![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Molecular and Cellular Biology, February 2004, p. 1769-1778, Vol. 24, No. 4
0270-7306/04/$08.00+0 DOI: 10.1128/MCB.24.4.1769-1778.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
and Tamás Kiss*
Laboratoire de Biologie Moléculaire Eucaryote du CNRS, UMR5099, IFR109 CNRS, Université Paul Sabatier, 31062 Toulouse Cedex, France
Received 11 September 2003/ Returned for modification 21 October 2003/ Accepted 7 November 2003
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
A few box C/D and H/ACA snoRNPs, however, function in the nucleolytic processing of rRNAs. These snoRNPs, in contrast to the modification guide snoRNPs, are usually essential for cell viability (34, 49). The most extensively studied processing snoRNP, the U3 box C/D snoRNP, functions in the early cleavages of pre-rRNA at the A0, A1, and A2 sites (Fig. 1A). In the absence of U3, accumulation of mature 18S rRNA is inhibited both in Saccharomyces cerevisiae cells and Xenopus oocytes (21, 23, 37, 43). Likewise, depletion of yeast and Xenopus U14 (29, 30) or Xenopus U22 (51) box C/D snoRNAs abolishes 18S rRNA production. Two other snoRNAs, the Xenopus U8 box C/D (39) and the yeast 7-2/MRP (33) snoRNAs, were demonstrated to function in the processing of 5.8S and 25S rRNAs. With the exception of 7-2/MRP, which is an RNase P-related endoribonuclease (34, 49), none of the processing snoRNPs have been demonstrated to possess ribonucleolytic activities. The function that box C/D snoRNAs have in rRNA processing is underlined by formation of transient base pairing interactions with pre-rRNA sequences. These snoRNAs likely function as chaperones. They prevent premature or incorrect folding events and/or facilitate the formation of pre-rRNA structures competent for nucleolytic processing (3, 4, 20, 31, 38, 45).
Less is known about the function that box H/ACA snoRNPs have in rRNA processing. Thus far, it has only been unambiguously demonstrated that two box H/ACA snoRNAs, yeast snR10 and snR30, participate in rRNA processing. While yeast cells lacking snR10 are only slightly impaired in cell growth and in processing of 35S pre-rRNA, snR30 is essential for cell viability (2, 48). In the absence of snR30, cleavages of 35S pre-rRNA at the A0, A1, and A2 processing sites are inhibited, and, therefore, accumulation of mature 18S rRNA and its immediate precursor, the 20S pre-rRNA, is abolished (Fig. 1A) (36). Instead, the 35S pre-RNA is cleaved into 23S and 27SA3 products (Fig. 1B). While the 27SA3 RNA is processed into mature 5.8S and 25S rRNAs, the aberrant 23S product, encompassing the 18S rRNA, is rapidly degraded (36). In vitro processing studies also implicated the vertebrate U17/E1, U19/E2, and E3 box H/ACA snoRNAs in the early A0 cleavage of pre-rRNA (11, 35). However, these observations have been called into question by the finding that at least two of these snoRNAs, U19/E2 and E3, are genuine pseudouridylation guide snoRNAs that function in 28S modification (6, 14).
The molecular basis of the function of yeast snR30 in rRNA processing is unknown, and, so far, no functional homologues of snR30 have been identified in other organisms. In this study, we undertook a detailed structural and functional analysis of yeast snR30 to determine the sequence and structural elements supporting its function. We show that snR30 is an evolutionarily conserved snoRNA that is present in vertebrates, the fission yeast Schizosaccharomyces pombe, and the ciliate Tetrahymena thermophila. We demonstrate that all snR30 RNAs contain two short, highly conserved sequence motifs that are essential for the production of 18S rRNA.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
his3 URA3-GAL10::snR30) was obtained by crossing strains D190 and 578.SC (MAT
ade2 ilv1 leu2-3 met8 Trp1 his3 ura3-53 lys2) (kindly provided by J.-P. Gélugne, Laboratoire de Biologie Moléculaire Eucaryote du Centre National de la Recherche Scientifique, Toulouse, France). Expression plasmids were introduced into yeast cells by the lithium acetate transformation procedure (22). The following oligodeoxynucleotides were used in this study: 1, CAACCTGCAGACATC; 2, TCGAGATGTCTGCAGGTTGGTAC; 3, CTCGGTACCAACCATAGTCTCGTG; 4, CGTCTGCAGTATGGTTTTACC; 5, TGTGTGCATTTCTTGCTATTGGACGAGTTTAACTTAGATT; 6, CGTCCTACCGCAGTATCTTTCGAACACTATGAAATGACCC; 7, GTTTAGGAATATACTGCGGCTTAATCTCTTCCAGCCATTTGCGCTT; 8, AGATCATGCGTCCTACTTAATCTCTTCCAGCCATTTGCGCT; 9, ATAGGTACCATCATTCAATAAACTGA; 10, CCCGTTGACGAGTTTAACTTAGATTAAGCCGCAGTATATTCCTA; 11, CCCGTTGACGAGTTTAACTTCGCTTAAGCCGCGTATATT; 12, TTGCATGCCTGCAGTAGATCGTTACCCAAATGATCATGG; 13, ATAGGTACCATCATGAATCTGAAGTTAC; 14, ATACTCGAGAAATGTCAACTGTATGGTT; 15, AGATGTCTGCAGTATGGTTT; 16, TTGTGTCTGGACCTGGTGAG; 17, ACACCCTCTATGTCTCTTCAC; 18, TTAAGCGCAGGCCCGGCTGG; 19, NNTGTATATTCCTANP. Plasmid constructs. Construction of the pFL45/SNR yeast expression vector, containing the promoter and terminator regions of the yeast SNR5 gene, has been described (5). To facilitate the cloning of full-length snR30, oligonucleotides 1 and 2 were annealed and inserted into the KpnI and XhoI sites of pFL45/SNR. The resulting pFL45/SNRP construct carried 12 3'-terminal nucleotides of snR30, including the PstI site at position 601. The coding region of the yeast SNR30 gene from position 1 to 602 was amplified by PCR by using yeast genomic DNA as a template and oligonucleotides 3 and 4 as 5'- and 3'-specific primers, respectively. The resulting fragment was digested with KpnI and PstI and inserted into the same sites of the pBluescript (Stratagene) cloning vector, resulting in pBS-R30. To obtain pFL45/SNR/R30, the KpnI and PstI fragment of pBS-R30 was inserted into the same sites of pFL45/SNRP. Construction of pFL45/SNR/R30-d5' and pFL45/SNR/R30m1 was performed by a two-step PCR using pBS-R30 as a template. The 3' half of snR30 was amplified with oligonucleotides 5 (R30-d5') and 6 (R30m1) as 5'-end-specific primers and oligonucleotide 4 as a common 3'-specific primer. The resulting PCR products were used as megaprimers in the second PCR together with oligonucleotide 3 as a 5'-specific primer. The amplified fragments were digested with KpnI and PstI and inserted into the same sites of pFL45/SNRP. A similar approach was used to construct pFL45/SNR/R5-R30S and pFL45/SNR/R5-R30L except that, in the first PCR, the 5' half of snR5 RNA was amplified with oligonucleotides 7 (R5-R30S) and 8 (R5-R30L) as 3'-specific primers, with oligonucleotide 9 as a 5'-specific primer and yeast genomic DNA as a template. The PCR products were used as megaprimers in the second amplification reaction, which also contained oligonucleotide 4 as a 3' primer and pBS-R30 as a template. The amplified fragments were cloned into the KpnI and PstI sites of pFL45/SNRP. To generate pFL45/SNR/R30-dIH and pFL45/SNR/R30-H, fragments of the SNR30 gene were amplified by using oligonucleotide 4 as a common 3' primer and oligonucleotides 10 and 11 as 5' primers, respectively. After digestion with HincII and PstI, the resulting PCR fragments were used to replace the HincII-PstI fragment of pFL45/SNR/R30. To construct pFL45/SNR/R30m2, the coding region of snR30 was amplified by using oligonucleotide 3 as a 5' primer and a mutagenic 3' primer (oligonucleotide 12). The PCR product was digested with KpnI and PstI and cloned into the same sites of pFL45/SNRP. To generate pFL45/SNR/U17pombe, the coding region of the S. pombe U17 snoRNA gene was amplified by using oligonucleotide 13 as a 5'-specific primer, oligonucleotide 14 as a 3' primer, and genomic DNA as a template. After digestion with KpnI and XhoI, the resulting PCR fragment was cloned into pFL45/SNRP.
RNA analysis. Cellular RNA from yeasts S. cerevisiae and S. pombe was isolated by the guanidine thiocyanate-phenol-chloroform extraction method (50). T. thermophila cellular RNA was kindly provided by K. Collins (University of California). For Northern analysis of rRNAs, total cellular RNA corresponding to 1.8 x 107 exponentially growing yeast cells was size fractionated on 1.2% agarose-formaldehyde gel. For analysis of snoRNAs, about 5 µg of total RNA was fractionated on 6% denaturing polyacrylamide gels. RNAs were electroblotted (acrylamide gels) or transferred by capillary blotting (agarose gels) onto a Hybond-N nylon membrane (Amersham Biosciences). The filters were probed with terminally labeled oligonucleotides specific for the snR30 (oligonucleotide 15), 18S (oligonucleotide 16), 25S (oligonucleotide 17), or 20S (oligonucleotide 18) RNA. RNase A/T1 mapping was described previously (17). To generate an antisense RNA probe for mapping snR30, snR30m1, and snR30m2 RNAs, the pBS/R30 recombinant plasmid was linearized by XhoI and used as a template for synthesis of an internally labeled RNA probe by the T3 RNA polymerase.
The 3'-terminal portions of S. pombe and T. thermophila U17 snoRNAs were cloned by the oligonucleotide ligation-PCR amplification procedure (26), except that a degenerate oligonucleotide (19) was used as an upstream primer. Further upstream sequences of the S. pombe and T. thermophila U17 snoRNAs were determined by dideoxy sequencing, using total RNA as a template and 5'-end-labeled oligonucleotides complementary to the 3'-terminal sequences of the S. pombe (oligonucleotide 20) and T. thermophila (oligonucleotide 21) U17 snoRNAs as primers for avian myeloblastosis virus reverse transcriptase.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
|
To test whether the 5' leader or the proximal part of the 5' hairpin of snR30 contains functionally important elements, a chimeric snR5-snR30 (R5-R30S) RNA was created (Fig. 3B). The R5-R30S RNA contained the 5'-terminal half of the yeast snR5 box H/ACA pseudouridylation guide snoRNA (A1-G85), the hinge region (A390 to G398), and the 3'-terminal hairpin (C530 to U608) of snR30. When placed under the control of the SNR5 promoter in the pFL45/SNR expression vector, the chimeric R5-R30S RNA was efficiently expressed in the GAL::snR30 test strain (Fig. 3D, lane 6) and, more importantly, supported cell growth on glucose (Fig. 3C). However, compared to that of the control R30 strain, expressing wild-type snR30, the growth rate of the R5-R30 strain was reduced by about 40% (Fig. 3C and data not shown). Since yeast small nuclear and nucleolar RNAs are generally much longer than their vertebrate counterparts (18), we hypothesized that the decreased functional efficiency of the R5-R30S RNA might result from its reduced molecular mass rather than the lack of important elements. To test this assumption, the inserted hairpin element of snR30 that had been demonstrated to lack functionally important elements (Fig. 3C, R30-dIH) was reintroduced into the R5-R30S RNA. The resulting R5-R30L chimeric RNA, which contained the 5'-terminal region of snR5 (A1-G84) and the 3' half of snR30 (A390 to U608), accumulated in GAL::snR30 cells (Fig. 3D, lane 7). When grown on glucose, the GAL::snR30 cells expressing R5-R30L had a growth rate that was highly comparable to that of the control R30 cells (Fig. 3C), indicating that increasing the molecular mass of R5-R30S could improve its functional efficacy. In conclusion, the results of the deletion analysis of snR30, taken together with the finding that R5-R30S chimeric RNA can support cell growth, indicate that all the elements essential for cell viability are contained within the 3'-terminal hairpin of snR30.
snR30 is a ubiquitous RNA. The notion that the 3'-terminal hairpin of snR30 contains the functionally important elements that are likely conserved during evolution prompted us to undertake a closer inspection of the 3' hairpins of all known box H/ACA snoRNAs. We noticed that the 3' hairpin of the human U17 snoRNA contains two short sequence motifs, called m1 (141-AUAUUCCUA-149) and m2 (188-AAACCAU-194) (Fig. 4A), which are also present in yeast snR30 (Fig. 3B). The nucleotide sequences of U17 for a variety of vertebrate species, including four mammal, one bird, eight reptile, one amphibian, and four fish species, have been determined (7-9, 26, 41, 44). We found that perfect copies of the m1 and m2 motifs are present in the 3'-terminal hairpin of all vertebrate U17 snoRNAs. In Fig. 4A, the computer-predicted structures of the 3'-terminal hairpins of Caretta caretta (turtle), Xenopus laevis (frog), and Fugu rubripes (fish) U17 snoRNAs are shown as representative examples.
|
Upon a detailed scrutiny of all known U17/snR30 snoRNAs, including the new S. pombe and T. thermophila RNAs, it became apparent that not only the sequences but also the positions of the m1 and m2 motifs are strictly conserved during evolution. The m1 and m2 motifs occupy the proximal (lower) part of an internal stem-loop-stem structure within the 3' hairpins of all U17/snR30 snoRNAs (Fig. 4). While the first 2 residues of the m1 motif (AU) and the last 2 nucleotides of the m2 motif (UA) are predicted to base pair to each other, the other conserved nucleotides of the m1 and m2 motifs occupy unpaired positions in the opposite strands of the internal loop. We also noticed that the distance between the conserved m1-m2 structural motif and the ACA box of U17/snR30 snoRNAs is perfectly conserved; they are separated always by 7 nucleotides. Taken together, these observations led us to conclude that U17/snR30 is an evolutionarily conserved snoRNA that is present in many, if not all, eukaryotic organisms.
S. pombe U17 snoRNA can restore depletion of snR30 in yeast S. cerevisiae. A database search revealed that the nucleotide sequence of the S. pombe U17 gene had been already determined to be part of chromosome 1 (GenBank accession number AL357232). Primer extension analysis showed that the S. pombe U17 snoRNA is composed of 325 nucleotides and, as predicted by computer modeling, it folds into a 5'-hairpin hinge-internal hairpin-3'-hairpin structure highly reminiscent of the architecture of the yeast S. cerevisiae snR30 (Fig. 5A). Inspired by the significant structural conservation of U17/snR30, we tested whether the S. pombe U17 snoRNA could restore the growth of the GAL::snR30 test strain on glucose-containing medium when accumulation of snR30 is inhibited. The coding region of the S. pombe U17 gene was amplified by PCR and inserted into the pFL45/SNR expression vector (Fig. 3A). Upon transformation of the resulting pFL45/SNR/U17pombe expression plasmid into the GAL::snR30 strain, the S. pombe U17 RNA (U17pombe) was faithfully expressed (Fig. 5B). When streaked on glucose-containing medium, GAL::snR30 cells expressing U17pombe or yeast snR30 showed similar growth properties (Fig. 5C), demonstrating that the fission yeast S. pombe U17 snoRNA can fully restore the function of snR30 in S. cerevisiae. In a similar experiment, the human U17a snoRNA, though it accumulated efficiently, failed to restore the growth of GAL::snR30 cells on glucose (data not shown; see also Discussion).
|
|
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Secondary structure modeling demonstrated that all U17/snR30 snoRNAs fold into the consensus hairpin-hinge-hairpin-tail structure of box H/ACA snoRNAs, except that they carry an additional internal hairpin located before the 3'-terminal hairpin of the RNA (Fig. 2, 4, and 5 and data not shown). As indicated by deletion analysis of yeast snR30, neither the 5'-terminal nor the internal hairpin of U17/snR30 contains functionally important elements (Fig. 3). Consistent with this notion, both the nucleotide compositions and sizes of these hairpins show a high level of variation during evolution. Expression of an snR5-snR30 chimeric RNA (R5-R30S) demonstrated that the 3'-terminal hairpin of snR30 carries all the elements that are critical for cell viability (Fig. 3). The 3' hairpin of each U17/snR30 RNA carries the conserved m1 (AUAUUCCUA) and m2 (AAACCAU) sequence elements, which occupy an invariant position in the proximal (lower) part of an internal loop, exactly 7 nucleotides upstream to the ACA box of the RNA (Fig. 4). Mutational analyses demonstrated that the m1 and m2 motifs are crucial for cell viability and 18S production (Fig. 6 and 7). Apart from the essential m1 and m2 elements, the nucleotide sequence of the 3'-terminal hairpin of U17/snR30 RNAs shows no significant conservation, indicating that it contains no additional functionally important sequence elements.
One possibility is that the m1 and m2 motifs might function as specific protein-binding signals. Besides the Cbf5p/dyskerin (65 kDa), Gar1p (25 kDa), Nhp2p (22 kDa), and Nop10p (10 kDa) box H/ACA snoRNP core proteins (1, 16, 19, 53), purified yeast snR30 snoRNP was reported to be associated with three additional proteins of 36, 46, and 48 kDa (32). However, in vitro reconstitution experiments performed with the human U17 snoRNA could detect only four U17-associated proteins, which, based on their apparent molecular masses, likely represent the human Cbf5p/dyskerin (60 kDa), Gar1p (29 kDa), Nhp2p (23 kDa), and Nop10p (14 kDa) box H/ACA core proteins (10). Notably, in vitro reconstitution studies also revealed that the 3'-terminal hairpin of U17 could be packaged into a stable snoRNP particle (10). In marked contrast, full-length snoRNAs were required for the assembly of the human U64 and U19 box H/ACA pseudouridylation guide snoRNPs. This observation strongly suggests that the 3'-terminal hairpin of U17 has specific structural and functional features which distinguish this RNA from the authentic pseudouridylation guide snoRNAs. Apparently, further experiments are required to clarify whether the m1 and m2 motifs of U17/snR30 can bind specific proteins.
The high degree of evolutionary conservation of the m1 and m2 motifs might also indicate that they represent antisense sequence recognition elements. In fact, the overwhelming majority of box H/ACA snoRNAs function as guide RNAs which select ribosomal pseudouridylation sites by forming transient base pairing interactions with complementary rRNA sequences. However, the fact that the m1 and m2 elements occupy the proximal part of the putative pseudouridylation loop of U17/snR30 rather than its distal part, as would have been expected for a genuine pseudouridylation guide RNA (14), strongly argues against a modification guide function for U17/snR30. Moreover, human and yeast rRNAs lack sequences with known pseudouridylation sites that could form a canonical rRNA-guide RNA interaction with U17/snR30. At the moment, however, we cannot unambiguously rule out the formal possibility that U17/snR30 directs pseudouridylation of another, not yet identified RNA that plays a crucial role in pre-rRNA processing. Currently, we are testing whether the mouse U17 snoRNA is capable of directing pseudouridylation of appropriately designed artificial substrate RNAs expressed in the nucleoli of mouse cells.
According to another, more likely scenario, U17/snR30 might function as a molecular chaperone that facilitates the correct folding of pre-rRNAs, as has been proposed for the U3, U14, and U8 box C/D snoRNAs (see the introduction). Previous psoralen photo-cross-linking experiments found the human U17 (E1) and yeast snR30 snoRNAs to be associated with large pre-rRNAs (36, 40). Although vertebrate and yeast pre-rRNAs lack perfect, evolutionarily conserved complementarities to the m1 and m2 motifs of U17/snR30, numerous shorter, either perfect or imperfect base pairing interactions could be formed between the m1 and m2 motifs of U17/snR30 and pre-rRNA sequences (data not shown). This also implies that the m1 and m2 elements might form functionally important hydrogen bonding interactions with distinct regions of the pre-rRNA. Notably, alteration of the m1 or the m2 motif of snR30 gave rise to slightly different pre-rRNA processing pathways (Fig. 7). In the absence of an intact m1 motif, processing of 35S pre-rRNA is delayed, while alteration of the m2 motif results in an increased accumulation of the aberrant 23S processing intermediate. Moreover, we have recently found that the viability of yeast cells expressing snR30m2, but not snR30m1, could be restored by coexpression of the human U17a snoRNA (our unpublished data). This observation, besides demonstrating that the human U17 snoRNA is indeed the functional homologue of yeast snR30, provides further support for the assumption that the m1 and m2 elements might work, at least to some extent, independently from one another. To identify the putative sites of interaction between U17/snR30 and pre-rRNA, we are currently performing a detailed cross-linking analyses of human and yeast pre-rRNAs.
Thus far, most box C/D and H/ACA snoRNAs implicated in rRNA processing have been assumed to be unique to either vertebrates (U8 and U22) or the yeast S. cerevisiae (snR30 and snR10). Only the U3 and U14 box C/D snoRNAs have been found in both yeast and metazoan cells. Demonstration that the U17/snR30 box H/ACA snoRNA is also present in vertebrates, the fission yeast S. pombe, and the protozoan T. thermophila further supports the idea that the snoRNA-assisted processing mechanism of eukaryotic pre-rRNAs has an ancient evolutionary origin. More importantly, determination of the functionally essential elements of U17/snR30 will greatly facilitate the future dissection of the molecular mechanism underlying the function of this snoRNA in pre-rRNA processing.
|
ACKNOWLEDGMENTS |
|---|
V.A. was funded by the Deutscher Akademischer Austauschdienst and Fondation pour la Recherche Médicale. P.F. was funded by CNR-NATO and CNRS. Our work was supported by grants from la Ligue Nationale contre le Cancer, Association pour le Recherche contre le Cancer, and MURST (RBNE015MPB and RBNE01KXC9).
|
FOOTNOTES |
|---|
Present address: Department of Genetics and Molecular Biology, Istituto di Biologia e Patologia Molecolari, C.N.R. Rome, Italy.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Bally, M., J. Hughes, and G. Cesareni. 1988. SnR30: a new, essential small nuclear RNA from Saccharomyces cerevisiae. Nucleic Acids Res. 16:5291-5303.
3. Beltrame, M., and D. Tollervey. 1995. Base pairing between U3 and the pre-ribosomal RNA is required for 18S rRNA synthesis. EMBO J. 14:4350-4356.[Medline]
4. Borovjagin, A. V., and S. A. Gerbi. 2000. The spacing between functional cis-elements of U3 snoRNA is critical for rRNA processing. J. Mol. Biol. 300:57-74.[CrossRef][Medline]
5. Bortolin, M. L., P. Ganot, and T. Kiss. 1999. Elements essential for accumulation and function of small nucleolar RNAs directing site-specific pseudouridylation of ribosomal RNAs. EMBO J. 18:457-469.[CrossRef][Medline]
6. Bortolin, M. L., and T. Kiss. 1998. Human U19 intron-encoded snoRNA is processed from a long primary transcript that possesses little potential for protein coding. RNA 4:445-454.[Abstract]
7. Cecconi, F., C. Crosio, P. Mariottini, G. Cesareni, M. Giorgi, S. Brenner, and F. Amaldi. 1996. A functional role for some Fugu introns larger than the typical short ones: the example of the gene coding for ribosomal protein S7 and snoRNA U17. Nucleic Acids Res. 24:3167-3172.
8. Cecconi, F., P. Mariottini, F. Loreni, P. Pierandrei-Amaldi, N. Campioni, and F. Amaldi. 1994. U17XS8, a small nucleolar RNA with a 12 nt complementarity to 18S rRNA and coded by a sequence repeated in the six introns of Xenopus laevis ribosomal protein S8 gene. Nucleic Acids Res. 22:732-741.
9. Cervelli, M., F. Cecconi, M. Giorgi, F. Annesi, M. Oliverio, and P. Mariottini. 2002. Comparative structure analysis of vertebrate U17 small nucleolar RNA (snoRNA). J. Mol. Evol. 54:166-179.[CrossRef][Medline]
10. Dragon, F., V. Pogacic, and W. Filipowicz. 2000. In vitro assembly of human H/ACA small nucleolar RNPs reveals unique features of U17 and telomerase RNAs. Mol. Cell. Biol. 20:3037-3048.
11. Enright, C. A., E. S. Maxwell, G. L. Eliceiri, and B. Sollner-Webb. 1996. 5'ETS rRNA processing facilitated by four small RNAs: U14, E3, U17, and U3. RNA 2:1094-1099.[Abstract]
12. Fatica, A., and D. Tollervey. 2002. Making ribosomes. Curr. Opin. Cell Biol. 14:313-318.[CrossRef][Medline]
13. Filipowicz, W., and V. Pogacic. 2002. Biogenesis of small nucleolar ribonucleoproteins. Curr. Opin. Cell Biol. 14:319-327.[CrossRef][Medline]
14. Ganot, P., M. L. Bortolin, and T. Kiss. 1997. Site-specific pseudouridine formation in preribosomal RNA is guided by small nucleolar RNAs. Cell 89:799-809.[CrossRef][Medline]
15. Ganot, P., M. Caizergues-Ferrer, and T. Kiss. 1997. The family of box ACA small nucleolar RNAs is defined by an evolutionarily conserved secondary structure and ubiquitous sequence elements essential for RNA accumulation. Genes Dev. 11:941-956.
16. Girard, J. P., H. Lehtonen, M. Caizergues-Ferrer, F. Amalric, D. Tollervey, and B. Lapeyre. 1992. GAR1 is an essential small nucleolar RNP protein required for pre-rRNA processing in yeast. EMBO J. 11:673-682.[Medline]
17. Goodall, G. J., K. Wiebauer, and W. Filipowicz. 1990. Analysis of pre-mRNA processing in transfected plant protoplasts. Methods Enzymol. 181:148-161.[Medline]
18. Guthrie, C., and B. Patterson. 1988. Spliceosomal snRNAs. Annu. Rev. Genet. 22:387-419.[CrossRef][Medline]
19. Henras, A., Y. Henry, C. Bousquet-Antonelli, J. Noaillac-Depeyre, J. P. Gelugne, and M. Caizergues-Ferrer. 1998. Nhp2p and Nop10p are essential for the function of H/ACA snoRNPs. EMBO J. 17:7078-7090.[CrossRef][Medline]
20. Hughes, J. M. 1996. Functional base-pairing interaction between highly conserved elements of U3 small nucleolar RNA and the small ribosomal subunit RNA. J. Mol. Biol. 259:645-654.[CrossRef][Medline]
21. Hughes, J. M., and M. Ares, Jr. 1991. Depletion of U3 small nucleolar RNA inhibits cleavage in the 5' external transcribed spacer of yeast pre-ribosomal RNA and impairs formation of 18S ribosomal RNA. EMBO J. 10:4231-4239.[Medline]
22. Ito, H., Y. Fukuda, K. Murata, and A. Kimura. 1983. Transformation of intact yeast cells treated with alkali cations. J. Bacteriol. 153:163-168.
23. Kass, S., K. Tyc, J. A. Steitz, and B. Sollner-Webb. 1990. The U3 small nucleolar ribonucleoprotein functions in the first step of preribosomal RNA processing. Cell 60:897-908.[CrossRef][Medline]
24. Kiss, T. 2001. Small nucleolar RNA-guided post-transcriptional modification of cellular RNAs. EMBO J. 20:3617-3622.[CrossRef][Medline]
25. Kiss, T. 2002. Small nucleolar RNAs: an abundant group of noncoding RNAs with diverse cellular functions. Cell 109:145-148.[CrossRef][Medline]
26. Kiss, T., and W. Filipowicz. 1993. Small nucleolar RNAs encoded by introns of the human cell cycle regulatory gene RCC1. EMBO J. 12:2913-2920.[Medline]
27. Kressler, D., P. Linder, and J. de La Cruz. 1999. Protein trans-acting factors involved in ribosome biogenesis in Saccharomyces cerevisiae. Mol. Cell. Biol. 19:7897-7912.
28. Lafontaine, D. L., C. Bousquet-Antonelli, Y. Henry, M. Caizergues-Ferrer, and D. Tollervey. 1998. The box H + ACA snoRNAs carry Cbf5p, the putative rRNA pseudouridine synthase. Genes Dev. 12:527-537.
29. Lange, T. S., A. Borovjagin, E. S. Maxwell, and S. A. Gerbi. 1998. Conserved boxes C and D are essential nucleolar localization elements of U14 and U8 snoRNAs. EMBO J. 17:3176-3187.[CrossRef][Medline]
30. Li, H. D., J. Zagorski, and M. J. Fournier. 1990. Depletion of U14 small nuclear RNA (snR128) disrupts production of 18S rRNA in Saccharomyces cerevisiae. Mol. Cell. Biol. 10:1145-1152.
31. Liang, W. Q., and M. J. Fournier. 1995. U14 base-pairs with 18S rRNA: a novel snoRNA interaction required for rRNA processing. Genes Dev. 9:2433-2443.
32. Lubben, B., P. Fabrizio, B. Kastner, and R. Luhrmann. 1995. Isolation and characterization of the small nucleolar ribonucleoprotein particle snR30 from Saccharomyces cerevisiae. J. Biol. Chem. 270:11549-11554.
33. Lygerou, Z., C. Allmang, D. Tollervey, and B. Seraphin. 1996. Accurate processing of a eukaryotic precursor ribosomal RNA by ribonuclease MRP in vitro. Science 272:268-270.[Abstract]
34. Maxwell, E. S., and M. J. Fournier. 1995. The small nucleolar RNAs. Annu. Rev. Biochem. 64:897-934.[CrossRef][Medline]
35. Mishra, R. K., and G. L. Eliceiri. 1997. Three small nucleolar RNAs that are involved in ribosomal RNA precursor processing. Proc. Natl. Acad. Sci. USA 94:4972-4977.
36. Morrissey, J. P., and D. Tollervey. 1993. Yeast snR30 is a small nucleolar RNA required for 18S rRNA synthesis. Mol. Cell. Biol. 13:2469-2477.
37. Mougey, E. B., L. K. Pape, and B. Sollner-Webb. 1993. A U3 small nuclear ribonucleoprotein-requiring processing event in the 5' external transcribed spacer of Xenopus precursor rRNA. Mol. Cell. Biol. 13:5990-5998.
38. Peculis, B. A. 1997. The sequence of the 5' end of the U8 small nucleolar RNA is critical for 5.8S and 28S rRNA maturation. Mol. Cell. Biol. 17:3702-3713.[Abstract]
39. Peculis, B. A., and J. A. Steitz. 1993. Disruption of U8 nucleolar snRNA inhibits 5.8S and 28S rRNA processing in the Xenopus oocyte. Cell 73:1233-1245.[CrossRef][Medline]
40. Rimoldi, O. J., B. Raghu, M. K. Nag, and G. L. Eliceiri. 1993. Three new small nucleolar RNAs that are psoralen cross-linked in vivo to unique regions of pre-rRNA. Mol. Cell. Biol. 13:4382-4390.
41. Ruff, E. A., O. J. Rimoldi, B. Raghu, and G. L. Eliceiri. 1993. Three small nucleolar RNAs of unique nucleotide sequences. Proc. Natl. Acad. Sci. USA 90:635-638.
42. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
43. Savino, R., and S. A. Gerbi. 1990. In vivo disruption of Xenopus U3 snRNA affects ribosomal RNA processing. EMBO J. 9:2299-2308.[Medline]
44. Selvamurugan, N., O. H. Joost, E. S. Haas, J. W. Brown, N. J. Galvin, and G. L. Eliceiri. 1997. Intracellular localization and unique conserved sequences of three small nucleolar RNAs. Nucleic Acids Res. 25:1591-1596.
45. Sharma, K., and D. Tollervey. 1999. Base pairing between U3 small nucleolar RNA and the 5' end of 18S rRNA is required for pre-rRNA processing. Mol. Cell. Biol. 19:6012-6019.
46. Sherman, F. 1991. Getting started with yeast. Methods Enzymol. 194:3-23.[CrossRef][Medline]
47. Terns, M. P., and R. M. Terns. 2002. Small nucleolar RNAs: versatile trans-acting molecules of ancient evolutionary origin. Gene Expr. 10:17-39.[Medline]
48. Tollervey, D. 1987. A yeast small nuclear RNA is required for normal processing of pre-ribosomal RNA. EMBO J. 6:4169-4175.[Medline]
49. Tollervey, D., and T. Kiss. 1997. Function and synthesis of small nucleolar RNAs. Curr. Opin. Cell Biol. 9:337-342.[CrossRef][Medline]
50. Tollervey, D., and I. W. Mattaj. 1987. Fungal small nuclear ribonucleoproteins share properties with plant and vertebrate U-snRNPs. EMBO J. 6:469-476.[Medline]
51. Tycowski, K. T., M. D. Shu, and J. A. Steitz. 1994. Requirement for intron-encoded U22 small nucleolar RNA in 18S ribosomal RNA maturation. Science 266:1558-1561.
52. Venema, J., and D. Tollervey. 1999. Ribosome synthesis in Saccharomyces cerevisiae. Annu. Rev. Genet. 33:261-311.[CrossRef][Medline]
53. Watkins, N. J., A. Gottschalk, G. Neubauer, B. Kastner, P. Fabrizio, M. Mann, and R. Luhrmann. 1998. Cbf5p, a potential pseudouridine synthase, and Nhp2p, a putative RNA-binding protein, are present together with Gar1p in all H BOX/ACA-motif snoRNPs and constitute a common bipartite structure. RNA 4:1549-1568.[Abstract]
54. Yu, Y. T., E. C. Scharl, S. C. M., and J. A. Steitz. 1999. The growing world of small nuclear ribonucleoproteins, p. 487-524. In R. F. Gesteland, T. R. Cech, and J. F. Atkins (ed.), The RNA world. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
55. Zuker, M., D. H. Mathews, and D. H. Turner. 1999. Algorithms and thermodynamics for RNA secondary structure prediction: a practical guide, p. 11-43. In J. Barciszewski and B. F. C. Clark (ed.), RNA biochemistry and bio/technology. Kluwer Academic Publishers, Dordrecht, The Netherlands.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|
