Previous Article | Next Article ![]()
Molecular and Cellular Biology, April 2004, p. 2605-2613, Vol. 24, No. 7
0270-7306/04/$08.00+0 DOI: 10.1128/MCB.24.7.2605-2613.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Division of Basic Sciences, Fred Hutchinson Cancer Research Center, Seattle, Washington 98109,1 Molecular and Cellular Biology Program, Fred Hutchinson Cancer Research Center and University of Washington, Seattle, Washington 981952
Received 9 October 2003/ Returned for modification 9 November 2003/ Accepted 11 January 2004
|
|
|---|
) complex, and Dls1p is homologous to another pol
subunit, Dpb3p. Therefore, these small histone fold proteins may fulfill functions that are required for both pol
and Isw2 complexes. We characterized the role of Dls1p in known roles of the Isw2 complex in vivo. Transcriptional analyses reveal that the Isw2 complex requires Dls1p to various degrees at a wide variety of loci in vivo. Consistent with this, Dls1p is required for Isw2-dependent chromatin remodeling in vivo, although the requirement for this protein varies among Isw2 targets. Dls1p is likely required for functions of the Isw2 complex at steps subsequent to its interaction with chromatin, since a dls1 mutation does not affect cross-linking of Isw2 with chromatin. |
|
|---|
Biochemical and genetic studies have identified several ATP-dependent chromatin-remodeling complexes from a wide variety of eukaryotic organisms (4, 31, 45). These complexes exhibit numerous biochemical activities, including ATPase activity, nucleosome sliding activity, and nucleosome assembly activity, and the ability to modify histone-DNA contacts. They are grouped into different classes according to the ATPase subunit found in each complex, including SWI/SNF, ISWI, CHD1, and INO80. The ISWI class of ATPases has been evolutionarily well conserved. It has been identified in mammals (5, 6, 34, 39), Xenopus laevis (10, 18, 26, 30), Drosophila melanogaster (21, 41, 43), and the budding yeast Saccharomyces cerevisiae (42). This high degree of evolutionary conservation strongly argues for critical functions of ISWI chromatin-remodeling factors in vivo.
The biological functions of some ISWI chromatin-remodeling factors have just begun to be uncovered. In Drosophila, the ISWI gene is essential for cell viability, and ISWI mutant embryos die at late larval or early pupal stages (11). One of the most striking phenotypes of ISWI mutants is a massive deformation of the X chromosome in male flies (11), which requires the presence of an active dosage compensation complex (8). NURF, one of three ISWI-containing complexes in Drosophila, is responsible for both cell viability and maintenance of chromosome architecture in males (3). The connection between ISWI remodeling factors and higher-order chromatin structure appears to be evolutionarily conserved. In mammalian cells, ISWI-containing complexes are targeted to heterochromatin (6) and are required for its replication (7) and silencing (38). In addition, ISWI complexes are implicated in loading of cohesin complex (19) and functions of matrix association regions (46).
ISWI-containing CHRAC complexes in higher eukaryotes contain two small histone fold proteins that are evolutionarily conserved (9, 34). Recent studies revealed that the human CHRAC and DNA polymerase epsilon (pol
) complexes share a small histone fold subunit (28, 34). This finding led to the proposal that functions of ISWI complexes in heterochromatin may be mediated by the subunits containing histone fold motifs (7). However, the roles of these histone fold proteins in vivo have not been identified.
Our laboratory has shown that one of the two ISWI proteins in yeast, Isw2p, forms a complex that is required for repression of early meiotic genes during mitotic cell growth (17). Our group further demonstrated that Isw2 and Rpd3-Sin3 histone deacetylase complexes collaborate to repress a wide variety of genes (13, 17). In addition, the Isw2 complex is required for repression of Mata-specific genes in Mat
cells (40; M. E. Gelbart and T. Tsukiyama, unpublished data). Consistent with these results in yeast, Drosophila ISWI protein and RNA polymerase II localize in a mutually exclusive manner on polytene chromosomes (11), and a mammalian ISWI complex, No-RC, represses ribosomal DNA transcription (48). Isw1p, another ISWI protein in yeast, forms two complexes (44) that affect nucleosome position at a number of loci in vivo (25) and are involved in transcriptional termination together with the Isw2 complex and another chromatin-remodeling factor, Chd1p (1).
In this work, we describe the identification of two new subunits of the Isw2 complex, Dpb4p and Yjl065cp (named Dls1p). Dpb4p has previously been identified as a nonessential subunit of pol
, whereas Dls1p has not been previously characterized. However, Dls1p is homologous to another nonessential subunit of pol
, Dpb3p. Dpb4p and Dls1p have histone fold motifs and are homologous to the smallest subunits of CHRAC complexes in higher eukaryotes. Our studies reveal that Dls1p plays critical roles in Isw2-dependent repression of a wide variety of genes in vivo, including early meiotic genes. However, Dls1p is only partially required for repression of some genes, including POT1, and is dispensable for repression of Mata-specific genes in Mat
cells. Chromatin analyses reveal that Dls1p is required for formation of normal repressive chromatin structure at each of these loci, although the degree to which the Isw2 complex depends on Dls1p varies among Isw2 targets. Chromatin immunoprecipitation analyses suggest that Dls1p is likely required for functions of Isw2 at steps subsequent to its interaction with chromatin.
|
|
|---|
subunits as previously described: three-FLAG (16), TAP (36), six-hemagglutinin (HA) (27), and 13-Myc (29) tags. |
View this table: [in a new window] |
TABLE 1. Strains used in this study
|
Coimmunoprecipitation assay. Yeast cells grown to mid-log phase (2 liters) were harvested, and extracts were prepared by breaking frozen cell pellets in coffee grinders, followed by thawing frozen cell powder in buffer H-0.3. Extracts were then clarified by ultracentrifugation, yielding approximately 1.5 ml in volume. For immunoprecipitation, 12 (FLAG) or 20 (HA) µg of antibodies was conjugated with 20 or 80 µl, respectively, of Protein G Dynabeads (Dynal) and mixed with approximately 400 µg (100 to 150 µl) of extract for 3 h at 4°C. After beads were washed in buffer H-0.3 five times for 5 min each, bound proteins were eluted by boiling in 20 µl of sodium dodecyl sulfate-polyacrylamide gel sample buffer. Five microliters of samples was loaded per lane.
RNA analysis. Northern blotting was done as described previously (17) using 30 µg of total RNA per lane. For DNA microarray analysis, RNA was prepared in triplicate (YTT2346, YTT2347, and YTT2348 for the dls1 rpd3 mutant and YTT552 and YTT717 [duplicated] for the isw2 rpd3 mutant). To make data comparable to published results (13), Mata cells were used. Direct comparison of transcriptional profiles of mutants was done as follows. Each RNA sample was labeled separately with Cy3 and Cy5 dyes, and samples from the two mutants were directly competed on PCR-based spotted arrays as described previously (13). For each pair of mutants, analysis was done using a dye swap pair. This was done for three independent RNA samples from each genotype (total of six hybridizations), and the results were normalized by GeneSpring 5.03 software (Silicon Genetics). The full data set for DNA microarray analysis is available at http://www.fhcrc.org/labs/tsukiyama/mcb-supplementary-data/. All DNA microarray analyses were performed at the DNA Array Facility at the Fred Hutchinson Cancer Research Center.
Nucleosome mapping. Nucleosome mapping was done by digestion of chromatin with micrococcal nuclease (MNase) followed by indirect end labeling as described elsewhere (14).
Chromatin immunoprecipitation (CHIP) assay.
The CHIP assay was done as previously described (17) with minor modifications. Briefly, cells (300 ml of culture in yeast extract-peptone-dextrose) were fixed at an optical density at 600 nm of 0.5 by addition of 30 ml of 11% formaldehyde-0.1 M NaCl-1 mM EDTA-50 mM HEPES-KOH, pH 7.6, for 20 min. After quenching for 5 min by addition of 54 ml of 2.5 M glycine, cells were washed and broken by glass beads. Chromatin was precipitated by centrifugation (1 min at 20,800 x g in a microcentrifuge) and washed twice with 1 ml of FA lysis buffer (50 mM HEPES-KOH [pH 7.6], 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate). Chromatin fragments (average,
500 bp) were solubilized by sonication, and insoluble materials were removed by centrifugation. Chromatin corresponding to approximately 40 ml of culture was used per immunoprecipitation with 4 µg of FLAG M2 antibody (Sigma) conjugated with 20 µl of Dynabeads Protein G (Dynal) as described previously (35). After beads were washed three times with FA lysis buffer, twice with FA lysis buffer with 500 mM NaCl, and once with radioimmunoprecipitation assay buffer (10 mM Tris [pH 8.0], 0.25 M LiCl, 0.5% NP-40, 0.5% sodium deoxycholate, 1 mM EDTA), bound proteins were eluted twice with 50 µl of 1-mg/ml peptide (Met-Asp-Tyr-Lys-Asp-His-Asp-Gly-Asp-Tyr-Lys-Asp-His-Asp-Ile-Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) in radioimmunoprecipitation assay buffer. Cross-linking was reversed by incubation of samples at 75°C for 6 h, and DNA was purified by proteinase K digestion followed by organic extractions. A detailed protocol for the CHIP assay is available upon request.
For PCR, the following primers were used: REC104 (+), GTCCTTTAGCTAATAGAGTAAGCC; REC104 (-), ATGGACATGTTGTCCAAGTTGCTG; POT1 (+), TGCTAGTTTTGAACCTATGCCAC; POT1 (-), TATTCACTCTGTACTCAGAGCCAC; STE6 (+), GCGACATAGCTGTTATTACCTACTAG; STE6 (-), GATGAACGGCAATAATGCAACAGT; YPL025C (+), GACAGATACTTGAGCAGATTTTGTGG; and YPL025C (-), CACAGTTTTAGTAGGGTCACCGATA.
YPL025C was identified in a preliminary CHIP analysis on DNA microarray as a locus where Isw2p cross-links significantly less efficiently than at most other chromosomal loci (T. Tsukiyama, unpublished results). PCR was done in the presence of a radioactive nucleotide, and signals were quantified by a phosphorimager (Molecular Dynamics). The signal at each Isw2 target locus was measured relative to that at the YPL025C locus. Three independent immunoprecipitations were performed using two independent chromatin preparations, and the average and standard deviation of the signals were calculated at each locus.
|
|
|---|
) subunit, Dpb3p (Dpb3-like subunit of Isw2 complex 1). This name will be used in the rest of this paper.
![]() View larger version (33K): [in a new window] |
FIG. 1. Identification of two previously unidentified subunits of the Isw2 complex. (A) Silver-stained gel of Isw2p purified by FLAG immunoaffinity chromatography followed by Source Q anionic-exchange chromatography. The identities of Isw2 complex subunits are shown on the right. The asterisk shows contaminants in the preparation. The numbers on the top indicate the fractions from the Source Q column. "Load" corresponds to the fraction from the FLAG immunoaffinity purification step, and "FT" represents the flowthrough fractions. (B) Silver-stained gel of Dls1p (Yjl065cp) purified by FLAG immunoaffinity chromatography followed by the Source Q column. The identities of Isw2 complex subunits are shown on the right. The numbers indicate the fractions from the Source Q column.
|
(32), suggesting that this subunit is shared between pol
and Isw2 complexes. We tested this possibility by a coimmunoprecipitation experiment using a strain in which Dpb4p, Isw2p, and Pol2p were epitope tagged. Pol2p is the catalytic subunit of pol
. As shown in Fig. 2A, immunodepletion of Dpb4p resulted in quantitative precipitation of both Isw2p and Pol2p, showing that Dpb4p is indeed shared by Isw2 and pol
complexes. Since no pol
subunits other than Dpb4p were detected in any large-scale purification of Isw2 described above, we concluded that pol
and Isw2 complexes are not stably associated with each other in vivo. We further confirmed this conclusion by an immunoprecipitation assay. As shown in Fig. 2B, no detectable amount of Isw2p coprecipitated when the pol
subunit Dpb2p was immunoprecipitated from whole-cell extract. These results also suggest that, despite the homology, Dpb3p does not substitute for Dls1p in the Isw2 complex. Our results are consistent with those recently reported by Iida and Araki (20).
![]() ![]() View larger version (53K): [in a new window] |
FIG. 2. Quantitative analyses of interactions between small histone fold proteins in the Isw2 complex. (A) Coimmunoprecipitation assay of Dpb4p with both Pol2p and Isw2p. Dpb4p was immunoprecipitated from extracts prepared from YTT2186 (Dpb4p-6HA Pol2p-3FLAG Isw2p-13Myc) and YTT2133 (Pol2p-3FLAG Isw2p-13Myc) strains, and Dpb4p, Pol2p, and Isw2p were detected by Western blotting. To estimate the degree of depletion of epitope-tagged proteins from YTT2186 extract, serially diluted input materials were run in parallel. (B) Coimmunoprecipitation assay of Dpb2p with Isw2p. Dpb2p was immunoprecipitated from extracts prepared from YTT2756 (Dpb2-3FLAG) and YTT2757 (ISW2-13MYC DPB2-3FLAG) strains, and Isw2p and Dpb2p were detected by Western blotting. (C) Coimmunoprecipitation assay of Dls1p with both Itc1 and Isw2p. Dls1p was immunoprecipitated from extracts prepared from YTT2527 (Dls1p-3FLAG Itc1p-13Myc Isw2p-6HA) and YTT2529 (Itc1p-13Myc Isw2p-6HA) strains, and Dls1p, Itc1p, and Isw2p were detected by Western blotting.
|
Dls1p is required for Isw2-dependent transcriptional repression of some target genes. To gain some insight into the in vivo function of Dls1p, we sought to test its role in Isw2-dependent transcriptional repression. A dls1 null mutant can be used to specifically test the role of this small subunit in the Isw2 complex in vivo, since no other complex containing Dls1p was detected. We first compared transcriptional profiles in isw2 and dls1 mutants by DNA microarray analysis in order to obtain a comprehensive view of the requirement for Dls1p in Isw2 functions in vivo. We have previously reported that the Isw2 complex represses transcription of a wide variety of genes in parallel with the Rpd3-Sin3 complex (13, 17). As a result, the effects of an isw2 rpd3 mutation on transcription are more prominent than those of an isw2 single mutant (13, 17). We therefore used an rpd3 mutant background to sensitize the system. RNA was prepared from independent isw2 rpd3 and dls1 rpd3 strains, and labeled cDNA was directly competed on PCR-based spotted DNA microarrays (see Materials and Methods for details). Data from three independent labeling and hybridization assays were normalized by the GeneSpring software and graphed on a scatter plot to directly compare the profiles of the two mutant strains. As shown in Fig. 3A, signals were generally distributed along a diagonal line, and the vast majority of spots stayed within a twofold difference between the mutants. This result demonstrates that isw2 and dls1 mutations affect transcription in a similar manner, indicating that Dls1p is required for the Isw2 complex to be fully functional at a wide variety of target genes in vivo. Signals for many known Isw2 targets, including early meiotic genes REC104 and SPO13, for example, landed on the diagonal line. The signals for many non-Isw2 targets, such as ACT1, also stayed on the diagonal line as expected. However, Dls1p is not absolutely required for Isw2 to function at all loci, and the degree to which the Isw2 complex depends on Dls1p varies among target genes. For example, we observed that Isw2 target POT1 is expressed at a lower level in a dls1 rpd3 mutant than in an isw2 rpd3 mutant. No particular common functions or regulatory pathways were found among genes whose transcription levels showed more than a twofold difference between the two mutants.
![]() View larger version (40K): [in a new window] |
FIG. 3. Requirement for Dls1p in Isw2-dependent effects on transcription. (A) Direct comparison of transcriptional profiles in isw2 rpd3 and dls1 rpd3 cells by DNA microarray analysis. Signals (pixels) normalized from six independent hybridizations were plotted. x axis, isw2 rpd3 mutant; y axis, dls1 rpd3 mutant. Note that the signals are represented by the number of pixels detected, rather than the ratio of expression to that of wild-type cells. The numbers of pixels detected are proportional to the strength of signals, hence the abundance of RNA molecules. The line in the center represents identical signals from each mutant. The two outside lines represent a twofold difference between the mutants. The two dots that are most distant from the diagonal line represent ISW2 and YJL064W genes. YJL064W is a dubious open reading frame that overlaps with the DLS1 gene (YJL065C). The DLS1 gene itself was eliminated from this analysis because of high local backgrounds in the batch of DNA microarrays used. (B) Northern blot analysis of Isw2 target genes. The genotypes of the cells used are indicated on the top. Listed vertically on the right of each blot is the gene being probed. The number under each band indicates the fold change in expression level relative to wild-type cells as determined with a phosphorimager. Signals were normalized for a loading control, ACT1. (C) Epistasis analysis of ISW2 and DLS1 genes by Northern blotting. (D) Northern blot analysis of Mata-specific genes STE2 and STE6 in Mat isw2 and dls1 mutants. As an internal positive control, the REC104 gene was also probed. WT, wild type.
|
It was recently found that the Isw2 complex is also required for repression of Mata-specific genes in Mat
cells (40; Gelbart and Tsukiyama, unpublished) (Fig. 3D). However, a dls1 mutation did not derepress the Mata-specific genes STE2 and STE6 to detectable levels (Fig. 3D), thus showing that Mata-specific genes are exceptions to the general requirement of Dls1p for Isw2 function in vivo.
Dls1p is partially required for Isw2-dependent chromatin remodeling in vivo. The differential effects of a dls1 mutation on the expression of Isw2 target genes prompted us to test the effects of this mutation on the chromatin structure of these genes. The positions of nucleosomes were determined at these loci by MNase digestion of chromatin followed by indirect end labeling. At the REC104 locus, a few nucleosomes were shifted in position in an isw2 mutant compared to wild-type cells as previously described (17). A dls1 mutant showed nucleosome positions similar to those of an isw2 mutant (Fig. 4A). The most prominent difference between the two mutants was that MNase digestion was less intense in the promoter region of the dls1 mutant (note the bracketed region in Fig. 4A). This result demonstrates that the Isw2 complex requires Dls1p for much of its function at this locus.
![]() View larger version (53K): [in a new window] |
FIG. 4. Requirement for Dls1p in Isw2-dependent chromatin regulation. (A) Nucleosome mapping at the REC104 locus. The genotypes of cells used are indicated on the top. "N" stands for naked DNA control. The bracket on the right shows the region where differences in MNase sensitivities were observed between isw2 and dls1 mutants. (B) Nucleosome mapping at the POT1 locus. The arrowheads indicate the sites where a dls1 mutant exhibits a mixture of mutant and wild-type patterns. (C) Nucleosome mapping at the STE6 locus. The arrowheads indicate the sites where a dls1 mutant exhibits a mixture of mutant and wild-type patterns. The bracket shows the region where wild-type and dls1 cells have the same MNase digestion pattern, which is distinct from that of an isw2 mutant. WT, wild type.
|
At the STE6 locus, we have found that chromatin structure around the promoter region is different in wild-type and isw2 cells (Gelbart and Tsukiyama, unpublished) (Fig. 4C). While STE6 transcription was not affected in a dls1 mutant (Fig. 3D), MNase digestion at the promoter region exhibited a mixture of the wild-type and isw2 mutant patterns, as indicated by arrows. This result demonstrates a partial requirement for Dls1p in Isw2-dependent chromatin remodeling around the promoter region of this gene. The isw2 mutant showed an altered chromatin structure in an upstream region of STE6, as indicated by a bracket. However, the dls1 mutant exhibited wild-type chromatin structure in this region, showing that the requirements for Dls1p in Isw2 complex function can differ at two loci separated by a short distance. These results collectively show differing requirements for Dls1p in Isw2-dependent chromatin remodeling at various loci in vivo.
Dls1p is not required for the Isw2 complex to interact with chromatin. We next employed CHIP assays to test whether the Isw2 complex requires Dls1p for interaction with chromatin or, rather, at steps following chromatin interaction in vivo. To this end, we used strains carrying Isw2p with three copies of the FLAG epitope tag (Isw2-3FLAG) in wild-type and dls1 mutant backgrounds, as well as a strain with a FLAG-tagged Dls1p (Dls1-3FLAG). As shown in Fig. 5, CHIP signals above background were detected at the REC104, POT1, and STE6 genes with both Isw2-3FLAG and Dls1p-3FLAG strains, and a dls1 mutation did not significantly affect the CHIP signals of Isw2-3FLAG at these loci. This result shows that Dls1p does not affect the interaction of the Isw2 complex with chromatin as measured by the CHIP assay. In addition, the strength of the CHIP signals of Isw2p and Dls1p did not correlate with the strength of the effects of a dls1 mutation on chromatin structure or on transcriptional repression at Isw2 targets. Taken together, the results of the CHIP analyses suggest that Dls1p does not affect interaction of the Isw2 complex with chromatin and is likely required for functions of the Isw2 complex subsequent to chromatin binding. We, however, cannot rule out the possibility that Dls1p affects association of Isw2 with chromatin at loci that are yet to be tested.
![]() View larger version (55K): [in a new window] |
FIG. 5. CHIP analysis of Isw2p and Dls1p. The relevant genotypes of the strains are shown on the top. The numbers indicate the averages and standard deviations of the CHIP signals at each locus relative to those at a control (YPL025C) locus. See Materials and Methods for the selection of the YPL025C locus as a control locus. As a control 100-fold (POT1 and STE6)- or 400-fold (REC104)-diluted input DNA from each strain was used.
|
|
|
|---|
As Dpb4p is shared by Isw2 and pol
complexes, and Dls1p and Dpb3p are homologous, it is possible that these small histone fold proteins play similar roles in the two complexes. Dpb3p and Dpb4p form a heterodimer in the pol
complex that interacts with a heterodimer of Dpb2p and Pol2p, the subunits essential for cell viability (12). The precise functions of Dpb3p and Dpb4p in pol
in vivo have not been identified, but recent reports suggest their roles in DNA replication and repair: transcription of the DPB3 gene is cell cycle regulated, peaking during S phase (2), and a dpb4 mutation shows strong synthetic growth defects when combined with mutations in DNA replication and repair enzymes (32). Taken together with the fact that the DPB3 and DPB4 genes are not essential for cell viability, these results suggest regulatory roles for Dpb3p and Dpb4p in pol
functions. Given the high degree of homology between the small histone fold proteins in ISWI complexes and pol
, one possibility is that these proteins fulfill similar functions required for the two complexes, such as interactions with DNA or with specific sets of chromatin proteins.
Our transcriptional profiling and Northern blot analyses revealed that Dls1p is required for the Isw2-dependent transcriptional effect on most genes. However, the extent of this requirement varies among different Isw2 target genes. For example, repression of early meiotic genes by Isw2 is largely dependent on Dls1p, but the POT1 gene only partially requires Dls1p for repression. A dls1 mutation did not cause any detectable derepression of STE2 and STE6 in Mat
cells. On the other hand, chromatin structure near the promoter of the STE6 gene was affected in a dls1 mutant, albeit to a lesser degree than in an isw2 mutant. This implies that the reason that STE6 transcription is not affected in a dls1 mutant is not because Dls1p is dispensable for chromatin remodeling at this gene but rather because chromatin changes at STE6 in a dls1 mutant are not sufficient to cause detectable derepression. In contrast to the STE6 locus, changes in chromatin structure at the REC104 and POT1 genes were consistent with changes in transcriptional levels of these genes. At REC104, chromatin structure was similar in isw2 and dls1 mutants, whereas the POT1 gene was less affected in a dls1 mutant than in an isw2 mutant. Chromatin was more locally affected at the POT1 gene in a dls1 mutant than in an isw2 mutant (one nucleosome versus three). The basis for the differential requirements for Dls1p in Isw2 function at various loci is currently unknown. Since only a part of Isw2p forms a complex with Dpb4p and Dls1p (Fig. 2), one possibility is that the four-subunit (Itc1p-Isw2p-Dpb4p-Dls1p) and two-subunit (Itc1p-Isw2p) Isw2 complexes are differentially targeted to these loci. For example, if the two-subunit complex is preferentially recruited to function at POT1 and STE6 loci, the effects of a dls1 mutation would be more subtle than those of an isw2 mutation. However, the results of the CHIP assay in Fig. 5 are not consistent with this possibility.
CHIP analysis showed that a dls1 mutation does not affect the CHIP signals of Isw2p at any of the three loci tested. CHIP signals of Dls1p did not correlate with the requirement of Dls1p in chromatin regulation at these loci either. These results suggest that Dls1p is not required for association of the Isw2 complex with its target genes as measured by the CHIP assay. Rather, it is likely that Dls1p affects the activity of the Isw2 complex at steps following its association with chromatin at these loci. Therefore, identification of the steps at which Dls1p is required for Isw2 function will help us to further dissect the process of Isw2-dependent chromatin remodeling.
This work was supported by National Institutes of Health grant GM58465 to T.T. M.E.G. is supported by a predoctoral fellowship from HHMI. T.T. is a Leukemia and Lymphoma Society scholar.
|
|
|---|
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»