different recruitment of splicing factors to the enhancers).In support of this hypothesis is the observation that RNA secondarystructure can affect the recruitment of two nuclear factorsbelonging to the SR protein family of splicing regulators (B52and SRp55) (55, 62). Moreover, even the binding of hnRNP A1(a well-known splicing-antagonistic factor) has been recentlyobserved to be affected by RNA secondary structure in the removalof the second intron in the human immunodeficiency virus type1 rev and tat pre-mRNAs (20). Interestingly, it should be notedthat this relationship goes both ways and proteins such as hnRNPA1 (56) and the polypyrimidine tract-binding protein (16) havebeen reported to bind on either side of exons and physicallyloop them out of the splicing process.

In this respect, it should be mentioned that overexpressionof hnRNP A1 causes a slight but significant decrease in theinclusion of both mouse and human EDA exons (A. F. Muro, unpublisheddata). However, the comparison of the effects of hnRNP A1-mediatedsplicing inhibition on these exons has not revealed any significantdifference between the two species. In addition, the degreeof splicing inhibition detected in both systems is lower thanthe observed increase in EDA inclusion following similar levelsof overexpression of SF2/ASF (19). Taken together, these datasuggest that, in the EDA system, the inhibitory effect of hnRNPA1 may not be linked to a specific target sequence.

On a more general note, a question that also remains to be addressedis the presence of RNA secondary structure in vivo. There isstill no definitive answer to this question. However, severalrecent lines of evidence indicate that RNA folding can occurin vivo (61) and that this process can influence biologicalprocesses. For example, binding of proteins to RNA trinucleotiderepeats in vivo closely matches the in vitro results that predictthese repeats to be folded in a characteristic hairpin shape(63). It could, of course, be argued that these structures areof a very localized and specific nature. However, statisticalanalysis of mRNA coding sequences has revealed that calculatedmRNA folding is more stable than expected by chance, suggestingthat codon bias may favor the existence of mRNA structures (60).Although these results have been challenged with a differentset of statistical tools and genes (67), considerations analogousto those of Seffens and Digby (60) have been recently made concerningbacterial RNA (35). Thus, the picture that is beginning to emergeclearly favors the possibility that mRNA coding sequences arequite capable of harboring in vivo variable amounts of secondarystructure that may affect biological processes.

The structural data reported in this study indicate that them ${Delta}$ B6 deletion causes the mESE element to lose the original mTotRNA structure. It could then represent a situation analogousto that already reported to occur in a variety of 5' and 3'splice sites where RNA secondary structure prevents the U1 andU2 snRNP proteins from binding to the RNA (18, 22, 30, 45, 46,51). In fact, inhibition of SR protein binding in the m ${Delta}$ B6 mutanthas been confirmed by our IP analyses, which show that thismutant is unable to bind (or compete for binding of) the SF2/ASFprotein and, with less efficiency, the other SR proteins. Thisbinding profile correlates well with the splicing behavior ofthe m ${Delta}$ B6 mutant, which is identical to that of the h ${Delta}$ 2e and m ${Delta}$ Amutants. Interestingly, overexpression of this protein in aminigene assay has demonstrated that SF2/ASF possesses the greatestability of any SR protein family member to stimulate EDA inclusion(19). This provides a likely explanation of why the maintenanceof SC35, SRp40, SRp55, and SRp75 protein binding to m ${Delta}$ B6 cannotcompensate for loss of SF2/ASF binding capacity. Analogously,the fact that the m ${Delta}$ B5 mutant possesses an SR protein IP profileidentical to that of mTot is consistent with the observationthat both RNAs are spliced to the same degree.

Nonetheless, it should be noted that the correlation betweenSR binding levels and splicing efficiency is not complete. Itis clear that below an SR binding level threshold, functionalityis lost, such as observed for the h ${Delta}$ 2e, m ${Delta}$ A, and m ${Delta}$ B6 mutants.However, in the case of the h ${Delta}$ 4 mutant (for which we observedfull EDA inclusion), direct IP experiments detected a moderatereduction in SR binding levels, although the RNA preserves veryefficient competitor activity (a factor distinguishing it fromm ${Delta}$ B6 or h ${Delta}$ 2e RNA). It is thus clear that additional factors, otherthan the SR proteins, must contribute to the final outcome.One possibility is that the relative protein composition ("quality")of the complex that binds the ESE might play a role besidesthe quantity of SR proteins bound to the RNA or, alternatively,that additional positive or negative splicing factors (34) besidesthose immunoprecipitated by our antibodies might play a rolein h ${Delta}$ 4 splicing. Furthermore, other undetected structural changesnear the 5' and 3' splice sites may have caused improvementof splicing even in the case of reduced SR binding efficiency.

In conclusion, our results show that changes in regions thatdo not directly participate in protein binding can affect ESEelements by inducing changes in mRNA conformation. The importanceof the RNA secondary structure for recruitment of SR proteinfactors is also highlighted by the fact that a small RNA thatcontains two tandem copies of the human ESE sequence (GAAGAAGA)is considerably less efficient in binding the SR proteins detectedby a single copy of the same sequence in its original context(the EDA exon). In this respect, an even more striking resultis the inability of a naturally occurring intronic GAAGAAGAsequence to immunoprecipitate any of the SR proteins pulleddown by the same human sequence in its original context. Theresults highlight the importance of the local context in determininga functional effect on mRNA processing. Taken together, ourdata demonstrate that the sequence context, in addition to primarysequence identity, can heavily contribute to the making of functionalunits capable of influencing pre-mRNA splicing.

ACKNOWLEDGMENTS

This work was supported by grants from the Telethon Onlus Foundation(grant E1038 awarded to F.E.B.).

FOOTNOTES

* Corresponding author. Mailing address: ICGEB, Padriciano 99, I-34012 Trieste, Italy. Phone: (39) 040-3757337. Fax: (39) 040-3757361. E-mail: baralle{at}icgeb.org.

Present address: Institut für Anatomie und ZellbiologieIII, Universität Heidelberg, 69120 Heidelberg, Germany.

REFERENCES

Top