MCB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McConnell, A. D.
Right arrow Articles by Tsukiyama, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McConnell, A. D.
Right arrow Articles by Tsukiyama, T.
Molecular and Cellular Biology, April 2004, p. 2605-2613, Vol. 24, No. 7
0270-7306/04/$08.00+0     DOI: 10.1128/MCB.24.7.2605-2613.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Histone Fold Protein Dls1p Is Required for Isw2-Dependent Chromatin Remodeling In Vivo

Audrey D. McConnell,1 Marnie E. Gelbart,1,2 and Toshio Tsukiyama1*

Division of Basic Sciences, Fred Hutchinson Cancer Research Center, Seattle, Washington 98109,1 Molecular and Cellular Biology Program, Fred Hutchinson Cancer Research Center and University of Washington, Seattle, Washington 981952

Received 9 October 2003/ Returned for modification 9 November 2003/ Accepted 11 January 2004


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We report the identification of two new subunits of the Isw2 chromatin-remodeling complex in Saccharomyces cerevisiae. Both proteins, Dpb4p and Yjl065cp (named Dls1p), contain histone fold motifs and are homologous to the two smallest subunits of ISWI-containing CHRAC complexes in higher eukaryotes. Dpb4p is also a subunit of the DNA polymerase epsilon (pol{varepsilon}) complex, and Dls1p is homologous to another pol{varepsilon} subunit, Dpb3p. Therefore, these small histone fold proteins may fulfill functions that are required for both pol{varepsilon} and Isw2 complexes. We characterized the role of Dls1p in known roles of the Isw2 complex in vivo. Transcriptional analyses reveal that the Isw2 complex requires Dls1p to various degrees at a wide variety of loci in vivo. Consistent with this, Dls1p is required for Isw2-dependent chromatin remodeling in vivo, although the requirement for this protein varies among Isw2 targets. Dls1p is likely required for functions of the Isw2 complex at steps subsequent to its interaction with chromatin, since a dls1 mutation does not affect cross-linking of Isw2 with chromatin.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Chromatin structure in eukaryotic nuclei in vivo imposes restrictions on a wide variety of protein-DNA interactions, causing inhibition of cellular processes that depend upon these interactions. As a consequence, the regulation of chromatin structure can modulate these processes both positively and negatively. Consistent with this idea, it has become clear that chromatin-remodeling factors play critical roles in the regulation of a wide variety of nuclear processes. There are two major classes of chromatin-remodeling factors, histone-modifying enzymes and ATP-dependent chromatin-remodeling complexes. Among the histone modifications described so far, histone acetylation, methylation, and phosphorylation have been the most extensively studied because of their close correlation with transcription, DNA repair, and chromatin dynamics (23, 24, 33, 37).

Biochemical and genetic studies have identified several ATP-dependent chromatin-remodeling complexes from a wide variety of eukaryotic organisms (4, 31, 45). These complexes exhibit numerous biochemical activities, including ATPase activity, nucleosome sliding activity, and nucleosome assembly activity, and the ability to modify histone-DNA contacts. They are grouped into different classes according to the ATPase subunit found in each complex, including SWI/SNF, ISWI, CHD1, and INO80. The ISWI class of ATPases has been evolutionarily well conserved. It has been identified in mammals (5, 6, 34, 39), Xenopus laevis (10, 18, 26, 30), Drosophila melanogaster (21, 41, 43), and the budding yeast Saccharomyces cerevisiae (42). This high degree of evolutionary conservation strongly argues for critical functions of ISWI chromatin-remodeling factors in vivo.

The biological functions of some ISWI chromatin-remodeling factors have just begun to be uncovered. In Drosophila, the ISWI gene is essential for cell viability, and ISWI mutant embryos die at late larval or early pupal stages (11). One of the most striking phenotypes of ISWI mutants is a massive deformation of the X chromosome in male flies (11), which requires the presence of an active dosage compensation complex (8). NURF, one of three ISWI-containing complexes in Drosophila, is responsible for both cell viability and maintenance of chromosome architecture in males (3). The connection between ISWI remodeling factors and higher-order chromatin structure appears to be evolutionarily conserved. In mammalian cells, ISWI-containing complexes are targeted to heterochromatin (6) and are required for its replication (7) and silencing (38). In addition, ISWI complexes are implicated in loading of cohesin complex (19) and functions of matrix association regions (46).

ISWI-containing CHRAC complexes in higher eukaryotes contain two small histone fold proteins that are evolutionarily conserved (9, 34). Recent studies revealed that the human CHRAC and DNA polymerase epsilon (pol{varepsilon}) complexes share a small histone fold subunit (28, 34). This finding led to the proposal that functions of ISWI complexes in heterochromatin may be mediated by the subunits containing histone fold motifs (7). However, the roles of these histone fold proteins in vivo have not been identified.

Our laboratory has shown that one of the two ISWI proteins in yeast, Isw2p, forms a complex that is required for repression of early meiotic genes during mitotic cell growth (17). Our group further demonstrated that Isw2 and Rpd3-Sin3 histone deacetylase complexes collaborate to repress a wide variety of genes (13, 17). In addition, the Isw2 complex is required for repression of Mata-specific genes in Mat{alpha} cells (40; M. E. Gelbart and T. Tsukiyama, unpublished data). Consistent with these results in yeast, Drosophila ISWI protein and RNA polymerase II localize in a mutually exclusive manner on polytene chromosomes (11), and a mammalian ISWI complex, No-RC, represses ribosomal DNA transcription (48). Isw1p, another ISWI protein in yeast, forms two complexes (44) that affect nucleosome position at a number of loci in vivo (25) and are involved in transcriptional termination together with the Isw2 complex and another chromatin-remodeling factor, Chd1p (1).

In this work, we describe the identification of two new subunits of the Isw2 complex, Dpb4p and Yjl065cp (named Dls1p). Dpb4p has previously been identified as a nonessential subunit of pol{varepsilon}, whereas Dls1p has not been previously characterized. However, Dls1p is homologous to another nonessential subunit of pol{varepsilon}, Dpb3p. Dpb4p and Dls1p have histone fold motifs and are homologous to the smallest subunits of CHRAC complexes in higher eukaryotes. Our studies reveal that Dls1p plays critical roles in Isw2-dependent repression of a wide variety of genes in vivo, including early meiotic genes. However, Dls1p is only partially required for repression of some genes, including POT1, and is dispensable for repression of Mata-specific genes in Mat{alpha} cells. Chromatin analyses reveal that Dls1p is required for formation of normal repressive chromatin structure at each of these loci, although the degree to which the Isw2 complex depends on Dls1p varies among Isw2 targets. Chromatin immunoprecipitation analyses suggest that Dls1p is likely required for functions of Isw2 at steps subsequent to its interaction with chromatin.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Yeast strains. All strains are congenic to W303 and were derived from W1588-4A and W1588-4C (47). The strains used in this study are listed in Table 1. The following epitope tags were used to mark Isw2 and pol{varepsilon} subunits as previously described: three-FLAG (16), TAP (36), six-hemagglutinin (HA) (27), and 13-Myc (29) tags.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Strains used in this study

 
Purification of Isw2 complex. Isw2p was purified via the TAP tag (36) or three-FLAG tag (16) followed by a Source Q column (42) or a glycerol gradient (15 to 35% in buffer H [42], 20 h at 49,000 rpm in an SW55 rotor). Dls1p was tagged by a three-FLAG epitope and purified by immunoaffinity chromatography, followed by a Source Q column (0.2 ml) as described previously (42).

Coimmunoprecipitation assay. Yeast cells grown to mid-log phase (2 liters) were harvested, and extracts were prepared by breaking frozen cell pellets in coffee grinders, followed by thawing frozen cell powder in buffer H-0.3. Extracts were then clarified by ultracentrifugation, yielding approximately 1.5 ml in volume. For immunoprecipitation, 12 (FLAG) or 20 (HA) µg of antibodies was conjugated with 20 or 80 µl, respectively, of Protein G Dynabeads (Dynal) and mixed with approximately 400 µg (100 to 150 µl) of extract for 3 h at 4°C. After beads were washed in buffer H-0.3 five times for 5 min each, bound proteins were eluted by boiling in 20 µl of sodium dodecyl sulfate-polyacrylamide gel sample buffer. Five microliters of samples was loaded per lane.

RNA analysis. Northern blotting was done as described previously (17) using 30 µg of total RNA per lane. For DNA microarray analysis, RNA was prepared in triplicate (YTT2346, YTT2347, and YTT2348 for the dls1 rpd3 mutant and YTT552 and YTT717 [duplicated] for the isw2 rpd3 mutant). To make data comparable to published results (13), Mata cells were used. Direct comparison of transcriptional profiles of mutants was done as follows. Each RNA sample was labeled separately with Cy3 and Cy5 dyes, and samples from the two mutants were directly competed on PCR-based spotted arrays as described previously (13). For each pair of mutants, analysis was done using a dye swap pair. This was done for three independent RNA samples from each genotype (total of six hybridizations), and the results were normalized by GeneSpring 5.03 software (Silicon Genetics). The full data set for DNA microarray analysis is available at http://www.fhcrc.org/labs/tsukiyama/mcb-supplementary-data/. All DNA microarray analyses were performed at the DNA Array Facility at the Fred Hutchinson Cancer Research Center.

Nucleosome mapping. Nucleosome mapping was done by digestion of chromatin with micrococcal nuclease (MNase) followed by indirect end labeling as described elsewhere (14).

Chromatin immunoprecipitation (CHIP) assay. The CHIP assay was done as previously described (17) with minor modifications. Briefly, cells (300 ml of culture in yeast extract-peptone-dextrose) were fixed at an optical density at 600 nm of 0.5 by addition of 30 ml of 11% formaldehyde-0.1 M NaCl-1 mM EDTA-50 mM HEPES-KOH, pH 7.6, for 20 min. After quenching for 5 min by addition of 54 ml of 2.5 M glycine, cells were washed and broken by glass beads. Chromatin was precipitated by centrifugation (1 min at 20,800 x g in a microcentrifuge) and washed twice with 1 ml of FA lysis buffer (50 mM HEPES-KOH [pH 7.6], 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate). Chromatin fragments (average, ~500 bp) were solubilized by sonication, and insoluble materials were removed by centrifugation. Chromatin corresponding to approximately 40 ml of culture was used per immunoprecipitation with 4 µg of FLAG M2 antibody (Sigma) conjugated with 20 µl of Dynabeads Protein G (Dynal) as described previously (35). After beads were washed three times with FA lysis buffer, twice with FA lysis buffer with 500 mM NaCl, and once with radioimmunoprecipitation assay buffer (10 mM Tris [pH 8.0], 0.25 M LiCl, 0.5% NP-40, 0.5% sodium deoxycholate, 1 mM EDTA), bound proteins were eluted twice with 50 µl of 1-mg/ml peptide (Met-Asp-Tyr-Lys-Asp-His-Asp-Gly-Asp-Tyr-Lys-Asp-His-Asp-Ile-Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) in radioimmunoprecipitation assay buffer. Cross-linking was reversed by incubation of samples at 75°C for 6 h, and DNA was purified by proteinase K digestion followed by organic extractions. A detailed protocol for the CHIP assay is available upon request.

For PCR, the following primers were used: REC104 (+), GTCCTTTAGCTAATAGAGTAAGCC; REC104 (-), ATGGACATGTTGTCCAAGTTGCTG; POT1 (+), TGCTAGTTTTGAACCTATGCCAC; POT1 (-), TATTCACTCTGTACTCAGAGCCAC; STE6 (+), GCGACATAGCTGTTATTACCTACTAG; STE6 (-), GATGAACGGCAATAATGCAACAGT; YPL025C (+), GACAGATACTTGAGCAGATTTTGTGG; and YPL025C (-), CACAGTTTTAGTAGGGTCACCGATA.

YPL025C was identified in a preliminary CHIP analysis on DNA microarray as a locus where Isw2p cross-links significantly less efficiently than at most other chromosomal loci (T. Tsukiyama, unpublished results). PCR was done in the presence of a radioactive nucleotide, and signals were quantified by a phosphorimager (Molecular Dynamics). The signal at each Isw2 target locus was measured relative to that at the YPL025C locus. Three independent immunoprecipitations were performed using two independent chromatin preparations, and the average and standard deviation of the signals were calculated at each locus.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Identification of two previously unidentified Isw2 subunits. A large-scale purification of the Isw2 complex by FLAG immunoaffinity chromatography followed by a Source Q anionic-exchange column showed Isw2p to copurify with two previously unidentified proteins (Fig. 1A). A FLAG tag on Isw2p does not disturb the functions of the Isw2 complex, as Isw2 target genes remain repressed in the tagged strain (data not shown). These proteins were identified as Dpb4p and Yjl065cp by mass spectrometry. Association of these two proteins with Isw2p was confirmed by an independent purification of Isw2p via TAP tag followed by mass spectrometry analysis, as well as by an independent purification of the Isw2 complex by FLAG immunoaffinity chromatography and a glycerol gradient (data not shown). To further confirm the association of Dpb4p and Yjl065cp with Isw2, we directly purified Yjl065cp via FLAG immunoaffinity chromatography followed by a Source Q anionic-exchange column (Fig. 1B), which yielded a four-subunit Isw2 complex (Itc1p, Isw2p, Dpb4p, and Yjl065cp) and no other proteins at a detectable level. This result confirms the presence of Yjl065cp and Dpb4p in the Isw2 complex. In addition, it suggests that Yjl065cp is predominantly present in the Isw2 complex in the conditions under which cells were grown. It is likely that our group (42) and others (15) previously failed to identify these small subunits due to their low molecular weights and because they do not stain well by silver staining. Dpb4p and Yjl065cp were independently identified as Isw2 subunits by Iida and Araki (20), and Yjl065cp was named Dls1p since it is homologous to a DNA polymerase epsilon (pol{varepsilon}) subunit, Dpb3p (Dpb3-like subunit of Isw2 complex 1). This name will be used in the rest of this paper.



View larger version (33K):
[in this window]
[in a new window]
 
FIG. 1. Identification of two previously unidentified subunits of the Isw2 complex. (A) Silver-stained gel of Isw2p purified by FLAG immunoaffinity chromatography followed by Source Q anionic-exchange chromatography. The identities of Isw2 complex subunits are shown on the right. The asterisk shows contaminants in the preparation. The numbers on the top indicate the fractions from the Source Q column. "Load" corresponds to the fraction from the FLAG immunoaffinity purification step, and "FT" represents the flowthrough fractions. (B) Silver-stained gel of Dls1p (Yjl065cp) purified by FLAG immunoaffinity chromatography followed by the Source Q column. The identities of Isw2 complex subunits are shown on the right. The numbers indicate the fractions from the Source Q column.

 
While Dls1p has been previously uncharacterized, Dpb4p was identified as a nonessential subunit of pol{varepsilon} (32), suggesting that this subunit is shared between pol{varepsilon} and Isw2 complexes. We tested this possibility by a coimmunoprecipitation experiment using a strain in which Dpb4p, Isw2p, and Pol2p were epitope tagged. Pol2p is the catalytic subunit of pol{varepsilon}. As shown in Fig. 2A, immunodepletion of Dpb4p resulted in quantitative precipitation of both Isw2p and Pol2p, showing that Dpb4p is indeed shared by Isw2 and pol{varepsilon} complexes. Since no pol{varepsilon} subunits other than Dpb4p were detected in any large-scale purification of Isw2 described above, we concluded that pol{varepsilon} and Isw2 complexes are not stably associated with each other in vivo. We further confirmed this conclusion by an immunoprecipitation assay. As shown in Fig. 2B, no detectable amount of Isw2p coprecipitated when the pol{varepsilon} subunit Dpb2p was immunoprecipitated from whole-cell extract. These results also suggest that, despite the homology, Dpb3p does not substitute for Dls1p in the Isw2 complex. Our results are consistent with those recently reported by Iida and Araki (20).




View larger version (53K):
[in this window]
[in a new window]
 
FIG. 2. Quantitative analyses of interactions between small histone fold proteins in the Isw2 complex. (A) Coimmunoprecipitation assay of Dpb4p with both Pol2p and Isw2p. Dpb4p was immunoprecipitated from extracts prepared from YTT2186 (Dpb4p-6HA Pol2p-3FLAG Isw2p-13Myc) and YTT2133 (Pol2p-3FLAG Isw2p-13Myc) strains, and Dpb4p, Pol2p, and Isw2p were detected by Western blotting. To estimate the degree of depletion of epitope-tagged proteins from YTT2186 extract, serially diluted input materials were run in parallel. (B) Coimmunoprecipitation assay of Dpb2p with Isw2p. Dpb2p was immunoprecipitated from extracts prepared from YTT2756 (Dpb2-3FLAG) and YTT2757 (ISW2-13MYC DPB2-3FLAG) strains, and Isw2p and Dpb2p were detected by Western blotting. (C) Coimmunoprecipitation assay of Dls1p with both Itc1 and Isw2p. Dls1p was immunoprecipitated from extracts prepared from YTT2527 (Dls1p-3FLAG Itc1p-13Myc Isw2p-6HA) and YTT2529 (Itc1p-13Myc Isw2p-6HA) strains, and Dls1p, Itc1p, and Isw2p were detected by Western blotting.

 
Figure 2A also suggests the presence of Isw2p and Pol2p populations that are not associated with Dpb4p, as a significant portion of Pol2p and Isw2p remained soluble after Dpb4p was immunodepleted. To address if this is the case for Isw2p, we next tested the extent to which Isw2p and Itc1p stably associate with Dls1p by a coimmunoprecipitation experiment using a strain in which Itc1p, Isw2p, and Dls1p were epitope tagged. As shown in Fig. 2C, immunodepletion of Dls1p resulted in a partial depletion of both Isw2p and Itc1p, suggesting the presence of Isw2p and Itc1p populations that do not stably interact with Dls1p. This is consistent with the data in Fig. 1A, in which the two-subunit (fractions 15 and 16) and four-subunit (fractions 17 to 20) Isw2 complexes were separated by anionic-exchange chromatography. These results collectively suggest that Isw2p is likely present in two forms in vivo, the four-subunit (Itc1p-Isw2p-Dpb4p-Dls1p) and two-subunit (Itc1p-Isw2p) complexes. The four- and two-subunit Isw2 complexes resemble CHRAC (9, 43) and ACF (21, 22) complexes, respectively, in higher eukaryotes that share ISWI and ACF1 subunits. We, however, cannot rule out the possibility that the four-subunit complex was destabilized by epitope tagging, immunoprecipitation, or chromatographic procedures to form the two-subunit complex.

Dls1p is required for Isw2-dependent transcriptional repression of some target genes. To gain some insight into the in vivo function of Dls1p, we sought to test its role in Isw2-dependent transcriptional repression. A dls1 null mutant can be used to specifically test the role of this small subunit in the Isw2 complex in vivo, since no other complex containing Dls1p was detected. We first compared transcriptional profiles in isw2 and dls1 mutants by DNA microarray analysis in order to obtain a comprehensive view of the requirement for Dls1p in Isw2 functions in vivo. We have previously reported that the Isw2 complex represses transcription of a wide variety of genes in parallel with the Rpd3-Sin3 complex (13, 17). As a result, the effects of an isw2 rpd3 mutation on transcription are more prominent than those of an isw2 single mutant (13, 17). We therefore used an rpd3 mutant background to sensitize the system. RNA was prepared from independent isw2 rpd3 and dls1 rpd3 strains, and labeled cDNA was directly competed on PCR-based spotted DNA microarrays (see Materials and Methods for details). Data from three independent labeling and hybridization assays were normalized by the GeneSpring software and graphed on a scatter plot to directly compare the profiles of the two mutant strains. As shown in Fig. 3A, signals were generally distributed along a diagonal line, and the vast majority of spots stayed within a twofold difference between the mutants. This result demonstrates that isw2 and dls1 mutations affect transcription in a similar manner, indicating that Dls1p is required for the Isw2 complex to be fully functional at a wide variety of target genes in vivo. Signals for many known Isw2 targets, including early meiotic genes REC104 and SPO13, for example, landed on the diagonal line. The signals for many non-Isw2 targets, such as ACT1, also stayed on the diagonal line as expected. However, Dls1p is not absolutely required for Isw2 to function at all loci, and the degree to which the Isw2 complex depends on Dls1p varies among target genes. For example, we observed that Isw2 target POT1 is expressed at a lower level in a dls1 rpd3 mutant than in an isw2 rpd3 mutant. No particular common functions or regulatory pathways were found among genes whose transcription levels showed more than a twofold difference between the two mutants.



View larger version (40K):
[in this window]
[in a new window]
 
FIG. 3. Requirement for Dls1p in Isw2-dependent effects on transcription. (A) Direct comparison of transcriptional profiles in isw2 rpd3 and dls1 rpd3 cells by DNA microarray analysis. Signals (pixels) normalized from six independent hybridizations were plotted. x axis, isw2 rpd3 mutant; y axis, dls1 rpd3 mutant. Note that the signals are represented by the number of pixels detected, rather than the ratio of expression to that of wild-type cells. The numbers of pixels detected are proportional to the strength of signals, hence the abundance of RNA molecules. The line in the center represents identical signals from each mutant. The two outside lines represent a twofold difference between the mutants. The two dots that are most distant from the diagonal line represent ISW2 and YJL064W genes. YJL064W is a dubious open reading frame that overlaps with the DLS1 gene (YJL065C). The DLS1 gene itself was eliminated from this analysis because of high local backgrounds in the batch of DNA microarrays used. (B) Northern blot analysis of Isw2 target genes. The genotypes of the cells used are indicated on the top. Listed vertically on the right of each blot is the gene being probed. The number under each band indicates the fold change in expression level relative to wild-type cells as determined with a phosphorimager. Signals were normalized for a loading control, ACT1. (C) Epistasis analysis of ISW2 and DLS1 genes by Northern blotting. (D) Northern blot analysis of Mata-specific genes STE2 and STE6 in Mat{alpha} isw2 and dls1 mutants. As an internal positive control, the REC104 gene was also probed. WT, wild type.

 
Transcription of some Isw2 targets was confirmed by Northern blot analysis using isw2, dls1, isw2 rpd3, and dls1 rpd3 mutants. Figure 3B shows that dls1 and isw2 mutations caused comparable derepression of REC104 and SPO13 in both single and double mutants. A nonmeiotic ISW2 target, RAD51 (13), was also similarly affected by dls1 and isw2 mutations. Consistent with DNA microarray results, POT1 was significantly less affected by a dls1 mutation than by an isw2 mutation, showing a partial requirement for Dls1p in Isw2 function at this locus. Our epistasis analysis shown in Fig. 3C revealed that the Isw2 target gene REC104 was similarly derepressed in an isw2 dls1 rpd3 triple mutant and in both isw2 rpd3 and dls1 rpd3 double mutants. This result is consistent with our conclusion from biochemical analyses that Dls1p exists exclusively in the Isw2 complex.

It was recently found that the Isw2 complex is also required for repression of Mata-specific genes in Mat{alpha} cells (40; Gelbart and Tsukiyama, unpublished) (Fig. 3D). However, a dls1 mutation did not derepress the Mata-specific genes STE2 and STE6 to detectable levels (Fig. 3D), thus showing that Mata-specific genes are exceptions to the general requirement of Dls1p for Isw2 function in vivo.

Dls1p is partially required for Isw2-dependent chromatin remodeling in vivo. The differential effects of a dls1 mutation on the expression of Isw2 target genes prompted us to test the effects of this mutation on the chromatin structure of these genes. The positions of nucleosomes were determined at these loci by MNase digestion of chromatin followed by indirect end labeling. At the REC104 locus, a few nucleosomes were shifted in position in an isw2 mutant compared to wild-type cells as previously described (17). A dls1 mutant showed nucleosome positions similar to those of an isw2 mutant (Fig. 4A). The most prominent difference between the two mutants was that MNase digestion was less intense in the promoter region of the dls1 mutant (note the bracketed region in Fig. 4A). This result demonstrates that the Isw2 complex requires Dls1p for much of its function at this locus.



View larger version (53K):
[in this window]
[in a new window]
 
FIG. 4. Requirement for Dls1p in Isw2-dependent chromatin regulation. (A) Nucleosome mapping at the REC104 locus. The genotypes of cells used are indicated on the top. "N" stands for naked DNA control. The bracket on the right shows the region where differences in MNase sensitivities were observed between isw2 and dls1 mutants. (B) Nucleosome mapping at the POT1 locus. The arrowheads indicate the sites where a dls1 mutant exhibits a mixture of mutant and wild-type patterns. (C) Nucleosome mapping at the STE6 locus. The arrowheads indicate the sites where a dls1 mutant exhibits a mixture of mutant and wild-type patterns. The bracket shows the region where wild-type and dls1 cells have the same MNase digestion pattern, which is distinct from that of an isw2 mutant. WT, wild type.

 
In contrast to the REC104 locus, two major differences in chromatin structure were observed in comparing dls1 and isw2 mutants at the POT1 locus (Fig. 4B). As reported previously (13), the positions of three nucleosomes are changed in an isw2 mutant in comparison to wild-type cells. The position of only one MNase cleavage site was affected in a dls1 mutant, however. In addition, MNase cleavage at the edge of the affected nucleosome showed a mixture of the wild-type and mutant patterns as marked by arrows. This suggests that mutation of DLS1 results in a mixed population of cells, approximately half of which harbor the wild-type chromatin structure while the other half have one nucleosome shifted in position.

At the STE6 locus, we have found that chromatin structure around the promoter region is different in wild-type and isw2 cells (Gelbart and Tsukiyama, unpublished) (Fig. 4C). While STE6 transcription was not affected in a dls1 mutant (Fig. 3D), MNase digestion at the promoter region exhibited a mixture of the wild-type and isw2 mutant patterns, as indicated by arrows. This result demonstrates a partial requirement for Dls1p in Isw2-dependent chromatin remodeling around the promoter region of this gene. The isw2 mutant showed an altered chromatin structure in an upstream region of STE6, as indicated by a bracket. However, the dls1 mutant exhibited wild-type chromatin structure in this region, showing that the requirements for Dls1p in Isw2 complex function can differ at two loci separated by a short distance. These results collectively show differing requirements for Dls1p in Isw2-dependent chromatin remodeling at various loci in vivo.

Dls1p is not required for the Isw2 complex to interact with chromatin. We next employed CHIP assays to test whether the Isw2 complex requires Dls1p for interaction with chromatin or, rather, at steps following chromatin interaction in vivo. To this end, we used strains carrying Isw2p with three copies of the FLAG epitope tag (Isw2-3FLAG) in wild-type and dls1 mutant backgrounds, as well as a strain with a FLAG-tagged Dls1p (Dls1-3FLAG). As shown in Fig. 5, CHIP signals above background were detected at the REC104, POT1, and STE6 genes with both Isw2-3FLAG and Dls1p-3FLAG strains, and a dls1 mutation did not significantly affect the CHIP signals of Isw2-3FLAG at these loci. This result shows that Dls1p does not affect the interaction of the Isw2 complex with chromatin as measured by the CHIP assay. In addition, the strength of the CHIP signals of Isw2p and Dls1p did not correlate with the strength of the effects of a dls1 mutation on chromatin structure or on transcriptional repression at Isw2 targets. Taken together, the results of the CHIP analyses suggest that Dls1p does not affect interaction of the Isw2 complex with chromatin and is likely required for functions of the Isw2 complex subsequent to chromatin binding. We, however, cannot rule out the possibility that Dls1p affects association of Isw2 with chromatin at loci that are yet to be tested.



View larger version (55K):
[in this window]
[in a new window]
 
FIG. 5. CHIP analysis of Isw2p and Dls1p. The relevant genotypes of the strains are shown on the top. The numbers indicate the averages and standard deviations of the CHIP signals at each locus relative to those at a control (YPL025C) locus. See Materials and Methods for the selection of the YPL025C locus as a control locus. As a control 100-fold (POT1 and STE6)- or 400-fold (REC104)-diluted input DNA from each strain was used.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this paper, we described the identification of new subunits of the S. cerevisiae Isw2 complex that contain histone fold motifs. The two proteins, Dpb4p and Dls1p, are homologous to small subunits of Drosophila and mammalian CHRAC complexes. Therefore, Dpb4p and Dls1p are the only ISWI subunits, with the exception of the ISWI ATPases, that are highly conserved from yeast to mammalian cells. Another Isw2 subunit, Itc1p (16), shares the WAC motif with Drosophila and mammalian ACF1, a subunit of CHRAC and ACF complexes (22). However, no significant homology was detected outside of the WAC motif between Itc1p and ACF1. None of the three Isw1 subunits, Ioc2p, Ioc3p, and Ioc4p, share detectable homology with ISWI subunits in higher eukaryotes, with the exception of a PHD finger-like structure in Ioc2p (44). Conservation of small histone fold proteins in ISWI complexes during evolution is consistent with the possibility that these proteins play important roles in vivo. However, the functions of these proteins have not been reported either in vivo or in vitro.

As Dpb4p is shared by Isw2 and pol{varepsilon} complexes, and Dls1p and Dpb3p are homologous, it is possible that these small histone fold proteins play similar roles in the two complexes. Dpb3p and Dpb4p form a heterodimer in the pol{varepsilon} complex that interacts with a heterodimer of Dpb2p and Pol2p, the subunits essential for cell viability (12). The precise functions of Dpb3p and Dpb4p in pol{varepsilon} in vivo have not been identified, but recent reports suggest their roles in DNA replication and repair: transcription of the DPB3 gene is cell cycle regulated, peaking during S phase (2), and a dpb4 mutation shows strong synthetic growth defects when combined with mutations in DNA replication and repair enzymes (32). Taken together with the fact that the DPB3 and DPB4 genes are not essential for cell viability, these results suggest regulatory roles for Dpb3p and Dpb4p in pol{varepsilon} functions. Given the high degree of homology between the small histone fold proteins in ISWI complexes and pol{varepsilon}, one possibility is that these proteins fulfill similar functions required for the two complexes, such as interactions with DNA or with specific sets of chromatin proteins.

Our transcriptional profiling and Northern blot analyses revealed that Dls1p is required for the Isw2-dependent transcriptional effect on most genes. However, the extent of this requirement varies among different Isw2 target genes. For example, repression of early meiotic genes by Isw2 is largely dependent on Dls1p, but the POT1 gene only partially requires Dls1p for repression. A dls1 mutation did not cause any detectable derepression of STE2 and STE6 in Mat{alpha} cells. On the other hand, chromatin structure near the promoter of the STE6 gene was affected in a dls1 mutant, albeit to a lesser degree than in an isw2 mutant. This implies that the reason that STE6 transcription is not affected in a dls1 mutant is not because Dls1p is dispensable for chromatin remodeling at this gene but rather because chromatin changes at STE6 in a dls1 mutant are not sufficient to cause detectable derepression. In contrast to the STE6 locus, changes in chromatin structure at the REC104 and POT1 genes were consistent with changes in transcriptional levels of these genes. At REC104, chromatin structure was similar in isw2 and dls1 mutants, whereas the POT1 gene was less affected in a dls1 mutant than in an isw2 mutant. Chromatin was more locally affected at the POT1 gene in a dls1 mutant than in an isw2 mutant (one nucleosome versus three). The basis for the differential requirements for Dls1p in Isw2 function at various loci is currently unknown. Since only a part of Isw2p forms a complex with Dpb4p and Dls1p (Fig. 2), one possibility is that the four-subunit (Itc1p-Isw2p-Dpb4p-Dls1p) and two-subunit (Itc1p-Isw2p) Isw2 complexes are differentially targeted to these loci. For example, if the two-subunit complex is preferentially recruited to function at POT1 and STE6 loci, the effects of a dls1 mutation would be more subtle than those of an isw2 mutation. However, the results of the CHIP assay in Fig. 5 are not consistent with this possibility.

CHIP analysis showed that a dls1 mutation does not affect the CHIP signals of Isw2p at any of the three loci tested. CHIP signals of Dls1p did not correlate with the requirement of Dls1p in chromatin regulation at these loci either. These results suggest that Dls1p is not required for association of the Isw2 complex with its target genes as measured by the CHIP assay. Rather, it is likely that Dls1p affects the activity of the Isw2 complex at steps following its association with chromatin at these loci. Therefore, identification of the steps at which Dls1p is required for Isw2 function will help us to further dissect the process of Isw2-dependent chromatin remodeling.


    ACKNOWLEDGMENTS
 
We thank Tom Fazzio for technical assistance in indirect end labeling, Phil Gafken for mass spectrometry analysis, Jeff Delrow for assistance in DNA microarray analysis, and Hiro Araki for sharing results before publication. We also thank Hiro Araki, Tom Fazzio, Jack Vincent, Kim Wachter, and Iestyn Whitehouse for comments on this paper.

This work was supported by National Institutes of Health grant GM58465 to T.T. M.E.G. is supported by a predoctoral fellowship from HHMI. T.T. is a Leukemia and Lymphoma Society scholar.


    FOOTNOTES
 
* Corresponding author. Mailing address: Division of Basic Sciences, Fred Hutchinson Cancer Research Center, Mail Stop A1-162, 1100 Fairview Ave. North, Seattle, WA 98109-1024. Phone: (206) 667-4996. Fax: (206) 667-6497. E-mail: ttsukiya{at}fhcrc.org. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Alen, C., N. A. Kent, H. S. Jones, J. O'Sullivan, A. Aranda, and N. J. Proudfoot. 2002. A role for chromatin remodeling in transcriptional termination by RNA polymerase II. Mol. Cell 10:1441-1452.[CrossRef][Medline]

2. Araki, H., R. K. Hamatake, A. Morrison, A. L. Johnson, L. H. Johnston, and A. Sugino. 1991. Cloning DPB3, the gene encoding the third subunit of DNA polymerase II of Saccharomyces cerevisiae. Nucleic Acids Res. 19:4867-4872.[Abstract/Free Full Text]

3. Badenhorst, P., M. Voas, I. Rebay, and C. Wu. 2002. Biological functions of the ISWI chromatin remodeling complex NURF. Genes Dev. 16:3186-3198.[Abstract/Free Full Text]

4. Becker, P. B., and W. Horz. 2002. ATP-dependent nucleosome remodeling. Annu. Rev. Biochem. 71:247-273.[CrossRef][Medline]

5. Bochar, D. A., J. Savard, W. Wang, D. W. Lafleur, P. Moore, J. Cote, and R. Shiekhattar. 2000. A family of chromatin remodeling factors related to Williams syndrome transcription factor. Proc. Natl. Acad. Sci. USA 97:1038-1043.[Abstract/Free Full Text]

6. Bozhenok, L., P. A. Wade, and P. Varga-Weisz. 2002. WSTF-ISWI chromatin remodeling complex targets heterochromatic replication foci. EMBO J. 21:2231-2241.[CrossRef][Medline]

7. Collins, N., R. A. Poot, I. Kukimoto, C. Garcia-Jimenez, G. Dellaire, and P. D. Varga-Weisz. 2002. An ACF1-ISWI chromatin-remodeling complex is required for DNA replication through heterochromatin. Nat. Genet. 32:627-632.[CrossRef][Medline]

8. Corona, D. F., C. R. Clapier, P. B. Becker, and J. W. Tamkun. 2002. Modulation of ISWI function by site-specific histone acetylation. EMBO Rep. 3:242-247.[CrossRef][Medline]

9. Corona, D. F., A. Eberharter, A. Budde, R. Deuring, S. Ferrari, P. Varga-Weisz, M. Wilm, J. Tamkun, and P. B. Becker. 2000. Two histone fold proteins, CHRAC-14 and CHRAC-16, are developmentally regulated subunits of chromatin accessibility complex (CHRAC). EMBO J. 19:3049-3059.[CrossRef][Medline]

10. Demeret, C., S. Bocquet, J. M. Lemaitre, P. Francon, and M. Mechali. 2002. Expression of ISWI and its binding to chromatin during the cell cycle and early development. J. Struct. Biol. 140:57-66.[CrossRef][Medline]

11. Deuring, R., L. Fanti, J. A. Armstrong, M. Sarte, O. Papoulas, M. Prestel, G. Daubresse, M. Verardo, S. L. Moseley, M. Berloco, T. Tsukiyama, C. Wu, S. Pimpinelli, and J. W. Tamkun. 2000. The ISWI chromatin-remodeling protein is required for gene expression and the maintenance of higher order chromatin structure in vivo. Mol. Cell 5:355-365.[CrossRef][Medline]

12. Dua, R., S. Edwards, D. L. Levy, and J. L. Campbell. 2000. Subunit interactions within the Saccharomyces cerevisiae DNA polymerase epsilon (pol epsilon) complex. Demonstration of a dimeric pol epsilon. J. Biol. Chem. 275:28816-28825.[Abstract/Free Full Text]

13. Fazzio, T. G., C. Kooperberg, J. P. Goldmark, C. Neal, R. Basom, J. Delrow, and T. Tsukiyama. 2001. Widespread collaboration of Isw2 and Sin3-Rpd3 chromatin remodeling complexes in transcriptional repression. Mol. Cell. Biol. 21:6450-6460.[Abstract/Free Full Text]

14. Fazzio, T. G., and T. Tsukiyama. 2003. Chromatin remodeling in vivo: evidence for a nucleosome sliding mechanism. Mol. Cell 12:1333-1340.[CrossRef][Medline]

15. Gavin, A. C., M. Bosche, R. Krause, P. Grandi, M. Marzioch, A. Bauer, J. Schultz, J. M. Rick, A. M. Michon, C. M. Cruciat, M. Remor, C. Hofert, M. Schelder, M. Brajenovic, H. Ruffner, A. Merino, K. Klein, M. Hudak, D. Dickson, T. Rudi, V. Gnau, A. Bauch, S. Bastuck, B. Huhse, C. Leutwein, M. A. Heurtier, R. R. Copley, A. Edelmann, E. Querfurth, V. Rybin, G. Drewes, M. Raida, T. Bouwmeester, P. Bork, B. Seraphin, B. Kuster, G. Neubauer, and G. Superti-Furga. 2002. Functional organization of the yeast proteome by systematic analysis of protein complexes. Nature 415:141-147.[CrossRef][Medline]

16. Gelbart, M. E., T. Rechsteiner, T. J. Richmond, and T. Tsukiyama. 2001. Interactions of Isw2 chromatin remodeling complex with nucleosomal arrays: analyses using recombinant yeast histones and immobilized templates. Mol. Cell. Biol. 21:2098-2106.[Abstract/Free Full Text]

17. Goldmark, J. P., T. G. Fazzio, P. W. Estep, G. M. Church, and T. Tsukiyama. 2000. The Isw2 chromatin remodeling complex represses early meiotic genes upon recruitment by Ume6p. Cell 103:423-433.[CrossRef][Medline]

18. Guschin, D., T. M. Geiman, N. Kikyo, D. J. Tremethick, A. P. Wolffe, and P. A. Wade. 2000. Multiple ISWI ATPase complexes from Xenopus laevis. Functional conservation of an ACF/CHRAC homolog. J. Biol. Chem. 275:35248-35255.[Abstract/Free Full Text]

19. Hakimi, M. A., D. A. Bochar, J. A. Schmiesing, Y. Dong, O. G. Barak, D. W. Speicher, K. Yokomori, and R. Shiekhattar. 2002. A chromatin remodelling complex that loads cohesin onto human chromosomes. Nature 418:994-998.[CrossRef][Medline]

20. Iida, T., and H. Araki. 2004. Noncompetitive counteractions of DNA polymerase epsilon and ISW2/yCHRAC for epigenetic inheritance of telomere position effect in Saccharomyces cerevisiae. Mol. Cell. Biol. 24:217-227.[Abstract/Free Full Text]

21. Ito, T., M. Bulger, M. J. Pazin, R. Kobayashi, and J. T. Kadonaga. 1997. ACF, an ISWI-containing and ATP-utilizing chromatin assembly and remodeling factor. Cell 90:145-155.[CrossRef][Medline]

22. Ito, T., M. E. Levenstein, D. V. Fyodorov, A. K. Kutach, R. Kobayashi, and J. T. Kadonaga. 1999. ACF consists of two subunits, Acf1 and ISWI, that function cooperatively in the ATP-dependent catalysis of chromatin assembly. Genes Dev. 13:1529-1539.[Abstract/Free Full Text]

23. Jenuwein, T., and C. D. Allis. 2001. Translating the histone code. Science 293:1074-1080.[Abstract/Free Full Text]

24. Kadam, S., and B. M. Emerson. 2002. Mechanisms of chromatin assembly and transcription. Curr. Opin. Cell Biol. 14:262-268.[CrossRef][Medline]

25. Kent, N. A., N. Karabetsou, P. K. Politis, and J. Mellor. 2001. In vivo chromatin remodeling by yeast ISWI homologs Isw1p and Isw2p. Genes Dev. 15:619-626.[Abstract/Free Full Text]

26. Kikyo, N., P. A. Wade, D. Guschin, H. Ge, and A. P. Wolffe. 2000. Active remodeling of somatic nuclei in egg cytoplasm by the nucleosomal ATPase ISWI. Science 289:2360-2362.[Abstract/Free Full Text]

27. Knop, M., K. Siegers, G. Pereira, W. Zachariae, B. Winsor, K. Nasmyth, and E. Schiebel. 1999. Epitope tagging of yeast genes using a PCR-based strategy: more tags and improved practical routines. Yeast 15:963-972.[CrossRef][Medline]

28. Li, Y., Z. F. Pursell, and S. Linn. 2000. Identification and cloning of two histone fold motif-containing subunits of HeLa DNA polymerase epsilon. J. Biol. Chem. 275:23247-23252.[Abstract/Free Full Text]

29. Longtine, M. S., A. McKenzie III, D. J. Demarini, N. G. Shah, A. Wach, A. Brachat, P. Philippsen, and J. R. Pringle. 1998. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14:953-961.[CrossRef][Medline]

30. MacCallum, D. E., A. Losada, R. Kobayashi, and T. Hirano. 2002. ISWI remodeling complexes in Xenopus egg extracts: identification as major chromosomal components that are regulated by INCENP-aurora B. Mol. Biol. Cell 13:25-39.[Abstract/Free Full Text]

31. Narlikar, G. J., H. Y. Fan, and R. E. Kingston. 2002. Cooperation between complexes that regulate chromatin structure and transcription. Cell 108:475-487.[CrossRef][Medline]

32. Ohya, T., S. Maki, Y. Kawasaki, and A. Sugino. 2000. Structure and function of the fourth subunit (Dpb4p) of DNA polymerase epsilon in Saccharomyces cerevisiae. Nucleic Acids Res. 28:3846-3852.[Abstract/Free Full Text]

33. Peterson, C. L. 2002. Chromatin remodeling enzymes: taming the machines. Third in review series on chromatin dynamics. EMBO Rep. 3:319-322.[CrossRef][Medline]

34. Poot, R. A., G. Dellaire, B. B. Hulsmann, M. A. Grimaldi, D. F. Corona, P. B. Becker, W. A. Bickmore, and P. D. Varga-Weisz. 2000. HuCHRAC, a human ISWI chromatin remodelling complex, contains hACF1 and two novel histone-fold proteins. EMBO J. 19:3377-3387.[CrossRef][Medline]

35. Ren, B., F. Robert, J. J. Wyrick, O. Aparicio, E. G. Jennings, I. Simon, J. Zeitlinger, J. Schreiber, N. Hannett, E. Kanin, T. L. Volkert, C. J. Wilson, S. P. Bell, and R. A. Young. 2000. Genome-wide location and function of DNA binding proteins. Science 290:2306-2309.[Abstract/Free Full Text]

36. Rigaut, G., A. Shevchenko, B. Rutz, M. Wilm, M. Mann, and B. Seraphin. 1999. A generic protein purification method for protein complex characterization and proteome exploration. Nat. Biotechnol. 17:1030-1032.[CrossRef][Medline]

37. Roth, S. Y., J. M. Denu, and C. D. Allis. 2001. Histone acetyltransferases. Annu. Rev. Biochem. 70:81-120.[CrossRef][Medline]

38. Santoro, R., J. Li, and I. Grummt. 2002. The nucleolar remodeling complex NoRC mediates heterochromatin formation and silencing of ribosomal gene transcription. Nat. Genet. 32:393-396.[CrossRef][Medline]

39. Strohner, R., A. Nemeth, P. Jansa, U. Hofmann-Rohrer, R. Santoro, G. Langst, and I. Grummt. 2001. NoRC—a novel member of mammalian ISWI-containing chromatin remodeling machines. EMBO J. 20:4892-4900.[CrossRef][Medline]

40. Sugiyama, M., and J. Nikawa. 2001. The Saccharomyces cerevisiae Isw2p-Itc1p complex represses INO1 expression and maintains cell morphology. J. Bacteriol. 183:4985-4993.[Abstract/Free Full Text]

41. Tsukiyama, T., C. Daniel, J. Tamkun, and C. Wu. 1995. ISWI, a member of the SWI2/SNF2 ATPase family, encodes the 140 kDa subunit of the nucleosome remodeling factor. Cell 83:1021-1026.[CrossRef][Medline]

42. Tsukiyama, T., J. Palmer, C. C. Landel, J. Shiloach, and C. Wu. 1999. Characterization of the imitation switch subfamily of ATP-dependent chromatin-remodeling factors in Saccharomyces cerevisiae. Genes Dev. 13:686-697.[Abstract/Free Full Text]

43. Varga-Weisz, P. D., M. Wilm, E. Bonte, K. Dumas, M. Mann, and P. B. Becker. 1997. Chromatin-remodelling factor CHRAC contains the ATPases ISWI and topoisomerase II. Nature 388:598-602.[CrossRef][Medline]

44. Vary, J. C., Jr., V. K. Gangaraju, J. Qin, C. C. Landel, C. Kooperberg, B. Bartholomew, and T. Tsukiyama. 2003. Yeast Isw1p forms two separable complexes in vivo. Mol. Cell. Biol. 23:80-91.[Abstract/Free Full Text]

45. Vignali, M., A. H. Hassan, K. E. Neely, and J. L. Workman. 2000. ATP-dependent chromatin-remodeling complexes. Mol. Cell. Biol. 20:1899-1910.[Free Full Text]

46. Yasui, D., M. Miyano, S. Cai, P. Varga-Weisz, and T. Kohwi-Shigematsu. 2002. SATB1 targets chromatin remodelling to regulate genes over long distances. Nature 419:641-645.[CrossRef][Medline]

47. Zhao, X., E. G. Muller, and R. Rothstein. 1998. A suppressor of two essential checkpoint genes identifies a novel protein that negatively affects dNTP pools. Mol. Cell 2:329-340.[CrossRef][Medline]

48. Zhou, Y., R. Santoro, and I. Grummt. 2002. The chromatin remodeling complex NoRC targets HDAC1 to the ribosomal gene promoter and represses RNA polymerase I transcription. EMBO J. 21:4632-4640.[CrossRef][Medline]


Molecular and Cellular Biology, April 2004, p. 2605-2613, Vol. 24, No. 7
0270-7306/04/$08.00+0     DOI: 10.1128/MCB.24.7.2605-2613.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McConnell, A. D.
Right arrow Articles by Tsukiyama, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McConnell, A. D.
Right arrow Articles by Tsukiyama, T.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. J. Virol. Eukaryot. Cell
Microbiol. Mol. Biol. Rev. Clin. Vaccine Immunol. All ASM Journals