![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Thomas C. Brodnicki, Jerry M. Adams, and Andreas Strasser*
The Walter and Eliza Hall Institute of Medical Research, Parkville, Victoria 3050, Australia
Received 9 November 2003/ Returned for modification 13 November 2003/ Accepted 18 November 2003
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Gene knockout studies have helped to determine the role of a number of Bcl-2 family members in apoptosis regulation (10). For example, mice lacking the proapoptotic BH3-only gene bim accumulate lymphoid, myeloid, and plasma cells (4). Their T-cell development is disrupted, and their lymphocytes are refractory to a range of apoptotic stimuli, including those mediating the deletion of autoreactive cells (5, 14). In contrast, mice lacking prosurvival Bcl-2 die early in life due to polycystic kidney disease (42) and their lymphocytes have an abnormally short life span and abnormal sensitivity to apoptotic stimuli (27, 42). The demonstration that the renal disease and lymphopenia in these mice were abolished by concomitant deficiency for Bim underlines the critical opposing roles of BH3-only and Bcl-2-like proteins for tissue homeostasis (3).
Determining the physiological roles of additional BH3-only proteins requires identification of the cell types in which each is expressed and establishment of the consequences of gene disruption. Here we report such studies for the mouse BH3-only gene originally designated blk (18). It is now evident that blk is the murine ortholog of human bik/nbk (6, 17) on the basis of their location in syntenic regions, gene organization, and nucleic as well as amino acid sequence homology (2, 11, 43). Consequently, we recommend that both the mouse and human gene be designated bik, as we will do below. Like other BH3-only proteins, Bik binds to prosurvival family members and kills cells when overexpressed (6, 17, 18). However, although Bik was one of the first BH3-only proteins to be discovered, little has been reported about its expression and regulation. We report here that mouse bik is widely expressed in the hematopoietic system and, like its human ortholog (22), can be induced in B cells following antigen receptor stimulation. Interestingly, we also found that bik is expressed in a subset of endothelial cells. We describe Bik-deficient mice and our efforts to determine whether Bik plays a nonredundant role in those cell types for their programmed death in vivo or for their responses to diverse cytotoxic stimuli in vitro.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Northern blotting, Southern blotting, and RT-PCR.
RNA for Northern blotting was extracted from tissues using guanidine isothiocyanate and phenol-chloroform and poly(A)+ mRNA enriched using oligo(dT) cellulose (Roche). RNA was size fractionated by electrophoresis on a denaturing 1% agarose-formaldehyde gel, and blots were hybridized to an 
-32P-labeled bik coding region probe in Church buffer (8). Similarly, for Southern blotting, DNA (10 µg) was digested overnight and size separated by electrophoresis on a 0.7% agarose gel and the blots were probed with -32P-labeled probes using Church buffer.
cDNA for reverse transcription-PCR (RT-PCR) expression analysis was prepared from fluorescence-activated cell sorter (FACS)-sorted hematopoietic cells, and PCR amplifications were performed as described previously (30). Oligonucleotides for bik were 5'-GCTTGGCAGGATCCATGTCGGAGGCGAGACTTATG (sense) and 5'-AACAAGCTTCCCTGCCCCAGCTGCACTTCACTG) (antisense), those for hprt were 5'-GCTGGTGAAAAGGACCTCT (sense) and 5'-CACAGGACTAGAACACCTGC (antisense), and those for gapdh were 5' TGATGACATCAAGAAGGTGGTGAAG (sense) and 5' TCCTTGGAGGCCATGTAGGCCAT (antisense). PCR products were subjected to Southern blotting with -32P-end-labeled bik (5'-GTCAAGCTTCACTCAGGCGCCAGGAGTCAAGAC), hptr (5'-GGATACAGGCCAGACTTTGT), or a gapdh (5'-CCCGGCATCGAAGGTGGAAGAG) oligonucleotide in Church buffer.
Cell culture and viability assays. All cells were cultured at 37°C in a humidified 10% CO2 incubator in high-glucose Dulbecco Modified Eagle medium supplemented with 10% heat-inactivated fetal calf serum, 50 µM 2-mercaptoethanol, and 10-6 M asparagine. FACS-sorted primary T and B lymphocytes were cultured at 1 x 105 to 4 x 105 cells/ml, and thymocytes were cultured at 2 x 106 cells/ml. FACS-sorted mature B cells (sIgMlo sIgDhi) (see below) were stimulated with 20 µg of goat anti-mouse immunoglobulin M (IgM) (µ chain) F(ab')2 antibody fragments (Jackson ImmunoResearch) per ml in the presence of 100 U each of interleukin-2 (IL-2), IL-4, and IL-5 per ml at a starting concentration of 105 cells/ml. FACS-sorted T cells were stimulated with 2 ng of phorbol myristate acetate (PMA) (Sigma) per ml and 0.1 µg of ionomycin (Sigma) per ml plus 100 U of IL-2 per ml at 105 cells/ml. Cross-linked FasL was prepared by mixing FLAG-tagged human FasL (Alexis) with anti-FLAG M2 antibody (10 µg/ml) (Sigma). To assess viability, cell suspensions were incubated with 2 µg of propidium iodide (PI) (Sigma) per ml on ice for 5 min and analyzed on a FACS analyzer and viability was determined as the percentage of cells negative for PI.
Hematopoietic reconstitutions. Fetal livers were dissected from Ly5.2+ E14.5 embryos and dispersed, and 2 x 106 cells were injected via the tail vein into irradiated (twice at 550 R) C57BL/6 Ly5.1 female recipient mice. Blood was taken 9 to 12 weeks postreconstitution and subjected to hematologic and FACS analysis. Host- and donor-derived cells were distinguished by staining for Ly5.1 and Ly5.2, respectively. Hematopoietic organ composition was determined by FACS 11 to 15 weeks postreconstitution. Donor-derived T and B lymphocytes (Ly5.2+) were isolated from recipient lymph nodes for viability assays by cell sorting (see below). All analysis was performed using recipients from multiple independent donors of each genotype.
Immunofluorescence staining and flow cytometric analysis. FACS analysis and cell sorting were performed using RA3-6B2 anti-B220, S7 anti-CD43, 5.1 anti-IgM, 11-26C anti-IgD, YTA-321 anti-CD4, YTS-169 anti-CD8, A201.7 anti-Ly5.1, AL14A7 Ly5.2, 8C5 anti-Gr-1, and MI/70 anti-Mac-1 antibodies and Ter119 anti-erythroid surface marker conjugated to fluorescein isothiocyanate, Cy5, or biotin (Molecular Probes). R-Phycoerythrin-conjugated anti-B220 (Pharmingen) and anti-CD8 (Caltag) were also used Cell types were sorted as positive for the appropriate surface markers as described previously (30) using MoFlo (Cytomation) or Diva (Becton Dickinson) sorters. Pro-T and pre-T populations were sorted from thymus. Pro-B, pre-B, nucleated erythroid cells, and macrophages were sorted from bone marrow. Naive and mature B cells were sorted from spleen. T cells were sorted from lymph nodes, and granulocytes were isolated from peritoneal lavage fluid.
For hematopoietic analysis, single-cell suspensions were prepared from the thymus, lymph nodes (axial, branchial, mesenteric, and inguinal), bone marrow (two femurs), and spleen. Total viable white cells were then enumerated by trypan blue/hemocytometer counts. The composition of these organs was determined by FACS analysis as described previously (30) by using a FACScan apparatus (Becton Dickinson) or LSR analyser (Becton Dickinson). Hematological analysis was performed using an ADVIA hematology system (Bayer) on blood extracted via the retroorbital plexus.
For survival assays, wild-type and bik-/- lymphocytes were sorted from lymph nodes. T cells were sorted as CD4+ CD8- or CD4- CD8+ cells, whereas B cells were negatively sorted by collecting CD4- CD8- lymph node cells and shown to be 
98% B220+.
Histology and ß-galactosidase assay. Tissues for frozen sections were dissected and fixed in 4 or 0.2% paraformaldehyde (pH 7.4) for 2 or 16 h, respectively. The tissues were infiltrated with sucrose before being transferred to OCT fixative (Sakura Finetechnical Co., Tokyo, Japan) and snap frozen. Blocks were sectioned at 10 µm on a Leica CM 3050 S cryostat (Leica).
Dual ß-galactosidase/CD31 (PECAM-1) staining was performed on frozen sections from tissue fixed for 16 h with 0.2% paraformaldehyde. Sections were washed three times in phosphate buffered saline and then incubated with 0.03% H2O2 for 10 min. They were blocked with 10% normal goat serum (Vector Laboratories) before the addition of rat anti-mouse CD31- (7 µg/ml [Pharmingen], a kind gift from S. Stacker, Ludwig Institute, Melbourne, Australia) or isotype-matched rat anti-mouse B220 monoclonal antibody (RA3-6B2) for 2 h at room temperature. The sections were then incubated with biotin-conjugated mouse anti-rat Ig
light chain antibody (Mar-18) followed by ABC biotin-specific horseradish peroxidase reagent (Vector Laboratories). CD31 staining was then revealed by diaminobenzidine staining. The sections were rinsed in five changes of distilled H2O and, while still moist, immediately stained for ß-galactosidase activity. ß-Galactosidase activity was assayed on fixed frozen sections or whole tissue by incubation at 37°C for 16 h in an air incubator containing stain solution (5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, 2 mM MgCl2, 0.02% Tween 20, 0.5 mg of 5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside [X-Gal] per ml). Stained tissues were embedded in paraffin and sectioned at 10 µm. The sections were counterstained with nuclear fast red.
For hyaloid vessel analysis, eyes from postnatal day 16 (PN16) mice were fixed for 2 h in Bouin's fixative, embedded in paraffin, and sectioned longitudinally to reveal pupillary membrane (PM), tunica vasculosa lentis (TVL), and vasa hyaloidea propria (VHP). The sections were stained with hematoxylin and eosin. Vessel counts were conducted on 12 nonconsecutive sections from each eye, and the average number of vessels per section was calculated for each eye.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Because the expression of several genes for BH3-only proteins is induced by cytotoxic insults (10, 35), we also investigated whether bik expression was induced in response to DNA damage or treatment with cytotoxic drugs. bik mRNA levels were examined by RT-PCR analysis on cDNA prepared from thymocytes exposed to dexamethasone, ionizing radiation, or the calcium ionophore ionomycin or thymocytes undergoing spontaneous death when cultured in the absence of cytokines. No change was discerniable in response to any of these stimuli (data not shown).
Generation of mice lacking Bik. The bik gene was disrupted by replacing its first two coding exons (including that encoding the BH3 region) with a nucleus-localized E. coli ß-galactosidase reporter gene and a loxP-flanked neomycin resistance cassette (Fig. 2A). Three independently derived C57BL/6 ES cell clones harboring the correctly integrated targeting construct were identified. From each of two of these clones, an independent line of mice having a heterozygous deletion of the bik locus was established and bred to homozygosity. Targeting was confirmed by performing DNA analysis with both the 5' and 3' external genomic probes (Fig. 2B) and by showing that no bik mRNA could be detected in the major Bik-expressing organs: the liver, lung, heart, and kidneys (Fig. 2C). One of these mouse lines was then bred to C57BL/6 Cre deleter females, and deletion of the neo cassette was confirmed by PCR. Results presented here are from mice with a neo deletion and were verified by using a second, independently derived knockout line.
|
Loss of Bik does not affect hematopoiesis or cellular responses to apoptotic stimuli. Given the widespread expression of Bik in the hematopoietic compartment (Fig. 1), we explored whether its loss disrupted development or homeostasis of this compartment by comparing bone marrow, thymus, and spleen from 5- to 11-week old bik-/- mice and their wt littermates. The total cellularity of these organs from bik-/- mice was normal (Fig. 3A to C). Moreover, their bone marrow contained normal numbers of pro-B and pre-B cells, immature and mature B cells, precursor and mature macrophages, granulocytes, and nucleated erythroid cells (Fig. 3A and data not shown). In the bik-/- thymus, the numbers of pro-T, pre-T, and mature single positive T cells were normal (Fig. 3B). Similarly, the bik-/- spleen contained normal numbers of mature CD4+ and CD8+ T lymphocytes, B cells, macrophages, granulocytes, and nucleated erythroid cells (Fig. 3C and data not shown). In bik-/- lymph nodes, the percentages of mature T and B lymphocytes were also unaffected by Bik loss (data not shown). Furthermore, analysis of peripheral blood from aged bik-/- mice and their wt littermates (30 to 46 weeks old) showed that the total numbers of lymphocytes, monocytes, neutrophils, eosinophils, and basophils were normal (Fig. 3D), as were the numbers of erythrocytes and platelets (data not shown). The relatively small absolute numbers of peripheral blood leukocytes observed (in both wt and bik-/- mice) are most probably due to the advanced age of the mice examined.
|
|
|
Loss of Bik does not prevent endothelial cell apoptosis in blood vessel regression. Since Bik is expressed in endothelial cells, we sought to determine if the death of endothelial cells and vascular regression were impaired by the absence of Bik. To assess this, we studied hyaloid vessel regression in postnatal bik-/- and wt mice. Hyaloid vessels and PM, blood vessel networks that feed the developing eye, regress rapidly from postnatal (PN) day 8 and are generally undetectable by 4 weeks of age (20). Prior to vessel regression, the PM appears as a vascular mesh across the pupil, whereas the VHP resides in the vitreous body, leading from the hyaloid artery (HA) to the lens, where it diverges into the TVL capillaries that attach to the lens surface. Hyaloid vessels of bik+/- mice displayed ß-galactosidase activity at PN7, indicating that bik was expressed in these vessels at the onset of their regression (Fig. 6A). Nevertheless, comparison of the eyes from PN16 bik-/- and wt mice revealed no difference in the numbers of TVL, VHP, or PM (Fig. 6B). Moreover, by 5 weeks, no hyaloid vessels remained in the eyes of bik-/- mice (data not shown). Hence, these vessels regress normally in the absence of Bik.
|
Like bcl-2-/- mice, all bik-/- bcl-2-/- mice (n = 4) became runted and died between 2 and 4 weeks of age (Fig. 7A and B), and histologic examination confirmed that they had succumbed to polycystic kidney disease (Fig. 7C). An explanation emerged from an assessment of bik expression in the developing kidneys by a ß-galactosidase assay performed at E14.5, the time at which pathological cell death occurs in bcl-2-/- kidneys (28). In contrast to adult kidneys, no ß-galactosidase activity was found in the mesenchymal or tubule cells (Fig. 7D). The few, scattered ß-galactosidase-positive cells in the E14.5 kidneys appeared to be endothelial cells. It was therefore unsurprising that Bik loss could not prevent the early postnatal death of bcl-2-/- mice.
|
|
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Increasing the levels of BH3-only proteins such as Bik in response to activation may predispose B cells to apoptosis that occurs when growth factors become limiting, a process that is thought to be critical for the resolution of immune responses (26). This process can be mimicked in vitro by depriving activated B lymphocytes of their requisite cytokines. Although loss of Bik did not protect B-cell blasts against this death (data not shown), again it is possible that Bik may be operating in a redundant manner with other BH3-only proteins, such as Bim, which is required for B-cell apoptosis following cytokine withdrawal (4). The observation that overexpression of Bcl-2 affords B cells greater protection against cytokine withdrawal than does loss of Bim (4) suggests that other BH3-only proteins, such as Bik, do act in concert with Bim.
While Bim deficiency renders thymocytes highly resistant to ionomycin and spontaneous death in culture, it has only a minor effect on their response to glucocorticoids, DNA damage, or phorbol esters (4), death stimuli which can be countered by Bcl-2 overexpression (37, 38). Hence, Bim either is not required for apoptosis in response to these stimuli or acts in concert with other BH3-only proteins. However, Bik loss did not reduce the sensitivity of thymocytes to these or any other apoptotic stimuli tested (Fig. 4). Our results therefore show that Bik is not a major contributor to apoptosis in lymphoid cells in response to these stimuli but, again, that it might act in concert with other BH3-only proteins. Indeed, very recent work suggests that the BH3-only protein Puma plays an important role in these responses (21, 44).
Assessment of ß-galactosidase reporter activity indicated that bik is expressed in the liver, kidneys, lungs, and heart but not the brain, consistent with the expression pattern of bik obtained by Northern blotting (Fig. 1) (18). This indicates that the ß-galactosidase knock-in is a faithful reporter of Bik expression in many tissues. It is uncertain why ß-galactosidase activity was not found in lymphocytes and other hematopoietic cells despite clear expression of bik mRNA in these cells. An equivalent discrepancy has been noted with a lacZ knock-in at the bim locus, which also presents very low or undetectable ß-galactosidase activity in lymphoid areas of the lymph node, thymus, and spleen, even though RNA and protein analyses clearly indicate Bim expression in these cells (P. Bouillet, unpublished observation) (32), in which loss of Bim profoundly impairs apoptosis (4, 5). Silencing of lacZ transgenes in hematopoietic cells has been documented previously (12, 31), and hence silencing of the reporter gene might contribute to the lack of ß-galactosidase activity in the lymphocytes in which it is located in the bik or bim locus. Another possibility is that a regulatory element needed for lymphoid expression of the locus resides within the region deleted in the replacement, such as in the deleted intron.
Bik is expressed in a restricted set of endothelial cells but is dispensable for vascular regression. We found Bik to be expressed in endothelial cells in lymph node sinuses, high endothelial venules, heart (endocardium), and blood vessels (Fig. 5). Interestingly, expression in blood vessels was found in endothelial cells of veins but not arteries (Fig. 5). Discrete lineages of endothelial cells populate arteries and veins, and the lineages can be distinguished during embryogenesis from the earliest stages of vascular development, with arterial endothelial cells expressing EfnB2 and venous endothelial cells expressing EphB4 (45). Thus, inherent differences between venous and arterial endothelium may explain why Bik is confined to the former.
Since Bcl-2 overexpression inhibits endothelial cell apoptosis (13, 15, 16), Bik may contribute to apoptosis of endothelial cells during vessel regression or angiogenesis during development. To assess the impact of Bik loss on endothelial-cell apoptosis, we compared the regression of hyaloid vessels in the eyes of bik-/- and wt mice. These vessels service the developing lens and retina during embryogenesis but become redundant following birth and soon regress by apoptosis (20, 24). The PM and VHP become vestigial by 12 to 16 days of age. TVL and HA regression is slower, but both are largely undetectable by 1 month. Bik expression was detected in the TVL and PM, as assessed by ß-galactosidase activity (Fig. 6A), but the PM, TVL, and VHP vessels did not persist in the eyes of adult bik-/- mice and seemed to be cleared at the normal rate (Fig. 6). Hence, if Bik regulates apoptosis in venous endothelial cells during either angiogenesis or vascular regression, it must do so in collaboration with other BH3-only proteins. By utilizing different BH3-only proteins for apoptosis induction, distinct populations of blood vessel endothelium might be eliminated in response to distinct developmental signals, thus fine-tuning the process of angiogenesis.
Loss of Bik does not rescue the defects caused by Bcl-2 deficiency. The cellular life/death decision is considered determined by the balance of prosurvival and proapoptotic Bcl-2 family molecules (9). In several cell types, loss of Bcl-2 favors death but the balance can be restored by concomitant loss of its antagonist Bim (3). Would the loss of any BH3-only protein restore the balance and allow normal cell survival in Bcl-2-deficient mice? Since Bik, like Bim, is expressed in hematopoietic organs and the kidneys, tissues in which Bcl-2 deficiency has disastrous consequences (Fig. 1), loss of Bik might be expected to compensate for loss of Bcl-2. However, our analysis of mice lacking both Bcl-2 and Bik revealed that loss of Bik failed to rescue the hematopoietic and renal defects seen in mice lacking Bcl-2 (Fig. 7 to 9). The failure to rescue the renal defects can probably be ascribed to the absence of detectable bik expression in the relevant cell types in the developing kidneys at the time (around E14.5) when apoptosis occurs in the absence of Bcl-2 (28). The failure to rescue the hematopoietic defect was more surprising, but there are several potential explanations. First, since the activity of BH3-only proteins is regulated in multiple ways (10, 35), the Bik expressed in the hematopoietic system might be sequestered in an inactive state. If so, its absence might not restore the balance. Second, the presence of other BH3-only proteins (particularly Bim and Puma) may compensate, so that Bik loss alone is not sufficient to restore the balance. Third, Bik may play no role in apoptosis regulation at all but, instead, may perform another unidentified function in these cells. This possibility seems unlikely, however, given that at least in co-overexpression studies, Bik interacts with prosurvival family members and antagonizes their activity (6, 17, 18).
The explanation that we favor is that despite interacting with many prosurvival Bcl-2 family members when overexpressed, endogenous Bik may preferentially interact with only a few of these proteins under physiological conditions. Therefore, our observations in the bik-/- bcl-2-/- mice could be explained if Bik and Bcl-2 do not oppose each other under physiological conditions but are part of separate, parallel pathways. In lymphocytes, for example, where Bim (and certain other BH3-only proteins) antagonize Bcl-2, Bik may instead antagonize other prosurvival Bcl-2 homologues (e.g., Bcl-w) that play a less dominant survival role in those cells (33, 34). If so, although the absence of Bik does not affect the imbalance created by Bcl-2 loss in lymphocytes, it might still alter apoptosis in certain cells where Bcl-w is the vital guardian (34) or in cells also lacking another BH3-only protein. The assumption here that certain BH3-only "ligands" possess a degree of specificity for their prosurvival "receptors" would render control of apoptosis by the Bcl-2 family even more sophisticated. Proof of this hypothesis awaits careful affinity measurements of the interactions of BH3-only proteins with their prosurvival partners and further genetic studies. Indeed, Bik appears to favor Bcl-xL and Bcl-w binding over Bcl-2 in vitro (Chen et al., unpublished data).
|
ACKNOWLEDGMENTS |
|---|
This work was supported by fellowships and grants from the NHMRC (Canberra), the Dr Josef Steiner Cancer Research Foundation (Bern), the Leukemia and Lymphoma Society, and the NIH (CA80188). L.C. is a recipient of The Cancer Council Victoria Postdoctoral Cancer Research Fellowship.
|
FOOTNOTES |
|---|
Present address: Centre for Early Human Development, Monash Institute for Reproduction and Development, Clayton, Victoria 3168, Australia.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Amanna, I. J., K. Clise-Dwyer, F. E. Nashold, K. A. Hoag, and C. E. Hayes. 2001. Cutting edge: A/WySnJ transitional B cells overexpress the chromosome 15 proapoptotic Blk gene and succumb to premature apoptosis. J. Immunol. 167:6069-6072.
3. Bouillet, P., S. Cory, L.-C. Zhang, A. Strasser, and J. M. Adams. 2001. Degenerative disorders caused by Bcl-2 deficiency are prevented by loss of its BH3-only antagonist Bim. Dev. Cell 1:645-653.[CrossRef][Medline]
4. Bouillet, P., D. Metcalf, D. C. S. Huang, D. M. Tarlinton, T. W. H. Kay, F. Köntgen, J. M. Adams, and A. Strasser. 1999. Proapoptotic Bcl-2 relative Bim required for certain apoptotic responses, leukocyte homeostasis, and to preclude autoimmunity. Science 286:1735-1738.
5. Bouillet, P., J. F. Purton, D. I. Godfrey, L.-C. Zhang, L. Coultas, H. Puthalakath, M. Pellegrini, S. Cory, J. M. Adams, and A. Strasser. 2002. BH3-only Bcl-2 family member Bim is required for apoptosis of autoreactive thymocytes. Nature 415:922-926.[CrossRef][Medline]
6. Boyd, J. M., G. J. Gallo, B. Elangovan, A. B. Houghton, S. Malstrom, B. J. Avery, R. G. Ebb, T. Subramanian, T. Chittenden, R. J. Lutz, and G. Chinnadurai. 1995. Bik, a novel death-inducing protein shares a distinct sequence motif with Bcl-2 family proteins and interacts with viral and cellular survival-promoting proteins. Oncogene 11:1921-1928.[Medline]
7. Cheng, E. H., M. C. Wei, S. Weiler, R. A. Flavell, T. W. Mak, T. Lindsten, and S. J. Korsmeyer. 2001. BCL-2, BCL-xL sequester BH3 domain-only molecules preventing BAX- and BAK-mediated mitochondrial apoptosis. Mol. Cell 8:705-711.[CrossRef][Medline]
8. Church, G. M., and W. Gilbert. 1984. Genomic sequencing. Proc. Natl. Acad. Sci. USA 81:1991-1995.
9. Cory, S., and J. M. Adams. 2002. The Bcl2 family: regulators of the cellular life-or-death switch. Nat. Rev. Cancer 2:647-656.[CrossRef][Medline]
10. Cory, S., D. C. S. Huang, and J. M. Adams. The Bcl-2 family: role in cell survival and oncogenesis. Oncogene, in press.
11. Coultas, L., D. C. S. Huang, J. M. Adams, and A. Strasser. 2002. Pro-apoptotic BH3-only Bcl-2 family members in vertebrate model organisms suitable for genetic experimentation. Cell Death Differ. 9:1163-1166.[CrossRef][Medline]
12. Cui, C., M. A. Wani, D. Wight, J. Kopchick, and P. J. Stambrook. 1994. Reporter genes in transgenic mice. Transgenic Res. 3:182-194.[CrossRef][Medline]
13. Dimmeler, S., and A. M. Zeiher. 2000. Endothelial cell apoptosis in angiogenesis and vessel regression. Circ. Res. 87:434-439.
14. Enders, A., P. Bouillet, H. Puthalakath, Y. Xu, D. M. Tarlinton, and A. Strasser. 2003. Loss of the pro-apoptotic BH3-only Bcl-2 family member Bim inhibits BCR stimulation-induced apoptosis and deletion of autoreactive B cells. J. Exp. Med. 198:1119-1126.
15. Fisher, S. A., B. L. Langille, and D. Srivastava. 2000. Apoptosis during cardiovascular development. Circ. Res. 87:856-864.
16. Gerber, H. P., V. Dixit, and N. Ferrara. 1998. Vascular endothelial growth factor induces expression of the antiapoptotic proteins Bcl-2 and A1 in vascular endothelial cells. J. Biol. Chem. 273:13313-13316.
17. Han, J., P. Sabbatini, and E. White. 1996. Induction of apoptosis by human Nbk/Bik, a BH3-containing protein that interacts with E1B 19K. Mol. Cell. Biol. 16:5857-5864.[Abstract]
18. Hegde, R., S. M. Srinivasula, M. Ahmad, T. Fernandes-Alnemri, and E. S. Alnemri. 1998. Blk, a BH3-containing mouse protein that interacts with Bcl-2 and Bcl-xL, is a potent death agonist. J. Biol. Chem. 273:7783-7786.
19. Huang, D. C. S., and A. Strasser. 2000. BH3-only proteins—essential initiators of apoptotic cell death. Cell 103:839-842.[CrossRef][Medline]
20. Ito, M., and M. Yoshioka. 1999. Regression of the hyaloid vessels and pupillary membrane of the mouse. Anat. Embryol. (Berlin) 200:403-411.[CrossRef][Medline]
21. Jeffers, J. R., E. Parganas, Y. Lee, C. Yang, J. Wang, J. Brennan, K. H. MacLean, J. Han, T. Chittenden, J. N. Ihle, P. J. McKinnon, J. L. Cleveland, and G. P. Zambetti. 2003. Puma is an essential mediator of p53-dependent and -independent apoptotic pathways. Cancer Cell 4:321-328.[CrossRef][Medline]
22. Jiang, A., and E. A. Clark. 2001. Involvement of Bik, a proapoptotic member of the Bcl-2 family, in surface IgM-mediated B cell apoptosis. J. Immunol. 166:6025-6033.
23. Lam, K. P., and K. Rajewsky. 1998. Rapid elimination of mature autoreactive B cells demonstrated by Cre-induced change in B cell antigen receptor specificity in vivo. Proc. Natl. Acad. Sci. USA 95:13171-13175.
24. Lang, R. A., and J. M. Bishop. 1993. Macrophages are required for cell death and tissue remodeling in the developing mouse eye. Cell 74:453-462.[CrossRef][Medline]
25. Lindsten, T., A. J. Ross, A. King, W. Zong, J. C. Rathmell, H. A. Shiels, E. Ulrich, K. G. Waymire, P. Mahar, K. Frauwirth, Y. Chen, M. Wei, V. M. Eng, D. M. Adelman, M. C. Simon, A. Ma, J. A. Golden, G. Evan, S. J. Korsmeyer, G. R. MacGregor, and C. B. Thompson. 2000. The combined functions of proapoptotic Bcl-2 family members Bak and Bax are essential for normal development of multiple tissues. Mol. Cell 6:1389-1399.[CrossRef][Medline]
26. Marsden, V., and A. Strasser. 2003. Control of apoptosis in the immune system: Bcl-2, BH3-only proteins and more. Annu. Rev. Immunol. 21:71-105.[CrossRef][Medline]
27. Matsuzaki, Y., K.-I. Nakayama, K. Nakayama, T. Tomita, M. Isoda, D. Y. Loh, and H. Nakauchi. 1997. Role of bcl-2 in the development of lymphoid cells from the hematopoietic stem cell. Blood 89:853-862.
28. Nagata, M., H. Nakauchi, K.-I. Nakayama, K. Nakayama, D. Loh, and T. Watanabe. 1996. Apoptosis during an early stage of nephrogenesis induces renal hypoplasia in bcl-2-deficient mice. Am. J. Pathol. 148:1601-1611.[Abstract]
29. Nakayama, K., K.-I. Nakayama, I. Negishi, K. Kuida, H. Sawa, and D. Y. Loh. 1994. Targeted disruption of bcl-2ß in mice: occurrence of gray hair, polycystic kidney disease, and lymphocytopenia. Proc. Natl. Acad. Sci. USA 91:3700-3704.
30. Newton, K., A. W. Harris, and A. Strasser. 2000. FADD/MORT1 regulates the pre-TCR checkpoint and can function as a tumour suppressor. EMBO J. 19:931-941.[CrossRef][Medline]
31. Ogilvy, S., D. Metcalf, L. Gibson, M. L. Bath, A. W. Harris, and J. M. Adams. 1999. Promoter elements of vav drive transgene expression in vivo throughout the hematopoietic compartment. Blood 94:1855-1863.
32. O'Reilly, L. A., L. Cullen, J. Visvader, G. Lindeman, C. Print, M. L. Bath, D. C. S. Huang, and A. Strasser. 2000. The pro-apoptotic BH3-only protein Bim is expressed in hemopoietic, epithelial, neuronal and germ cells. Am. J. Pathol. 157:449-461.
33. O'Reilly, L. A., C. Print, G. Hausmann, K. Moriishi, S. Cory, D. C. S. Huang, and A. Strasser. 2001. Tissue expression and subcellular localization of the pro-survival molecule Bcl-w. Cell Death Differ. 8:486-494.[CrossRef][Medline]
34. Print, C. G., K. L. Loveland, L. Gibson, T. Meehan, A. Stylianou, N. Wreford, D. de Kretser, D. Metcalf, F. Köntgen, J. M. Adams, and S. Cory. 1998. Apoptosis regulator Bcl-w is essential for spermatogenesis but appears otherwise redundant. Proc. Natl. Acad. Sci. USA 95:12424-12431.
35. Puthalakath, H., and A. Strasser. 2002. Keeping killers on a tight leash: transcriptional and post-translational control of the pro-apoptotic activity of BH3-only proteins. Cell Death Differ. 9:505-512.[CrossRef][Medline]
36. Schwenk, F., U. Baron, and K. Rajewsky. 1995. A cre-transgenic mouse strain for the ubiquitous deletion of loxP-flanked gene segments including deletion in germ cells. Nucleic Acids Res. 23:5080-5081.
37. Sentman, C. L., J. R. Shutter, D. Hockenbery, O. Kanagawa, and S. J. Korsmeyer. 1991. bcl-2 inhibits multiple forms of apoptosis but not negative selection in thymocytes. Cell 67:879-888.[CrossRef][Medline]
38. Strasser, A., A. W. Harris, and S. Cory. 1991. Bcl-2 transgene inhibits T cell death and perturbs thymic self-censorship. Cell 67:889-899.[CrossRef][Medline]
39. Strasser, A., L. O'Connor, and V. M. Dixit. 2000. Apoptosis signaling. Annu. Rev. Biochem. 69:217-245.[CrossRef][Medline]
40. Strasser, A., S. Whittingham, D. L. Vaux, M. L. Bath, J. M. Adams, S. Cory, and A. W. Harris. 1991. Enforced BCL2 expression in B-lymphoid cells prolongs antibody responses and elicits autoimmune disease. Proc. Natl. Acad. Sci. USA 88:8661-8665.
41. Suzuki, M., R. J. Youle, and N. Tjandra. 2000. Structure of Bax: coregulation of dimer formation and intracellular localization. Cell 103:645-654.[CrossRef][Medline]
42. Veis, D. J., C. M. Sorenson, J. R. Shutter, and S. J. Korsmeyer. 1993. Bcl-2-deficient mice demonstrate fulminant lymphoid apoptosis, polycystic kidneys, and hypopigmented hair. Cell 75:229-240.[CrossRef][Medline]
43. Verma, S., M. L. Budarf, B. S. Emanuel, and G. Chinnadurai. 2000. Structural analysis of the human pro-apoptotic gene Bik: chromosomal localization, genomic organization and localization of promoter sequences. Gene 254:157-162.[CrossRef][Medline]
44. Villunger, A., E. M. Michalak, L. Coultas, F. Müllauer, G. Böck, M. J. Ausserlechner, J. M. Adams, and A. Strasser. 2003. p53- and drug-induced apoptotic responses mediated by BH3-only proteins Puma and Noxa. Science 302:1036-1038.
45. Wang, H. U., Z. F. Chen, and D. J. Anderson. 1998. Molecular distinction and angiogenic interaction between embryonic arteries and veins revealed by ephrin-B2 and its receptor Eph-B4. Cell 93:741-753.[CrossRef][Medline]
46. Zong, W. X., T. Lindsten, A. J. Ross, G. R. MacGregor, and C. B. Thompson. 2001. BH3-only proteins that bind pro-survival Bcl-2 family members fail to induce apoptosis in the absence of Bax and Bak. Genes Dev. 15:1481-1486.
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||
